CN115010813A

CN115010813A - Enterovirus 71 type virus-like particle, preparation method and application thereof

Info

Publication number: CN115010813A
Application number: CN202210555594.7A
Authority: CN
Inventors: 刘启亮; 朱寒钰; 刘洪波; 章�宁; 王婧; 甘燕媚
Original assignee: Guilin Medical University
Current assignee: Guilin Medical University
Priority date: 2022-05-19
Filing date: 2022-05-19
Publication date: 2022-09-06
Anticipated expiration: 2042-05-19
Also published as: CN115010813B

Abstract

The invention discloses an enterovirus 71 type virus-like particle, a preparation method and application thereof, and belongs to the technical field of genetic engineering and biological medicine. The enterovirus 71 type virus-like particle is obtained by infecting SF9 insect cells with recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene, and culturing to obtain more than 90% of SF9 insect cells infected with lesions. The invention also discloses a preparation method and application of the enterovirus 71 type virus-like particle. Compared with the wild type enterovirus 71 type virus particles, the enterovirus 71 type virus-like particles have completely similar appearance structure and size, do not contain virus nucleic acid, have no replication and infection capacity, have the function of stimulating the innate and adaptive immune response of a host, and have higher in-vitro assembly efficiency.

Description

Enterovirus 71 type virus-like particle, preparation method and application thereof

Technical Field

The invention relates to an enterovirus 71 type virus-like particle, a preparation method and application thereof, belonging to the technical field of genetic engineering and biological medicine.

Background

Hand-foot-and-mouth disease (HFMD) is a common infectious disease caused by infection of more than twenty enteroviruses (Enterovirus, EV), and only Enterovirus A group 71 (EV-A71) monovalent inactivated vaccine is on the market at present. The EV-A71 type monovalent inactivated vaccine cannot generate cross protection against other types of enteroviruses. In recent years, the non-EV-A71 enterovirus infection rate of CV-A16, CV-A10 and the like has increased year by year. In the prior art, multiple bivalent EV-A71/CV-A16 inactivated or VLP vaccines exist, the multivalent vaccines are mostly simple mixtures of different antigens, have better immunogenicity, and can induce and generate multiple protections, but the successful development of one multivalent vaccine needs strict and complex processes of strain screening, strain domestication, virus culture and the like, so that the development period is long, the cost is high, the production process has biological safety risks, and the requirement of emergency prevention and control of new emergent infectious diseases cannot be met.

Enterovirus group a type 71 (EV-a71) is an icosahedral spherical particle, 24-30nm in diameter, the viral genome comprising about 7.5kb bases, with only one open reading frame, a 5 'untranslated region and a 3' untranslated region, wherein the open reading frame encodes a polyprotein of about 2193 amino acids that can be hydrolyzed to 3 precursor proteins: p1, P2 and P3. Wherein capsid protein precursor P1 can be cleaved into VP1, VP2, VP3 and VP4 and assembled into a viral capsid in a cell. The cleavage by capsid protein precursor P3 to produce 3C and 3D proteases plays a major role in the cleavage of capsid protein precursor P1. VP1 contains important epitopes that neutralize the virus, has antigenicity, and plays an important role in the function of the virus. Research shows that the cell expresses P1 and 3CD simultaneously, can form EV-A71 Virus-like particles (VLPs), has the size and the shape similar to those of EV-A71 wild-type Virus, does not contain Virus nucleic acid, has no replication and infection capacity, maintains the natural conformation of EV-A71 wild-type Virus antigen protein, and has the functions of stimulating the innate and adaptive immune response of a host. Three human vaccines based on VLPs are currently officially approved for the prevention of hepatitis b virus, human papilloma virus and hepatitis e virus. No enterovirus-associated VLPs vaccine has yet been marketed.

The neutralizing epitope is a special small molecular peptide on the surface of the virus antigen protein, and can stimulate an organism to generate effective and specific neutralizing immune protection reaction. The major epitope of enterovirus has been proved to be located on VP1, and the current research has reported that EV-A71 VP1 linear neutralization epitope includes 163 rd to 177 th amino acid epitope peptide, 208 th to 222 th amino acid epitope peptide, 253 rd to 267 th amino acid epitope peptide and the like, and CV-A16 VP1 epitope includes 109 th to 123 th amino acid epitope peptide, 163 th to 177 th amino acid epitope peptide, 187 th to 202 th amino acid epitope peptide, 271 th to 285 th amino acid epitope peptide and the like. CV-A10 VP1 linear neutralizing epitope peptide, at present, has not been reported.

At present, no report exists for constructing trivalent epitope chimeric EV-A71 virus-like particles by simultaneously replacing corresponding positions of wild enterovirus EV-A71P 1 with two CV-A10 epitopes and one CV-A16 epitope.

Disclosure of Invention

An object of the present invention is to provide an enterovirus 71 type virus-like particle.

The technical scheme for solving the technical problems is as follows: an enterovirus 71 type virus-like particle is obtained by infecting SF9 insect cells with recombinant baculovirus expressing a P1 capsid protein gene and a 3CD protease gene of an enterovirus 71 type and culturing to obtain more than 90% of SF9 insect cells infected with lesions.

The enterovirus 71 type virus-like particle has the beneficial effects that:

1. compared with the wild type enterovirus 71 type virus particles, the enterovirus 71 type virus-like particles have completely similar appearance structure and size, do not contain virus nucleic acid, have no replication and infection capacity, have the function of stimulating the innate and adaptive immune response of a host, and have higher in-vitro assembly efficiency.

2. The enterovirus 71 type virus-like particle of the invention reserves the natural conformation of most wild enterovirus 71 type virus particle antigen proteins and reserves the immunogenicity and immunoprotection aiming at the enterovirus 71 type.

3. The enterovirus 71 virus-like particles of the invention also increase the protection efficiency against CV-A16 and CV-A10, which are 20% and 40%, respectively, thus increasing the protection range of the vaccine.

On the basis of the technical scheme, the invention can be further improved as follows.

Further, the preparation method of the recombinant baculovirus expressing the enterovirus 71 type P1 capsid protein gene and the 3CD protease gene comprises the following steps:

p1 capsid protein gene EV-A71-P1 of enterovirus 71 optimized by SF9 insect cell preference codon ^CHI3 And A3 CD protease gene optimized by SF9 insect cell preference codon, and is connected with a shuttle vector pOET5 of the insect baculovirus to obtain a recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD；

Then the recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD and insect baculovirus genome Flash-BAC DNA co-transfect SF9 insect cells, and after culturing more than 90% of SF9 insect cells to infect and lesion, obtaining recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene;

wherein, the nucleotide sequence of the P1 capsid protein gene of the enterovirus 71 which is optimized by the preferred codons of the SF9 insect cells is shown as SEQ ID NO. 1; the nucleotide sequence of the SF9 insect cell preference codon optimized 3CD protease gene is shown in SEQ ID NO. 2.

The adoption of the further beneficial effects is as follows: by adopting the method, the recombinant baculovirus expressing the enterovirus 71 type P1 capsid protein gene and the 3CD protease gene can be prepared.

Furthermore, the SF9 insect cell preference codon-optimized P1 capsid protein gene EV-A71-P1 of enterovirus 71 ^CHI3 The preparation method comprises the following steps:

respectively optimizing the VP1 linear neutralization epitope of the first CV-A10, the VP1 linear neutralization epitope of the second CV-A10 and the VP1 linear neutralization epitope of CV-A16 by SF9 insect cell preference codons, and then respectively substituting the positions from 1969 to 2016, from 2179 to 2223 and from 2314 to 2367 of the wild-type enterovirus 71-type P1 capsid protein gene;

the nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID No.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID No.4, the nucleotide sequence of the VP1 linear neutralization epitope after codon preference optimization of SF9 insect cells is shown as SEQ ID No.5, and the nucleotide sequence of the wild-type enterovirus 71-type P1 capsid protein gene is shown as SEQ ID No. 6.

The adoption of the method has the further beneficial effects that: the inventor of the invention studied and identified CV-A10 VP1 linear neutralizing epitope including nucleotides 1969 to 2016 and 2179 to 2223 in advance. The invention selects two neutralizing epitopes of CV-A10 to carry out codon optimization respectively. One neutralizing epitope peptide of CV-A16 was selected for codon optimization.

According to the invention, the wild enterovirus 71 type virus-like particle is used as a framework for the first time, the neutralizing epitope optimized by the three codons is embedded, the trivalent virus-like particle is constructed, and the protective efficiency of CA16 and CA10 is enhanced while the immunogenicity and the immunoprotection of the enterovirus 71 type are maintained.

Another object of the present invention is to provide a method for producing the above enterovirus 71 type virus-like particle.

