CN107841507B

CN107841507B - Efficiently expressed porcine circovirus type 2 Cap-cell-penetrating peptide fusion protein gene and application thereof

Info

Publication number: CN107841507B
Application number: CN201711177363.2A
Authority: CN
Inventors: 姜平; 白娟; 朱雪娇; 董彦鹏; 王先炜
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2017-11-23
Filing date: 2017-11-23
Publication date: 2021-05-11
Anticipated expiration: 2037-11-23
Also published as: CN107841507A

Abstract

The invention discloses a high-efficiency expression porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene and application thereof, wherein the encoding gene of the fusion protein is any one of (1) to (3): (1) a Cap gene fused with a sequence of a TAT gene of the cell-penetrating peptide; (2) a Cap gene fused with a sequence of the cell penetrating peptide ppTG20 gene; (3) and a Cap gene fused with a bee signal peptide HBM gene sequence. The research of the subject group finds that the DNA vaccine prepared by mixing the cell-penetrating peptide and the pVAX-Cap plasmid can improve the immune response level of the DNA vaccine in a mouse body. In the research, TAT, ppTG20 and HBM are fused with the N end of PCV2Cap protein, so that the recombinant baculovirus is successfully constructed, the effective expression of the Cap protein is realized, and a foundation is laid for PCV2 genetic engineering vaccine research.

Description

Efficiently expressed porcine circovirus type 2 Cap-cell-penetrating peptide fusion protein gene and application thereof

Technical Field

The invention belongs to the technical field of biological immunity, and particularly relates to a high-efficiency expression porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene and application thereof.

Background

Porcine circovirus type 2 (PCV2) is an important pathogen that compromises the world swine industry. Capsid cap protein coded by PCV2ORF2 gene has important immune protection function and is an important antigen gene of PCV2 recombinant subunit vaccine developed at present. PCV2 recombinant rod subunit vaccines have been commercialized, but the vaccine production costs are high. Many molecular adjuvants, such as some cytokines, IL-18, GMSF, etc., are used together with the immunogen to stimulate the body to generate a good immune response, thereby improving the immune effect of the vaccine.

The honeybee Bee venom secretion signal peptide (HBM) has the function of helping the secretion and expression of target genes, so that the recombinant protein has complete biological function. Cell tunneling Peptide (CPP) can deliver therapeutic substances into cells, and Tat Peptide contained in Tat protein of human immunodeficiency virus is the first discovered Cell tunneling Peptide and can effectively cross Cell membrane. It has been proved by research that drugs, polypeptides or proteins, oligonucleotides/DNA/RNA, nanoparticles, liposomes, bacteriophages, fluorescent dyes, quantum dots and other substances can be effectively delivered into cells. Since CPPs deliver a wide range of target substances and can deliver antigens to Antigen Presenting Cells (APCs) to enhance the immune response of the body, they have great potential in the fields of disease treatment and vaccines.

Disclosure of Invention

The invention aims to provide a porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene.

The invention also aims to provide a Cap-transmembrane peptide fusion protein of porcine circovirus type 2.

The invention also aims to provide application of the porcine circovirus type 2 Cap-penetrating peptide fusion protein.

The purpose of the invention can be realized by the following technical scheme:

a porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene is any one of the genes (1) to (3):

(1) a Cap gene fused with a sequence of a TAT gene of the cell-penetrating peptide;

(2) a Cap gene fused with a sequence of the cell penetrating peptide ppTG20 gene;

(3) and a Cap gene fused with a bee signal peptide HBM gene sequence.

The porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene is characterized in that:

the nucleotide sequence of the Cap gene of the fusion cell-penetrating peptide TAT gene sequence is shown as SEQ ID NO. 1;

the nucleotide sequence of the Cap gene of the fusion transmembrane peptide ppTG20 gene sequence is shown in SEQ ID NO. 3;

the nucleotide sequence of the Cap gene of the fused bee signal peptide HBM gene sequence is shown in SEQ ID No. 5.

the preparation process of the Cap gene fused with the sequence of the TAT gene of the cell-penetrating peptide comprises the following steps: designing primers TAT-Cap-F, 5' -CG according to sequence TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA of TAT gene of cell-penetrating peptide and sequence of Cap gene in pVax-CapCTCGAGATGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAATGACCTACCCCC-3’，Cap-R，5’-CGG GTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3', using the recombinant plasmid pVax-cap as a template to amplify to obtain TAT-cap gene;

the preparation process of the Cap gene of the fusion transmembrane peptide ppTG20 gene sequence comprises the following steps: according to the sequence GGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCA of the cell-penetrating peptide ppTG20 gene and the sequence of the Cap gene in pVax-Cap, a primer ppTG20-Cap-F1, 5' -CG is designedCTCGAGATGGGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACT-3’Xhol，ppTG20-cap-F2，5’-CTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCAATGACCTACCCCCGCCGCCG-3’，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3', using recombinant plasmid pVax-cap as template, two times of PCR amplificationIncreasing ppTG20-cap gene;

the preparation process of the Cap gene of the fused bee signal peptide HBM gene sequence comprises the following steps: designing primers HBM-Cap-F1, 5' -CG according to the sequence ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATACATTTCTTACATCTATGCGGATCGA of the bee signal peptide HBM gene and the sequence of the Cap gene in pVax-CapCTCGAGATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATAC-3’Xhol，HBM-cap-F2，5’-TTTATGGTCGTATACATTTCTTACATCTATGCGGATCGAATGACCTACCCCCGCCGCCG-3’，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3', and obtaining the HBM-cap gene by two PCR amplifications by taking the recombinant plasmid pVax-cap as a template.