The technical scheme for solving the technical problems is as follows: the preparation method of the enterovirus 71 type virus-like particle comprises the following steps:

step 1: construction of recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD

Respectively carrying out SF9 insect cell preference codon optimization on a VP1 linear neutralization epitope of a first CV-A10, a VP1 linear neutralization epitope of a second CV-A10 and a VP1 linear neutralization epitope of CV-A16, and then respectively substituting positions 1969 to 2016, 2179 to 2223 and 2314 to 2367 of a P1 capsid protein gene of a wild-type enterovirus 71 to obtain the P1 capsid protein gene-A71-P1 EV 1 of the enterovirus 71, which is subjected to SF9 insect cell preference codon optimization ^CHI3 ；

Carrying out SF9 insect cell preference codon optimization on the 3CD protease gene;

p1 capsid protein gene EV-A71-P1 of enterovirus 71 optimized by SF9 insect cell preference codon ^CHI3 And cloning the 3CD protease gene optimized by the SF9 insect cell preference codon to an EcoRI/Not I enzyme cutting site behind a P10 promoter of a shuttle vector pOET5 of the insect baculovirus and a BamHI/XhoI enzyme cutting site behind a polh promoter respectively to construct a recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD；

Wherein the nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralization epitope of CV-A16 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.5, the nucleotide sequence of the P1 capsid protein gene of the wild enterovirus 71 type is shown as SEQ ID NO.6, and the P1 capsid protein gene EV-A71-P1 of the enterovirus 71 type after codon optimization is shown as SEQ ID NO.6 ^CHI3 The nucleotide sequence of (A) is shown as SEQ ID NO.1, and the nucleotide sequence of the SF9 insect cell preferred codon optimized 3CD protease gene is shown as SEQ ID NO. 2;

step 2: construction of recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD

The recombinant plasmid pOET5-EV-A71-P1 obtained in the step 1 ^CHI3 The-3 CD and insect baculovirus genome Flash-BAC DNA are cotransfected with SF9 insect cells, and the P1 capsid protein gene and the 3CD gene are integrated into the insect baculovirus genome to obtain the recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD；

And 3, step 3: preparation and purification of Virus-like particles

Recombinant baculovirus rBV-EV-A71-P1 obtained by SF9 insect cell amplification step 2 ^CHI3 And (3) infecting SF9 insect cells, culturing until more than 90% of SF9 insect cells infect lesion, collecting supernatant and purifying the supernatant to obtain the enterovirus 71 type virus-like particles.

The principle of the preparation method of the enterovirus 71 type virus-like particles is as follows:

in step 1 of the present invention, the shuttle vector pOET5 for insect baculovirus, was purchased from Oxford Expression Technologies. The P1 capsid protein gene EV-A71-P1 of enterovirus 71 after codon optimization ^CHI3 And the codon optimized 3CD protease gene are cloned to an EcoRI/Not I enzyme cutting site behind a P10 promoter of a shuttle vector pOET5 of the insect baculovirus and a BamHI/Xho I enzyme cutting site behind a polh promoter respectively through chemical synthesis to construct a recombinant plasmid pOET5-EV-A71-P1 ^CHI3 3CD, this step is performed by the Huada gene.

In step 2 of the invention, the recombinant plasmid pOET5-EV-A71-P1 obtained in step 1 is taken ^CHI3 3CD, co-transfecting SF9 insect cells with insect baculovirus genome Flash-BAC DNA, so that the P1 protein gene and the 3CD protease gene of enterovirus 71 can be integrated into the insect baculovirus genome and produce the recombinant insect baculovirus. And infecting new SF9 insect cells to obtain live recombinant insect baculovirus with enlarged culture and high titer.

Insect baculovirus genome Flash-BAC DNA, commercially available, such as available from Oxford Expression Technologies, Inc., UK.

SF9 insect cells, a potent host cell for insect baculovirus, are commercially available, e.g., from Invitrogen corporation, USA.

In step 2 of the present invention, an insect cell transfection reagent is used for transfection, and the insect cell transfection reagent is commercially available, for example, from Invitrogen corporation, USA under the name Cellffectin II.

In conclusion, the invention constructs EV-A71P 1 which can simultaneously express and embed three heterologous epitopes on the basis of insect baculovirus-insect cell expression system ^CHI3 Recombinant baculovirus of protein gene and 3CD protease gene, digested with 3CD protease in cell P1 ^CHI3 And (3) spontaneously assembling proteins into trivalent enterovirus 71 type virus empty shells with heterologous epitopes. The trivalent enterovirus 71 virus empty shell can be released into culture supernatant.

The preparation method of the enterovirus 71 type virus-like particle has the beneficial effects that:

1. the production process of the invention is simple, and the prepared enterovirus 71 type virus-like particles do not contain virus genetic material, so that inactivation treatment is not needed.

2. The invention can culture and infect SF9 insect cells by shaking a flask, thereby producing the enterovirus 71 type virus-like particles in a large scale and further producing the enterovirus 71 type virus-like particle vaccine.

Further, in step 3, the recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD infection of SF9 insect cells with multiplicity of infection MOI of 3, said SF9 insect cells all having a density of 2X 10 ⁶ /mL。

The adoption of the further beneficial effects is as follows: by adopting the complex number of infection, the exogenous enterovirus 71-type P1 can be efficiently expressed ^CHI3 Protein gene and 3CD protease gene, and releasing the automatically assembled enterovirus 71 type virus-like particles into a cell culture solution.

Further, in the step 3, the temperature of the culture is 27 ℃, the shaking speed is 110 r/min, and the time is 5d-6 d.

The adoption of the further beneficial effects is as follows: using the above parameters, expression P1 was obtained after culturing ^CHI3 Structural proteins and 3CD protease, which are automatically assembled into an empty shell of enterovirus 71 in a host cell, namely trivalent enterovirus 71 virus-like particles (EV-A71-VLP) ^CHI3 ) A protein.

Further, in step 3, the specific method for purification is:

step 3.1: concentrating the supernatant

Mixing the supernatant with 20 wt% PEG8000 and 0.6M NaCl solution at equal volume, stirring at 4 deg.C overnight, centrifuging at 8000 rpm for 30min, removing supernatant, collecting protein precipitate, and resuspending the protein precipitate with PBS buffer to obtain virus concentrate; the PBS buffer solution contains KH ₂ PO ₄ 2mM、Na ₂ HPO ₄ 8mM, NaCl 136mM and KCl 2.6mM, pH 7.2;

step 3.2: sucrose density gradient ultracentrifugation

Respectively preparing sucrose solutions with the mass percentage concentrations of 30%, 45% and 60%, performing density gradient ultracentrifugation on the virus concentrated solution obtained in the step 3.1, performing centrifugation at 290,000 rpm for 60min, and collecting milky white substances at the junction of 30% and 45% and the junction of 45% and 60%, namely the enterovirus 71 type virus-like particles.

The adoption of the further beneficial effects is as follows: the off-white material at the 30% to 45% interface and at the 45% to 60% interface, containing purified EV-A71, was collected ^CHI3 A virus-like particle protein. EV-A71 after purification can be determined by BCA (bicinchoninic acid) protein concentration assay ^CHI3 The concentration of the virus-like particle protein for subsequent quantification in an immunoassay.

The third purpose of the invention is to provide an enterovirus 71 type virus-like particle vaccine.

The technical scheme for solving the technical problems is as follows: an enterovirus 71 type virus-like particle vaccine comprises the enterovirus 71 type virus-like particles as an active ingredient or one of the active ingredients.

The enterovirus 71 type virus-like particle vaccine has the beneficial effects that:

1. in the prior art, the multivalent vaccine product for the hand-foot-mouth disease is not provided, only the enterovirus 71 inactivated vaccine is provided, and the invention provides a trivalent enterovirus 71 virus-like particle vaccine.

2. The enterovirus 71 virus-like particle vaccine can cause the immune system of the organism to generate strong response, has strong immunity and long duration, can achieve 100 percent of complete protection on the enterovirus 71, can provide 20 percent of protection against CV-A16 and 40 percent of protection against CV-A10.

3. The enterovirus 71 type virus-like particle vaccine has a shell structure similar to that of a wild enterovirus 71 type virus, but has no virus activity and no infectivity, so the enterovirus 71 type virus-like particle vaccine is very safe and effective. The production process does not need special environmental control (such as a plant with biological safety level 2 or 3) to prevent virus leakage, and does not need inactivation treatment.

4. The enterovirus 71 type virus-like particle vaccine has short production period and is completely suitable for the rapid multi-mutation characteristic of the enterovirus. It takes only 6-8 weeks from the isolation of the structural protein genes of the mutant strains to the production of the vaccine.

Furthermore, the dosage form of the enterovirus 71 type virus-like particle vaccine is any one or more of liquid injection, injection powder and injection tablets.

The adoption of the further beneficial effects is as follows: the enterovirus 71 type virus-like particle vaccine can be prepared into various dosage forms, is used for meeting different use requirements, and is more convenient.

Further, the enterovirus 71 virus-like particle vaccine also comprises an adjuvant, wherein the adjuvant is selected from any one or more of an oil adjuvant, an oil-in-water adjuvant, a water-in-oil-in-water adjuvant, an aluminum salt and a polysaccharide adjuvant.

The adoption of the further beneficial effects is as follows: an adjuvant may be formulated together with the enterovirus 71 type virus-like particle of the present invention to make the enterovirus 71 type virus-like particle vaccine of the present invention.

Drawings

FIG. 1 shows that after mice are immunized with VP1 linear neutralization epitope peptide from position 96 to position 104 and amino acid epitope peptide from position 162 to position 176 of CV-A10, the average serum neutralization titers are 1:4 and 1:17.96 respectively.

FIG. 2 shows the construction of recombinant plasmid pOET5-EV-A71-P1 in the examples of the present invention ^CHI3 -3CD flow chart.

FIG. 3 shows a recombinant plasmid pOET5-EV-A71-P1 in an example of the present invention ^CHI3 Schematic representation of 3 CD.

FIG. 4 shows pOET5-EV-A71-P1 in accordance with an embodiment of the present invention ^CHI3 -3CD plasmid cleavage result diagram. Wherein, Lane M is 15000bp molecular weight standard Marker; lane 1 shows linearized pOET5-EV-A71-P1 ^CHI3 -3CD plasmid; lane 2 is the linearized pOET5 plasmid; lane 3 shows pOET5-EV-A71-P1 cleaved with four restriction enzymes, EcoRI, Not I, BamHI and xho I ^CHI3 -3CD。

FIG. 5 shows rBV-EV-A71-P1 in accordance with an embodiment of the present invention ^CHI3 -3CD recombinant baculovirus PCR results. Wherein, Lane M is 15000bp molecular weight standard Marker; lane 1 is a positive control pOET5-EV-A71-P1 ^CHI3 -3CD plasmid; lane 2 is rBV-EV-A71-P1 ^CHI3 -3CD recombinant baculovirus.

FIG. 6 shows infection with rBV-EV-A71-P1 ^CHI3 3CD recombinant baculovirus later, different days SF9 insect cell culture supernatant EV-A71-VLP ^CHI3 Virus-like particle expression profile. Wherein, the Lane M is a protein molecular weight standard Marker; lane PC is the positive control EV-A71 inactivated virus; lanes D1-D6 are SF9 insect cell culture supernatant EV-A71-VLP from day 1 to day 6, respectively ^CHI3 Virus-like particle expression profile.

FIG. 7 shows the purified EV-A71-VLP ^CHI3 And (4) detecting protein. Wherein, the lane PC is a positive control EV-A71 inactivated virus; lane 1 is purified EV-A71-VLP ^CHI3 。

FIG. 8 is a purified EV-A71-VLP ^CHI3 Transmission electron microscope picture of virus particle, the scale bar is 200 nm.

FIG. 9 shows serum specific IgG antibody levels in the sera of immunized mice against the inactivated EV-A71 virus.

FIG. 10 shows serum specific IgG antibody levels in immunized mouse sera against inactivated CA16 virus, data analyzed using the Student's-two-tailed t test.

FIG. 11 is the serum specific IgG antibody levels against CA10 inactivated virus in mouse sera. Data were analyzed using two-tailed t-test (Student's-two-tailed t test) × P < 0.05.

FIG. 12 is EV-A71-VLP ^CHI3 Virus-like particle vaccine and inactivated EV-A71 vaccine immunized mice serum neutralizing antibody titer against EV-A71 virus.

FIG. 13 is EV-A71-VLP ^CHI3 After mice are immunized by the virus-like particle vaccine and the inactivated EV-A71 vaccine, the serum neutralizes antibody titer against CA16 virus. Data were analyzed using the two-tailed t-test (Student's-two-tailed t test).

FIG. 14 is EV-A71-VLP ^CHI3 After mice are immunized by the virus-like particle vaccine and the inactivated EV-A71 vaccine, the serum neutralizes the antibody titer against CA10 virus. Data were analyzed using two-tailed t-test (Student's-two-tailed t test). p<0.05。

FIG. 15 is EV-A71-VLP ^CHI3 And the inactivated EV-A71 vaccine has the protection efficiency against EV-A71 challenge, and the survival rate is 100 percent.

FIG. 16 is EV-A71-VLP ^CHI3 And the inactivated EV-A71 vaccine has the protection efficiency against CA16 challenge, and the survival rate is 20 percent.

FIG. 17 is EV-A71-VLP ^CHI3 And the inactivated EV-A71 vaccine has the protection efficiency against CA10 challenge, and the survival rate is 40%.

Detailed Description

The principles and features of this invention are described below in conjunction with the following detailed drawings, which are given by way of illustration only and are not intended to limit the scope of the invention.

The preparation method of the enterovirus 71 type virus-like particle of the embodiment comprises the following steps:

step 1: the CV-A16 linear neutralization epitope is searched and screened and determined by a PubMed website, amino acid epitope peptides from 271 th to 285 th are selected as substitution epitopes, and the nucleotide sequence of the substitution epitopes after SF9 insect cell preference codon optimization is shown as SEQ ID NO. 5.

The P1 linear neutralizing epitope of CV-A10 studied and identified earlier by the inventors of the present invention includes two epitopes, i.e., 1969 through 2016 th and 2179 through 2223 th nucleotides, which are designated as VP1 linear neutralizing epitope of the first CV-A10 and VP1 linear neutralizing epitope of the second CV-A10, respectively. Serum is obtained after animals are respectively immunized by the two epitope peptides, and a trace neutralization experiment is carried out to prove that the two epitope peptides have the neutralizing capacity to CV-A10, and the average neutralizing titer is 1:4 and 1:17.96 respectively, as shown in figure 1.

Wherein, the nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.3, and the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO. 4.

And 2, step: construction of recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD

As shown in FIG. 2, the VP1 amino acid epitope peptide from 96 th position to 104 th position, the VP 162 amino acid epitope peptide from 162 th position to 176 th position and the VP1 amino acid epitope peptide from 271 th position to 285 th position of CV-A16 are subjected to SF9 insect cell preferred codon optimization respectively, and then, the P1 capsid protein gene EV-A35563268-P1 of the wild-type enterovirus 71 is substituted at the 1969 th position to 2016 th position, the 2179 th position to 2223 th position and the 2314 th position to 2367 th position respectively to obtain the enterovirus 71P 1 capsid protein gene EV-A35563250-P1 optimized by SF 7 insect cell preferred codon ^CHI3 。

The 3CD protease gene is optimized by SF9 insect cell preference codon.

P1 capsid protein gene EV-A71-P1 of enterovirus 71 optimized by SF9 insect cell preference codon ^CHI3 And the 3CD protease gene which is optimized by the preferred codon of the SF9 insect cell is respectively cloned to the insect baculovirusThe EcoRI/Not I cleavage site after the P10 promoter of the shuttle vector pOET5 and the BamHI/Xho I cleavage site after the polh promoter, to construct the recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD。

Wherein the nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralization epitope after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.5, the nucleotide sequence of the P1 capsid protein gene of the wild type enterovirus 71 is shown as SEQ ID NO.6, and the P1 capsid protein gene EV-A71-P1 gene of the codon optimized enterovirus 71 is shown as SEQ ID NO.6 ^CHI3 The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the nucleotide sequence of the SF9 insect cell preference codon optimized 3CD protease gene is shown as SEQ ID NO. 2.