Comprises an expression cassette, a recombinant expression vector, a recombinant baculovirus, a transgenic cell line or a transgenic recombinant bacterium of the porcine circovirus type 2 Cap-cell-penetrating peptide fusion protein gene.

A recombinant baculovirus prepared by the following process: cloning the porcine circovirus type 2 Cap-penetrating peptide fusion protein gene to a baculovirus vector pFast-Bac-Dual, transforming a positive recombinant vector plasmid into DH10Bac competence, carrying out homologous recombination to obtain recombinant Bacmid, and transfecting the recombinant Bacmid into Sf9 cells for culturing to obtain the recombinant baculovirus.

The porcine circovirus type 2 Cap-cell penetrating peptide fusion protein coded by the gene. Preferably, any one of a to c: a. an amino acid sequence shown as SEQ ID NO. 2; b. an amino acid sequence shown as SEQ ID NO. 4; c. the amino acid sequence shown as SEQ ID NO. 6.

The preparation process of the fusion protein comprises the following steps: cloning the porcine circovirus type 2 Cap-penetrating peptide fusion protein gene to a baculovirus vector pFast-Bac-Dual, transforming a positive recombinant vector plasmid into DH10Bac competence, carrying out homologous recombination to obtain recombinant Bacmid, transfecting the recombinant Bacmid into Sf9 cells, culturing to obtain recombinant baculovirus, and expressing by the recombinant baculovirus to obtain the fusion protein.

The application of the porcine circovirus type 2 Cap-cell-penetrating peptide fusion protein in preparing a PVC2 subunit vaccine.

A PVC2 subunit vaccine comprises the porcine circovirus type 2 Cap-transmembrane peptide fusion protein. The vaccine also comprises a CP974S aqueous adjuvant.

The invention has the beneficial effects that:

previous researches in this subject group found that the DNA vaccine prepared by mixing the cell-penetrating peptide and pVAX-Cap plasmid can improve the immune response level in mice. In the research, TAT, ppTG20 and HBM are fused with the N end of PCV2Cap protein, so that the recombinant baculovirus is successfully constructed, the Cap protein is effectively expressed, and a foundation is laid for PCV2 gene engineering vaccine research.

Drawings

FIG. 1 shows the technical scheme for construction of recombinant baculovirus with TAT, ppTG20, HBM and Cap fusion genes

FIG. 2 restriction enzyme analysis identification of recombinant plasmid

pFast-Bac-ppTG 20-cap; pFast-Bac-TAT-cap; pFast-Bac-HBM-cap; pFast-Bac-cap

A:M.DL5000DNA marker；1.ppTG20-cap；2.digestion product of pFast-Bac-ppTG20-cap；3.plasmid digestion control；

B:M.DL5000DNA marker；1.TAT-cap；2.digestion product of pFast-Bac-TAT-cap；3.plasmid digestion control；

C:M.DL5000DNA marker；1.HBM-cap；2.digestion product of pFast-Bac-HBM-cap；3.plasmid digestion control；

D:M2.DL5000DNA marker；1.digestion product of pFast-Bac-cap；2.plasmid digestion control

FIG. 3 PCR identification of recombinant plasmids

M.DL5000DNA marker；1-2.PCR product of rBac-ppTG20-cap using M13F+ppTG-F,2489bp；3-4.PCR product of rBac-HBM-cap using M13F+HBM-F,2496bp；5.PCR product of rBac-TAT-cap using M13F+TAT-F,2459bp；6.PCR product of rBac-cap using M13F+cap-F,2393bp

FIG. 4 cytopathic effect of SF9 cells after infection with recombinant baculovirus

FIG. 5Western blotting identification of recombinant baculovirus

FIG. 6 identification of recombinant baculovirus IFA (200 ×)

FIG. 7 Electron microscopy of Virus-like particles

FIG. 8 determination results of PCV2ELISA antibodies of mice immunized with different recombinant proteins

FIG. 9 detection of neutralizing antibodies to PCV2 in immunized mice

FIG. 10 measurement results of lymphocyte proliferation reaction in immunized mice

FIG. 11 detection results of ELISA antibody levels after piglet immunization

FIG. 12 detection results of neutralizing antibody levels after piglet immunization