atgggttcccaggtgtccactcaacgttccggttcccacgagaactccaactccgctaccgagggttccaccatcaactacaccaccatcaactactacaaggactcctacgctgctaccgctggtaagcagtccctgaagcaggaccctgacaagttcgctaaccctgtgaaggacatcttcaccgagatggctgctcctctgaagtctccttccgctgaggcttgtggttactccgatcgcgtggctcaactgaccatcggtaactccaccatcaccacccaggaggctgctaacatcatcgtgggttacggtgagtggccttcctactgctccgactccgatgctaccgctgtggacaaacctactcgccctgacgtttccgttaaccgcttctacaccctggacaccaagctgtgggagaagtcctccaagggttggtactggaagttccctgacgtgctgaccgaaaccggtgtgttcggtcagaacgctcagttccactacctgtaccgctccggtttctgcattcacgtgcaatgcaacgcttccaagttccaccagggtgctctgctggtggctgttctgcctgagtacgtgatcggtaccgtggctggtggtactggtaccgaagacacccaccctccttacaagcagacccagcctggtgctgatggtttcgagctgcagcacccttatgtgctggacgctggtatccctatctcccagctgaccgtgtgtcctcaccagtggatcaacctgcgcaccaacaactgcgctaccatcatcgtgccttacatcaacgctctgcctttcgactccgctctgaaccactgtaacttcggtctgctggtggtgcctatttcccctctggactacgatcagggtgctacccctgtgatccctatcaccatcaccctggctcctatgtgctccgagttcgctggtttgcgtcaggctgtgacccaaggtttccctaccgagctgaagcctggtaccaaccagttcctgaccaccgatgacggtgtgtccgctcctatcctgcctaacttccaccctaccccttgcatccacatccctggtgaggtgcgcaatttgctggagctgtgccaagtggagactatcctggaggtgaacaacgtgcctaccaacgctacctccctgatggagcgtctgcgctttcctgtgtccgctcaggctggtaagggtgaactgtgcgctgtgtttcgtgctgaccctggtagaaacggtccttggcaatccaccctgctgggtcaactgtgcggttactacacccagtggtccggttctctggaggtgaccttcatgttcaccggttccttcatggctaccggtaagatgctgatcgcttacacccctcctggtggtcctctgcctaaagaccgtgctaccgctatgttgggtacccacgtgatttgggacctgggtctgcaatcctctgtgaccctggtgatcccttggatctccaacacccactaccgcgctcatgctcgtgatggtgtgttcgactactacaccaccggtctggtgtccatctggtaccagaccaactacgtggtgcctatcggtgctcctaacaccgcttacatcatcgctctggctgctgctcagaagaacttcaccatgaagctgtgcaaggacgcttccgacatcttgcagaccggtaccattcaaggtgaccgcgtggctgatgttatcgagtcctccatcggtgattccgtgtcccgcgctttgactcatgctctgcctgctcctactggtcagaacacccaggtgtcctcccatcgtctggataccggtaaagtgcctgctctgcaggctgctgagattggtgcttcctccaacgcttccgacgagtccatgatcgaaacccgctgcgtgctcaattctcactccaccgctgaaaccactctggactccttcttttcccgcgctggtctggttggtgtggtgaacctgaccgatggtggtactgacaccaccggttatgctacctgggacatcgacatcaccggttacgctcagatgcgccgcaaagtggagctgttcacctacatgcgcttcgacgctgagttcaccttcgtggcttgcactcctactggtgaggtggtgcctcaactgctgcagtacatgttcgtgcctcctggtgctcctaaacctactggtcgcgacgctttccaatggcagaccgctactaacccttccgtgttcgtgaagctgtccgaccctcctgctcaagtgtccgtgcctttcatgtcccctgcttccgcttaccagtggttctacgacggtacccctaccttcggtgagcacctgcaggctaacgacctggactacggtcagtgccctaacaacatgatgggtaccttctccgtgcgtactgtgggtacctccaagtccaagtaccctctggtggtgcgcatctacatgcgcatgaagcacgtgcgcgcttggattcctcgtcctatgcgcaaccagaactacctgttcaaggctaaccctaactacgctggtaactccatcaagcctaccggtgcttcccgtaccgctatcaccaccctgtaa(SEQ ID NO.1)。

atgggtccatctttggacttcgctttgtctttgttgagaagaaacatcagacaagttcaaactgaccaaggtcacttcactatgttgggtgttagagacagattggctgttttgccaagacactctcaaccaggtaagactatctggatcgaacacaagttggttaacgttttggacgctgttgaattggttgacgaacaaggtgttaacttggaattgactttgatcactttggacactaacgaaaagttcagagacatcactaagttcatcccagaaaacatctctactgcttctgacgctactttggttatcaacactgaacacatgccatctatgttcgttccagttggtgacgttgttcaatacggtttcttgaacttgtctggtaagccaactcacagaactatgatgtacaacttcccaactaaggctggtcaatgtggtggtgttgttacttctgttggtaaggttgttggtatccacatcggtggtaacggtagacaaggtttctgtgctggtttgaagagatcgtacttcgcttctgaacaaggtgaaatccaatgggttaagccaaacaaggaaactggtagattgaacatcaacggtccaactagaactaagttggaaccatctgttttccacgacatcttcgaaggtaacaaggaaccagctgttttgcactctaaggacccaagattggaagttgacttcgaacaagctttgttctctaagtacgttggtaacactttgcacgaaccagacgaatacatcaaggaagctgctttgcactacgctaaccaattgaagcaattggaaatcaacacttctcaaatgtctatggaagaagcttgttacggtactgaaaacttggaagctatcgacttgcacacttctgctggttacccatactctgctttgggtatcaagaagagagacatcttggacccaactactagagacgtttctagaatgaagttctacatggacaagtacggtttggacttgccatactctacttacgttaaggacgaattgagatcgatcgacaagatcaagaagggtaagtctagattgatcgaagcttcttctttgaacgactctgtttacttgagaatggctttcggtcacttgtacgaagctttccacgctaacccaggtactatcactggttctgctgttggttgtaacccagacactttctggtctaagttgccaatcttgttgccaggttctttgttcgctttcgactactctggttacgacgcttctttgtctccagtttggttcagagctttggaattggttttgagagaaatcggttactctgaagaagctatctctttgatcgaaggtatcaaccacactcaccacgtttacagaaacaagacttactgtgttttgggtggtatgccatctggttgttctggtacttctatcttcaactctatgatcaacaacatcatcatcagagctttgttgatcaagactttcaagggtatcgacttggacgaattgaacatggttgcttacggtgacgacgttttggcttcttacccattcccaatcgactgtttggaattggctaagactggtaaggaatacggtttgactatgactccagctgacaagtctccatgtttcaacgaagttaactggggtaacgctactttcttgaagagaggtttcttgccagacgaacaattcccattcttgatccacccaactatgccaatgagagaaatccacgaatctatcagatggactaaggacgctagaaacactcaagaccacgttagatcgttgtgtttgttggcttggcacaacggtaagcaagaatacgaaaagttcgtttctactatcagatcggttccagttggtagagctttggctatcccaaactacgaaaacttgagaagaaactggttggaattgttctaa(SEQ ID NO.2)。

gtggtgaacctgaccgatggtggtactgacaccaccggttatgctacc(SEQ ID NO.3)。

cctactggtcgcgacgctttccaatggcagaccgctactaaccct(SEQ ID NO.4)。

acccctaccttcggtgagcacctgcaggctaacgacctggactacggtcagtgc(SEQ ID NO.5)。

atgggttcgcaagtgtctacacagcgctccggttctcacgaaaactcaaactcagccactgagggttctaccataaactacaccaccattaattactacaaagactcctatgctgccacagcaggcaaacagagtctcaagcaggatccagacaagtttgcaaatcctgttaaagacattttcactgaaatggcagcgccactgaaatccccatccgctgaggcatgtgggtacagtgatcgagtggcgcaattaactattggcaactccaccatcaccacgcaagaagcggctaacatcatagtcggttatggtgagtggccttcctactgctcagattctgacgctacagcagtggataaaccaacgcgcccggatgtttcagtgaacaggttttacacattggacaccaaattgtgggagaaatcgtccaaggggtggtactggaagttcccggatgtgttaactgaaactggggtttttgggcaaaatgcacaattccactacctctaccgatcagggttctgcatccacgtgcagtgcaatgccagtaaattccaccaaggagcactcctagtcgctgtcctaccagagtatgtcattgggacagtggcaggcggtacagggacggaagatacccaccccccttacaagcagactcaacccggcgccgatggcttcgagttgcaacacccgtacgtgcttgatgctggcatcccaatatcacagttaacagtgtgcccacaccagtggatcaacttgaggaccaacaattgtgctacaataatagtgccatacattaacgcactgccttttgattctgccttgaatcattgcaactttggcctgttggttgtgcctattagcccactagactacgaccaaggagcgacgccagtaatccctataactatcacattggccccaatgtgttctgaattcgcaggtcttaggcaggcagtcacgcaagggttccccaccgagctaaaacctggcacaaatcaatttttaaccaccgatgatggcgtttcagcacctattctaccaaacttccaccccaccccgtgtatccacatacctggtgaggttaggaacttgctagagttatgccaggtggaaaccattctggaggttaacaatgtgcccacgaatgccactagcttaatggagagactgcgcttcccggtctcagcacaagcagggaaaggtgagctgtgtgcggtgtttagagccgatcctgggcgaaatggaccatggcaatccaccttactgggtcagttgtgcgggtactacacccaatggtcaggatcattggaagtcaccttcatgtttactggatctttcatggctaccggcaagatgctcatagcctatacaccgccaggaggtcctctgcccaaggaccgggcgaccgccatgttgggcacgcacgtcatctgggatttggggctgcaatcgtctgttacccttgtaataccatggatcagcaacactcattacagagcacatgcccgagatggagtgtttgactactacaccacagggttagtcagtatatggtaccagacaaattacgtggttccaatcggtgcgcccaacacagcctatataatagcgctagcggcggcccaaaagaatttcactatgaaattgtgcaaggatgctagtgatatcctgcagacgggcaccatccagggagatagggtggcagatgtaattgaaagttccataggagatagcgtgagcagagccctcactcacgctctaccagcacccacaggccagaacacacaggtgagcagtcatcgactggatacaggtaaggttccagcactccaagctgctgaaattggagcatcatcaaatgctagtgacgagagcatgattgagacacgctgtgttcttaactcgcacagtacagctgagaccactcttgatagtttcttcagcagggcgggattagttggagagatagatctccctcttaagggcacaactaacccaaatggttatgccaactgggacatagatataacaggttacgcgcaaatgcgtagaaaggtagagctattcacctacatgcgctttgatgcagagttcacttttgttgcgtgcacacccaccggggaagttgtcccacaattgctccaatatatgtttgtgccacctggagcccctaagccagattctagggaatcccttgcatggcaaaccgccactaacccctcagtttttgtcaagctgtcagaccctccagcgcaggtttcagtgccgttcatgtcacctgcgagtgcttatcaatggttttatgacggatatcccacattcggagaacacaaacaggagaaagatcttgaatacggggcatgtcctaataacatgatgggcacgttctcagtgcggactgtggggacctccaagtccaagtaccctttagtggttaggatttacatgagaatgaagcacgtcagggcgtggatacctcgcccgatgcgtaaccagaactacctatttaaagccaacccaaattatgctggcaactccattaagccaactggcgccagtcgcacagcgatcaccactctttaa(SEQ ID NO.6)。

The shuttle vector pOET5 for the insect baculovirus described above was purchased from Oxford Expression Technologies. P1 capsid protein gene EV-A71-P1 of enterovirus 71 after codon optimization ^CHI3 And the codon optimized 3CD protease gene are cloned to an EcoRI/Not I enzyme cutting site behind a P10 promoter of a shuttle vector pOET5 of the insect baculovirus and a BamHI/Xho I enzyme cutting site behind a polh promoter respectively through chemical synthesis to construct a recombinant plasmid pOET5-EV-A71-P1 ^CHI3 3CD, as shown in FIG. 3, this step is performed by the Huada gene.

As shown in FIG. 4, pOET5-EV-A71-P1 ^CHI3 The-3 CD positive plasmid is digested simultaneously by four endonucleases of EcoRI, Not I, BamHI and Xho I to generate four bands which are respectively a linear pOET5 vector EV-A71-P1 vector from large to small ^CHI3 Gene, 3CD gene, and short sequences between the P10 promoter and polh promoter.

And step 3: construction of recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD

The recombinant plasmid pOET5-EV-A71-P1 obtained in the step 1 ^CHI3 The-3 CD and insect baculovirus genome Flash-BAC DNA are cotransfected with SF9 insect cells, and the P1 capsid protein gene and the 3CD gene are integrated into the insect baculovirus genome to obtain the recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD。

The insect baculovirus genome Flash-BAC DNA described above is commercially available, for example, from Oxford Expression Technologies, Inc. in UK.

The SF9 insect cell is a useful host cell for insect baculovirus, and is commercially available, for example, from Invitrogen corporation.

The recombinant baculovirus rBV-EV-A71-P1 ^CHI3 The-3 CD can be identified as positive by PCR as shown in FIG. 5.

The recombinant plasmid pOET5-EV-A71-P1 was transfected with an insect cell transfection reagent Cellffectin II (available from Invitrogen, USA) ^CHI3 Co-transfecting SF9 insect cells with Flash-BAC DNA of the-3 CD and insect baculovirus genome, and culturing the cells at the temperature of 27 ℃ for 5-6 days to obtain a large amount of recombinant insect baculovirus rBV-EV-A71-P1 ^CHI3 -3CD is released into the cell culture medium and the collected cell culture supernatant is used to infect new SF9 insect cells again to obtain a high titer of recombinant insect baculovirus after amplification for later use.

And 4, step 4: preparation and purification of Virus-like particles

Recombinant baculovirus rBV-EV-A71-P1 obtained by SF9 insect cell amplification step 2 ^CHI3 3CD to increase its viral titer. And (3) determining the virus titer, and calculating the copy number of the standard PMV-rBV according to the formula 1 by adopting a qPCR method.

Standard PMV-rBV copy number (copies/. mu.l) ═ 6.02 × 10 ²³ Plasmid concentration (ng/. mu.L). times.10 ^-9 /(number of plasmid bases × 660) formula 1.

Known copy number PMV-rBV plasmid was diluted at 10 fold ratio for 8 gradients as standard curve samples. Recombinant baculovirus rBV-EV-A71-P1 ^CHI3 3CD stock solution and 10-fold dilution solution as samples to be tested.

Baculovirus genome universal primers:

BV-F：gacaatccagtcacggacgaacat(SEQ ID NO 7)；

BV-R：ggcaaaggtttcaatgccgg(SEQ ID NO 8)。

calculating rBV-EV-A71-P1 according to the standard curve and the corresponding CQ value of the sample to be detected ^CHI3 -3CD titer.

The infection density was 2X 10 with a Multiplicity of infection (MOI) of 3 ⁶ the/mL SF9 insect cell culture solution can efficiently express exogenous enterovirus 71 type P1 ^CHI3 Protein gene and 3CD protease gene, and releasing the automatically assembled enterovirus 71 type virus-like particles into a cell culture solution.

Reinfection capsuleDegree of 2X 10 ⁶ The specific method comprises the following steps of culturing 5-6 days to more than 90% of SF9 insect cells infected with pathological changes by using a/mL SF9 insect cell culture solution at the temperature of 27 ℃ and the shaking speed of 110 rpm, collecting supernatant, detecting target protein in the supernatant, purifying the target protein in the supernatant, and finally detecting by using a transmission electron microscope, wherein the specific method comprises the following steps:

step 3.1: western Blot detection of target protein in supernatant

The supernatant samples were mixed with the loading buffer, boiled at 99 ℃ for 10 minutes, separated on a 10% SDS-PAGE gel, and further electrotransferred to PVDF membrane for Western Blot analysis. Mouse EV-A71 whole virus antiserum diluted to 1:500 was used as a primary antibody, goat anti-mouse HRP-conjugated IgG antibody diluted to 1:5000 was used as a secondary antibody, and chemiluminescence was performed using an ECL luminescence kit. As shown in FIG. 6, the protein expression in the 1d-6d supernatant was detected, and the VP1 protein was detected in large amounts in 5d and 6 d.

Step 3.2: concentrating the supernatant

Mixing the supernatant with 20 wt% PEG8000 and 0.6M NaCl solution at equal volume, stirring at 4 deg.C overnight, centrifuging at 8000 rpm for 30min, removing supernatant, collecting protein precipitate, and resuspending the protein precipitate with PBS buffer to obtain virus concentrate; the PBS buffer solution contains KH ₂ PO ₄ 2mM、Na ₂ HPO ₄ 8mM, NaCl 136mM and KCl 2.6mM, pH 7.2.

Step 3.3: sucrose density gradient ultracentrifugation

Respectively preparing sucrose solutions with the mass percentage concentrations of 30%, 45% and 60%, performing density gradient ultracentrifugation on the virus concentrated solution obtained in the step 3.1, performing centrifugation at 290,000 rpm for 60min, and collecting milky white substances at the junction of 30% and 45% and the junction of 45% and 60%, namely the enterovirus 71 type virus-like particles. As shown in FIG. 7, the sample purified by Western Blot contains a large amount of VP1 protein.

Step 3.4: transmission electron microscopy inspection

The purified sample was negatively stained with 2% phosphotungstic acid and observed under a transmission electron microscope, and the appearance showed spherical particles similar to real virus particles, with a diameter of about 30nm, as shown in FIG. 8.

Experimental example 1: BALB/c mice of 6 weeks of age free from contamination with specific pathogens were immunized with enterovirus 71 type virus-like particles and the sera of the immunized mice were analyzed.

Animal immunity, serum antibody measurement and virus neutralization reaction are carried out according to the currently used enterovirus animal immunity experiment mode. The experimental animals are selected BALB/c female mice with 6 weeks of age and without special pathogen contamination. The specific operation is as follows: each BALB/c mouse was injected subcutaneously with 0.3mL of enterovirus 71 type virus-like particles (10 μ g of total protein) emulsified in freund's adjuvant at

weeks

0, 2 and 4, mice were decapitated at

weeks

0, 2, 4, 6 and 12 with the same dose of inactivated enterovirus 71 type virus as a positive control and PBS group as a negative control, and sera were taken for ELISA and microneutralization experiments.

The ELISA experiment comprises the following specific steps:

step (1), coating: diluting the purified EV-A71 or CV-A16 or CV-A10 inactivated virus to 1 μ g/mL by using a coating buffer, adding 100 μ L of the virus to each well of a 96-well plate, and coating at 4 ℃ overnight;

washing in step (2): the next day was washed 3 times with 1 XPBST (containing 0.1% Tween-20). 200 μ L per well, 1min each time;

and (3) sealing: blocking with 1% BSA blocking solution, 200. mu.L per well, blocking at 37 ℃ for 1 h;

washing in step (4): 1 XPBST wash 3 times, 200 uL per well, 1min each time;

step (5) primary antibody incubation: adding dilution (0.1% BSA) to dilute the serum to be tested in a gradient manner, adding 100 μ L of each dilution into the coated reaction wells, and incubating at 37 ℃ for 1h (while performing blank, negative and positive well comparisons);

step (6) washing: washing with 1 XPBST for 3 times, 200. mu.L per well, 1min each time;

step (7) secondary antibody incubation: adding 100 mu L of enzyme-labeled secondary antibody HRP-goat anti-mouse IgG diluted by 1:5000 times with diluent (0.1% BSA), and incubating at 37 ℃ for 1 h;

step (8) washing: washing with 1 XPBST for 3 times, 200. mu.L per well, 1min each time;

step (9) color development: adding 100 mu L of TMB substrate color development liquid which is prepared temporarily into each reaction hole, and reacting for 10-20min at 37 ℃;

and (10) terminating: 50. mu.L of 1mol/L sulfuric acid was added to each reaction well to terminate the reaction. Reading value: immediately after termination of the reaction, the plate was read on a microplate reader at 450 nm.

The procedures for the microneutralization experiments were as follows:

inactivating the serum to be detected at 56 ℃ for 30 min;

step (2) dilution of EV-A71 or CV-A16 or CV-A10 isolates: diluting the virus to a virus content of 100TCI D50 per 25 mu L according to the titer of the EV-A71 or CV-A16 or CV-A10 isolate, wherein the diluent is a cell maintenance solution;

step (3) serum assay plate: adding 25 mu L of DMEM culture medium into each hole of a 96-hole plate, adding the detected serum into the first hole, uniformly mixing, sucking 25 mu L of the detected serum out to the second hole, and diluting according to the 2-fold ratio by analogy, wherein the dilution degrees are 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128 and 1:256 in sequence, and 2 holes are arranged in each dilution degree; adding 100TCID50/25 μ L EV-A71 or CV-A16 or CV-A10 virus suspension into each well, and gently mixing;

and (4) setting a negative serum control hole and a cell control hole: the dilution method of the negative serum control hole is the same as the step (3); adding 50 mu L of cell maintenance liquid into each cell control hole, and arranging 4 holes for cell control; virus back-drip control was set: adding 25 mu L of cell maintenance solution into each well of a 96-well plate, and then adding EV-A71 or CV-A16 or CV-A10100 TCID50/25 mu L, 10TCID50/25 mu L, 1TCID50/25 mu L and 0.1TCID50/25 mu L, wherein 8 wells are arranged in each dilution degree;

placing serum experimental plate, serum control, cell control, and virus back drop control in 5% CO ₂ Neutralizing in an incubator at 37 ℃ for 3 hours, and taking out the 96-well plate every half hour to uniformly mix so as to ensure that the detected serum and the virus fully react;

step (5) preparing a cell suspension: coverage 95% 25cm ² Digesting monolayer cells in culture flask, adding cell growth liquid, counting cells, and diluting cell suspension to density of 1.0 × 10 ⁵ one/mL.After neutralization for 3h, 100 μ L of cell suspension was added to each well of a 96-well plate, gently shaken and mixed, and placed in 5% CO ₂ Culturing in an incubator at 37 ℃; the record was observed every day, and when 100TCID 50/25. mu.L of virus control wells showed complete CPE, the results were judged, and the reciprocal of the highest serum dilution that did not produce CPE was taken as the neutralizing antibody titer against EV-A71 or CV-A16 or CV-A10 for the serum to be tested. The cell growth in the cell control well was good, the serum control well did not respond well, and the results of the experiment with the virus back-drop control in the range of 32-320TCID50/25 μ L were considered to be valid.

Experimental example 2: in-vivo passive protection experiment, enterovirus 71 type virus-like particles are used for immunizing ICR female mice with 6 weeks without special pathogen pollution, attacking toxin of the born suckling mice, and recording the survival rate of the suckling mice.

The virus attacking experiment of the experimental mouse is carried out according to the currently used enterovirus animal immunity experiment and virus attacking protection experiment modes. The immunization is performed on six-week-old ICR female mice without special pathogen pollution, the mice are respectively immunized with EV-A71 virus-like particles by subcutaneous inoculation at the dose of 10 mug/0.1 mL, the EV-A71 inactivated virus with the same dose is used as a positive control, a PBS group is used as a negative control, and the mice are immunized once at week 0, week 2 and week 4. The dams were mated at week three, delivered at approximately week 6-7, and approximately 10 suckling mice were produced per dam. Challenge protection experiment of suckling mice: taking 10 suckling mice of 1 day old as a group; groups were infected intracranial with 50 LD 50 times of EV-A71 or CV-A16 or CV-A10 mouse adapted strain, positive and negative control groups received the same dose of EV-A71 or CV-A16 or CV-A10 intracranial infection as the immunized experimental group, and the survival rate and clinical symptoms of the suckling mice were recorded daily for 15 days.

The experimental results are as follows:

FIGS. 9-11 show the results of serum-specific IgG antibody titer measurements after immunization of mice. Selecting 6-week-old female BALB/c mice as experimental animals, respectively using sf9 cell culture supernatant as negative control, PBS as blank control, EV-A71 inactivated virus as positive control, EV-A71-VLP ^CHI3 For the experimental group, mice were immunized and post-immunization sera were collected, and the specificity for EV-A71, CV-A16, and CV-A10 in the sera of mice was determined by an indirect ELISA methodIgG antibody titers. The results showed that EV-A71-VLP, as shown in FIG. 9 ^CHI3 The vaccine and the EV-A71 inactivated vaccine can induce mice to generate EV-A71 specific IgG antibodies, and the antibody titer is enhanced along with the increase of the immunization times; as shown in FIG. 10, EV-A71-VLP ^CHI3 The vaccine and the EV-A71 inactivated vaccine can induce mice to generate CV-A16 specific IgG antibody, the antibody titer is enhanced along with the increase of the immunization times, and the EV-A71-VLP ^CHI3 Inducing to generate CV-A16 specific IgG antibody titer higher than EV-A71 inactivated vaccine; as shown in FIG. 11, EV-A71-VLP ^CHI3 Can induce the generation of CV-A10 specific antibodies, and has significant difference compared with EV-A71 inactivated vaccine.

FIGS. 12-14 are serum neutralizing antibody titer assays after immunization of mice. The results showed that EV-A71-VLP, as shown in FIG. 12 ^CHI3 And the EV-A71 inactivated vaccine induced the generation of neutralizing antibodies against EV-A71 with average titers of 1:213 and 1:235, respectively; as shown in FIG. 13, EV-A71-VLP ^CHI3 And EV-a71 inactivated vaccine induced the production of neutralizing antibodies against CV-a16 with mean titers of 1:19 and 1:11, respectively; as shown in FIG. 14, EV-A71-VLP ^CHI3 And inactivated EV-a71 vaccine induced the average titers of neutralizing antibodies against CV-a10 to be 1:69 and 1:21, respectively.

FIGS. 15-17 are animal challenge protection experiments. The results showed that EV-A71-VLP, as shown in FIG. 15 ^CHI3 The EV-A71 virus inactivated vaccine and the EV-A71 inactivated vaccine can protect the virus challenge by 100 percent; as shown in FIG. 16, EV-A71-VLP was challenged with CV-A16 challenge ^CHI3 20% protection can be provided, while the EV-A71 inactivated vaccine cannot provide protection; as shown in FIG. 17, EV-A71-VLP was targeted against CV-A10 challenge ^CHI3 Can provide 40 percent of protection, while the EV-A71 inactivated vaccine can not provide protection.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Guilin medical college

<120> enterovirus 71 type virus-like particle, preparation method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2586

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgggttccc aggtgtccac tcaacgttcc ggttcccacg agaactccaa ctccgctacc 60

gagggttcca ccatcaacta caccaccatc aactactaca aggactccta cgctgctacc 120

gctggtaagc agtccctgaa gcaggaccct gacaagttcg ctaaccctgt gaaggacatc 180

ttcaccgaga tggctgctcc tctgaagtct ccttccgctg aggcttgtgg ttactccgat 240

cgcgtggctc aactgaccat cggtaactcc accatcacca cccaggaggc tgctaacatc 300

atcgtgggtt acggtgagtg gccttcctac tgctccgact ccgatgctac cgctgtggac 360

aaacctactc gccctgacgt ttccgttaac cgcttctaca ccctggacac caagctgtgg 420

gagaagtcct ccaagggttg gtactggaag ttccctgacg tgctgaccga aaccggtgtg 480

ttcggtcaga acgctcagtt ccactacctg taccgctccg gtttctgcat tcacgtgcaa 540

tgcaacgctt ccaagttcca ccagggtgct ctgctggtgg ctgttctgcc tgagtacgtg 600

atcggtaccg tggctggtgg tactggtacc gaagacaccc accctcctta caagcagacc 660

cagcctggtg ctgatggttt cgagctgcag cacccttatg tgctggacgc tggtatccct 720

atctcccagc tgaccgtgtg tcctcaccag tggatcaacc tgcgcaccaa caactgcgct 780

accatcatcg tgccttacat caacgctctg cctttcgact ccgctctgaa ccactgtaac 840

ttcggtctgc tggtggtgcc tatttcccct ctggactacg atcagggtgc tacccctgtg 900

atccctatca ccatcaccct ggctcctatg tgctccgagt tcgctggttt gcgtcaggct 960

gtgacccaag gtttccctac cgagctgaag cctggtacca accagttcct gaccaccgat 1020

gacggtgtgt ccgctcctat cctgcctaac ttccacccta ccccttgcat ccacatccct 1080

ggtgaggtgc gcaatttgct ggagctgtgc caagtggaga ctatcctgga ggtgaacaac 1140

gtgcctacca acgctacctc cctgatggag cgtctgcgct ttcctgtgtc cgctcaggct 1200

ggtaagggtg aactgtgcgc tgtgtttcgt gctgaccctg gtagaaacgg tccttggcaa 1260

tccaccctgc tgggtcaact gtgcggttac tacacccagt ggtccggttc tctggaggtg 1320

accttcatgt tcaccggttc cttcatggct accggtaaga tgctgatcgc ttacacccct 1380

cctggtggtc ctctgcctaa agaccgtgct accgctatgt tgggtaccca cgtgatttgg 1440

gacctgggtc tgcaatcctc tgtgaccctg gtgatccctt ggatctccaa cacccactac 1500

cgcgctcatg ctcgtgatgg tgtgttcgac tactacacca ccggtctggt gtccatctgg 1560

taccagacca actacgtggt gcctatcggt gctcctaaca ccgcttacat catcgctctg 1620

gctgctgctc agaagaactt caccatgaag ctgtgcaagg acgcttccga catcttgcag 1680

accggtacca ttcaaggtga ccgcgtggct gatgttatcg agtcctccat cggtgattcc 1740

gtgtcccgcg ctttgactca tgctctgcct gctcctactg gtcagaacac ccaggtgtcc 1800

tcccatcgtc tggataccgg taaagtgcct gctctgcagg ctgctgagat tggtgcttcc 1860

tccaacgctt ccgacgagtc catgatcgaa acccgctgcg tgctcaattc tcactccacc 1920

gctgaaacca ctctggactc cttcttttcc cgcgctggtc tggttggtgt ggtgaacctg 1980

accgatggtg gtactgacac caccggttat gctacctggg acatcgacat caccggttac 2040

gctcagatgc gccgcaaagt ggagctgttc acctacatgc gcttcgacgc tgagttcacc 2100

ttcgtggctt gcactcctac tggtgaggtg gtgcctcaac tgctgcagta catgttcgtg 2160

cctcctggtg ctcctaaacc tactggtcgc gacgctttcc aatggcagac cgctactaac 2220

ccttccgtgt tcgtgaagct gtccgaccct cctgctcaag tgtccgtgcc tttcatgtcc 2280

cctgcttccg cttaccagtg gttctacgac ggtaccccta ccttcggtga gcacctgcag 2340

gctaacgacc tggactacgg tcagtgccct aacaacatga tgggtacctt ctccgtgcgt 2400

actgtgggta cctccaagtc caagtaccct ctggtggtgc gcatctacat gcgcatgaag 2460

cacgtgcgcg cttggattcc tcgtcctatg cgcaaccaga actacctgtt caaggctaac 2520

cctaactacg ctggtaactc catcaagcct accggtgctt cccgtaccgc tatcaccacc 2580

ctgtaa 2586

<210> 2

<211> 1941

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgggtccat ctttggactt cgctttgtct ttgttgagaa gaaacatcag acaagttcaa 60

actgaccaag gtcacttcac tatgttgggt gttagagaca gattggctgt tttgccaaga 120

cactctcaac caggtaagac tatctggatc gaacacaagt tggttaacgt tttggacgct 180

gttgaattgg ttgacgaaca aggtgttaac ttggaattga ctttgatcac tttggacact 240

aacgaaaagt tcagagacat cactaagttc atcccagaaa acatctctac tgcttctgac 300

gctactttgg ttatcaacac tgaacacatg ccatctatgt tcgttccagt tggtgacgtt 360

gttcaatacg gtttcttgaa cttgtctggt aagccaactc acagaactat gatgtacaac 420

ttcccaacta aggctggtca atgtggtggt gttgttactt ctgttggtaa ggttgttggt 480

atccacatcg gtggtaacgg tagacaaggt ttctgtgctg gtttgaagag atcgtacttc 540

gcttctgaac aaggtgaaat ccaatgggtt aagccaaaca aggaaactgg tagattgaac 600

atcaacggtc caactagaac taagttggaa ccatctgttt tccacgacat cttcgaaggt 660

aacaaggaac cagctgtttt gcactctaag gacccaagat tggaagttga cttcgaacaa 720

gctttgttct ctaagtacgt tggtaacact ttgcacgaac cagacgaata catcaaggaa 780

gctgctttgc actacgctaa ccaattgaag caattggaaa tcaacacttc tcaaatgtct 840

atggaagaag cttgttacgg tactgaaaac ttggaagcta tcgacttgca cacttctgct 900

ggttacccat actctgcttt gggtatcaag aagagagaca tcttggaccc aactactaga 960

gacgtttcta gaatgaagtt ctacatggac aagtacggtt tggacttgcc atactctact 1020

tacgttaagg acgaattgag atcgatcgac aagatcaaga agggtaagtc tagattgatc 1080

gaagcttctt ctttgaacga ctctgtttac ttgagaatgg ctttcggtca cttgtacgaa 1140

gctttccacg ctaacccagg tactatcact ggttctgctg ttggttgtaa cccagacact 1200

ttctggtcta agttgccaat cttgttgcca ggttctttgt tcgctttcga ctactctggt 1260

tacgacgctt ctttgtctcc agtttggttc agagctttgg aattggtttt gagagaaatc 1320

ggttactctg aagaagctat ctctttgatc gaaggtatca accacactca ccacgtttac 1380

agaaacaaga cttactgtgt tttgggtggt atgccatctg gttgttctgg tacttctatc 1440

ttcaactcta tgatcaacaa catcatcatc agagctttgt tgatcaagac tttcaagggt 1500

atcgacttgg acgaattgaa catggttgct tacggtgacg acgttttggc ttcttaccca 1560

ttcccaatcg actgtttgga attggctaag actggtaagg aatacggttt gactatgact 1620

ccagctgaca agtctccatg tttcaacgaa gttaactggg gtaacgctac tttcttgaag 1680

agaggtttct tgccagacga acaattccca ttcttgatcc acccaactat gccaatgaga 1740

gaaatccacg aatctatcag atggactaag gacgctagaa acactcaaga ccacgttaga 1800

tcgttgtgtt tgttggcttg gcacaacggt aagcaagaat acgaaaagtt cgtttctact 1860

atcagatcgg ttccagttgg tagagctttg gctatcccaa actacgaaaa cttgagaaga 1920

aactggttgg aattgttcta a 1941

<210> 3

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtggtgaacc tgaccgatgg tggtactgac accaccggtt atgctacc 48

<210> 4

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cctactggtc gcgacgcttt ccaatggcag accgctacta accct 45

<210> 5

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acccctacct tcggtgagca cctgcaggct aacgacctgg actacggtca gtgc 54

<210> 6

<211> 2589

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgggttcgc aagtgtctac acagcgctcc ggttctcacg aaaactcaaa ctcagccact 60

gagggttcta ccataaacta caccaccatt aattactaca aagactccta tgctgccaca 120

gcaggcaaac agagtctcaa gcaggatcca gacaagtttg caaatcctgt taaagacatt 180

ttcactgaaa tggcagcgcc actgaaatcc ccatccgctg aggcatgtgg gtacagtgat 240

cgagtggcgc aattaactat tggcaactcc accatcacca cgcaagaagc ggctaacatc 300

atagtcggtt atggtgagtg gccttcctac tgctcagatt ctgacgctac agcagtggat 360

aaaccaacgc gcccggatgt ttcagtgaac aggttttaca cattggacac caaattgtgg 420

gagaaatcgt ccaaggggtg gtactggaag ttcccggatg tgttaactga aactggggtt 480

tttgggcaaa atgcacaatt ccactacctc taccgatcag ggttctgcat ccacgtgcag 540

tgcaatgcca gtaaattcca ccaaggagca ctcctagtcg ctgtcctacc agagtatgtc 600

attgggacag tggcaggcgg tacagggacg gaagataccc acccccctta caagcagact 660

caacccggcg ccgatggctt cgagttgcaa cacccgtacg tgcttgatgc tggcatccca 720

atatcacagt taacagtgtg cccacaccag tggatcaact tgaggaccaa caattgtgct 780

acaataatag tgccatacat taacgcactg ccttttgatt ctgccttgaa tcattgcaac 840

tttggcctgt tggttgtgcc tattagccca ctagactacg accaaggagc gacgccagta 900

atccctataa ctatcacatt ggccccaatg tgttctgaat tcgcaggtct taggcaggca 960

gtcacgcaag ggttccccac cgagctaaaa cctggcacaa atcaattttt aaccaccgat 1020

gatggcgttt cagcacctat tctaccaaac ttccacccca ccccgtgtat ccacatacct 1080

ggtgaggtta ggaacttgct agagttatgc caggtggaaa ccattctgga ggttaacaat 1140

gtgcccacga atgccactag cttaatggag agactgcgct tcccggtctc agcacaagca 1200

gggaaaggtg agctgtgtgc ggtgtttaga gccgatcctg ggcgaaatgg accatggcaa 1260

tccaccttac tgggtcagtt gtgcgggtac tacacccaat ggtcaggatc attggaagtc 1320

accttcatgt ttactggatc tttcatggct accggcaaga tgctcatagc ctatacaccg 1380

ccaggaggtc ctctgcccaa ggaccgggcg accgccatgt tgggcacgca cgtcatctgg 1440

gatttggggc tgcaatcgtc tgttaccctt gtaataccat ggatcagcaa cactcattac 1500

agagcacatg cccgagatgg agtgtttgac tactacacca cagggttagt cagtatatgg 1560

taccagacaa attacgtggt tccaatcggt gcgcccaaca cagcctatat aatagcgcta 1620

gcggcggccc aaaagaattt cactatgaaa ttgtgcaagg atgctagtga tatcctgcag 1680

acgggcacca tccagggaga tagggtggca gatgtaattg aaagttccat aggagatagc 1740

gtgagcagag ccctcactca cgctctacca gcacccacag gccagaacac acaggtgagc 1800

agtcatcgac tggatacagg taaggttcca gcactccaag ctgctgaaat tggagcatca 1860

tcaaatgcta gtgacgagag catgattgag acacgctgtg ttcttaactc gcacagtaca 1920

gctgagacca ctcttgatag tttcttcagc agggcgggat tagttggaga gatagatctc 1980

cctcttaagg gcacaactaa cccaaatggt tatgccaact gggacataga tataacaggt 2040

tacgcgcaaa tgcgtagaaa ggtagagcta ttcacctaca tgcgctttga tgcagagttc 2100

acttttgttg cgtgcacacc caccggggaa gttgtcccac aattgctcca atatatgttt 2160

gtgccacctg gagcccctaa gccagattct agggaatccc ttgcatggca aaccgccact 2220

aacccctcag tttttgtcaa gctgtcagac cctccagcgc aggtttcagt gccgttcatg 2280

tcacctgcga gtgcttatca atggttttat gacggatatc ccacattcgg agaacacaaa 2340

caggagaaag atcttgaata cggggcatgt cctaataaca tgatgggcac gttctcagtg 2400

cggactgtgg ggacctccaa gtccaagtac cctttagtgg ttaggattta catgagaatg 2460

aagcacgtca gggcgtggat acctcgcccg atgcgtaacc agaactacct atttaaagcc 2520

aacccaaatt atgctggcaa ctccattaag ccaactggcg ccagtcgcac agcgatcacc 2580

actctttaa 2589

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gacaatccag tcacggacga acat 24

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggcaaaggtt tcaatgccgg 20

Claims

1. An enterovirus 71 type virus-like particle is characterized in that recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene is used for infecting SF9 insect cells, and the virus-like particle is obtained after more than 90% of SF9 insect cells are cultured to infect lesion.

2. The enterovirus 71 virus-like particle of claim 1, wherein the recombinant baculovirus expressing the enterovirus 71P 1 capsid protein gene and the 3CD protease gene is prepared by:

Then the recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD and insect baculovirus genome Flash-BAC DNA co-transfect SF9 insect cells, and after culturing to reach more than 90% of the number of infected and diseased SF9 insect cells, obtaining recombinant baculovirus expressing enterovirus 71 type P1 capsid protein gene and 3CD protease gene;

wherein the nucleotide sequence of the P1 capsid protein gene of the enterovirus 71 type optimized by the codon preference of the SF9 insect cells is shown as SEQ ID NO. 1; the nucleotide sequence of the SF9 insect cell preference codon optimized 3CD protease gene is shown as SEQ ID NO. 2.

3. According toThe enterovirus 71 virus-like particle of claim 2, wherein the P1 capsid protein gene EV-A71-P1 of the SF9 insect cell bias codon optimized enterovirus 71 ^CHI3 The preparation method comprises the following steps:

respectively optimizing a VP1 linear neutralization epitope of a first CV-A10, a VP1 linear neutralization epitope of a second CV-A10 and a VP1 linear neutralization epitope of CV-A16 by SF9 insect cell preference codons, and then respectively substituting positions 1969 to 2016, 2179 to 2223 and 2314 to 2367 of a P1 capsid protein gene of a wild-type enterovirus 71 type;

the nucleotide sequence of the VP1 linear neutralizing epitope of the first CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralizing epitope of the second CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralizing epitope after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.5, and the nucleotide sequence of the P1 capsid protein gene of the wild-type enterovirus 71 is shown as SEQ ID NO. 6.

4. A preparation method of enterovirus 71 type virus-like particles is characterized by comprising the following steps:

step 1: construction of recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD

Respectively carrying out SF9 insect cell preference codon optimization on the VP1 linear neutralization epitope of the first CV-A10, the VP1 linear neutralization epitope of the second CV-A10 and the VP1 linear neutralization epitope of CV-A16, and then respectively substituting the positions 1969 to 2016, 2179 to 2223 and 2314 to 2367 of the wild-type enterovirus 71P 1 capsid protein gene to obtain the SF9 insect cell preference codon optimized enterovirus 71P 1 capsid protein gene-A71-P1 EV 1 ^CHI3 ；

enterovirus 71 optimized by codon preference of SF9 insect cellsP1 capsid protein gene EV-A71-P1 ^CHI3 And cloning the 3CD protease gene optimized by the SF9 insect cell preference codon to an EcoRI/Not I enzyme cutting site behind a P10 promoter of a shuttle vector pOET5 of the insect baculovirus and a BamHI/XhoI enzyme cutting site behind a polh promoter respectively to construct a recombinant plasmid pOET5-EV-A71-P1 ^CHI3 -3CD；

Wherein the nucleotide sequence of the VP1 linear neutralization epitope of the first CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.3, the nucleotide sequence of the VP1 linear neutralization epitope of the second CV-A10 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.4, the nucleotide sequence of the VP1 linear neutralization epitope of CV-A16 after codon preference optimization of SF9 insect cells is shown as SEQ ID NO.5, the nucleotide sequence of the P1 capsid protein gene of the wild enterovirus 71 type is shown as SEQ ID NO.6, and the P1 capsid protein gene EV-A71-P1 of the enterovirus 71 type after codon optimization is shown as SEQ ID NO.6 ^CHI3 The nucleotide sequence of the 3CD protease gene optimized by the codon preference of the SF9 insect cell is shown as SEQ ID NO.1, and the nucleotide sequence of the gene is shown as SEQ ID NO. 2;

step 2: construction of recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD

The recombinant plasmid pOET5-EV-A71-P1 obtained in the step 1 ^CHI3 The-3 CD and insect baculovirus genome Flash-BAC DNA are cotransfected with SF9 insect cells, the P1 capsid protein gene and the 3CD gene are integrated into the insect baculovirus genome, and the recombinant baculovirus rBV-EV-A71-P1 is obtained ^CHI3 -3CD；

And step 3: preparation and purification of Virus-like particles

5. The enterovirus 71 virus-like particle of claim 4The preparation method of (1), wherein in step 3, the recombinant baculovirus rBV-EV-A71-P1 ^CHI3 -3CD infection of SF9 insect cells with multiplicity of infection MOI of 3, said SF9 insect cells with density of 2X 10 ⁶ /mL。

6. The method for preparing enterovirus 71-type virus-like particles according to claim 4, wherein the culturing in step 3 is carried out at a temperature of 27 ℃, a shaking speed of 110 rpm, and a time of 5d to 6 d.

7. The method for preparing enterovirus 71-type virus-like particles according to claim 4, wherein the specific method for purification in step 3 is:

step 3.1: concentrating the supernatant

step 3.2: sucrose density gradient ultracentrifugation

8. An enterovirus 71 type virus-like particle vaccine comprising the enterovirus 71 type virus-like particle according to any one of claims 1 to 3 as an active ingredient or one of the active ingredients.

9. The enterovirus 71 virus-like particle vaccine of claim 8, wherein the dosage form of the enterovirus 71 virus-like particle vaccine is any one or more of liquid injection, injection powder and injection tablet.

10. The enterovirus type 71 virus-like particle vaccine of claim 8, further comprising an adjuvant, wherein the adjuvant is selected from any one or more of an oil adjuvant, an oil-in-water adjuvant, a water-in-oil-in-water adjuvant, an aluminum salt and a polysaccharide adjuvant.