FIG. 13 determination of relative daily gain of pigs in each group after challenge

FIG. 14 detection of porcine viral hemotopathy in groups after challenge

FIG. 15 detection of viral content in lymphoid tissues

FIG. 16 detection result of PCV2 antigen IHC in lymph node tissue (HE staining, 400 ×)

Detailed Description

Example I construction and identification of porcine circovirus type 2 recombinant baculovirus

In the embodiment, a PCR method is adopted to fuse porcine circovirus type 2 (PCV2) ORF2 optimized codon gene with cell-penetrating peptide ppTG20, TAT and bee signal peptide (HBM) gene, clone to a baculovirus vector pFast-Bac-Dual, after enzyme digestion and gene sequencing identification are correct, DH10Bac competence is respectively transformed, blue and white spots are used to screen the clone which is correctly transposed to Bacmid, genome is extracted, Bacmid is transfected into Sf9 insect cells by liposome, cell lysate is collected after cytopathic effect appears, recombinant baculovirus rBac-Cap, rBac-ppTG20-Cap, rBac-TAT-Cap and rBac-HBM-Cap are obtained, Western blot and immunofluorescence technology identification is adopted, and the result shows that four recombinant viruses can express Cap protein, the expression level of two cell-penetrating peptide fusion Cap genes in a baculovirus expression system is obviously higher than that of the bee signal peptide-Cap fusion gene recombinant viruses, the recombinant proteins TAT-cap and ppTG20-cap are obviously superior to HBM-cap and cap in antigenicity, and TAT-cap, ppTG20-cap and HBM-cap can all form virus-like particles, thereby laying a foundation for PCV2 genetic engineering vaccine research.

1 materials and methods

1.1 Main Material

Insect Baculovirus Expression System (BEVS) was purchased from Invitrogen corporation and includes pfastbach ht B, pfastbacatal plasmid, DH10Bac strain, Sf9 insect cells. Coli DH 5. alpha. was stored in the laboratory, and restriction enzymes, T4DNA ligase and Taq enzyme used in the experiment were purchased from Takara. DNA recovery kit and plasmid extraction kit were purchased from Dingguo corporation. Grace medium, Express Five serum-free medium and FBS for culturing insect cells are products of Gibco company. The transfection reagent Lipofectamine2000 was purchased from Invitrogen. HRP-labeled goat anti-mouse IgG and FITC-labeled SPA were purchased from bosd.

Monoclonal antibody 3E5 to PCV2Cap protein was prepared and stored by the laboratory. The monoclonal antibody is secreted by a hybridoma cell strain with the preservation number of CGMCC NO. 8169. The preparation process comprises the following steps: taking healthy female Balb/c mice of 6-8 weeks old, and injecting 0.5 mL/mouse of sterilized liquid paraffin into the abdominal cavity; 7 days later, each mouse was inoculated with 1-2X 10 cells in the abdominal cavity⁶And (3) hybridoma cells. Before inoculation, the culture solution is discarded from the hybridoma cells, the cells are washed twice by serum-free RPMI 1640 culture solution, serum protein is washed off as much as possible, the cells are blown off and prepared into the culture solution with the concentration of 4-5 multiplied by 10⁶Cell suspension per mL. Under sterile conditions, 0.5mL of cell suspension was injected into the abdominal cavity of the mice. The hybridoma cells propagate in the abdominal cavity of the mouse in the form of ascites tumor in a large amount, after 7 to 10 days, the abdomen of the mouse is obviously swollen, the mouse has fluctuation feeling and shows a state of listlessness and messy fur, and the ascites can be collected at this moment. When ascites was collected, the skin of the back of the neck, left hind leg and tail of the mouse were grasped by the left hand with the abdomen facing the experimenter and the head inclined downward at 45 degrees. After the mouse is inserted into the abdominal cavity from the groin by using a No. 12 needle, the head of the mouse is enabled to be upward and the abdomen of the mouse is enabled to be downward rapidly, and the ascites naturally flows out and is collected. After two or three days, the abdomen is distended and can be collected again, and the abdomen can be collected for 2-3 times generally. And (3) collecting the ascites into a centrifuge tube, centrifuging for 10min at 4000rpm, taking the intermediate colorless transparent layer liquid, namely the monoclonal antibody 3E5 ascites, and freezing and storing for later use at 20 ℃.

1.2PCV2Cap target gene molecule design

The following 4 PCV2Cap gene molecules are designed, amplified by a PCR method and used for constructing recombinant baculovirus.

1.2.1 codon sequence optimized PCV2Cap gene and recombinant plasmid pVax-Cap construction

A PCV2Cap gene (shown below) was designed according to a codon gene sequence preferred by eukaryotic cells, synthesized by Invitrogen corporation, and cloned into a pVax plasmid to obtain a recombinant plasmid pVax-Cap, wherein the target gene contains BamH I and Xho I at both ends. The specific construction method comprises the following steps: and carrying out double enzyme digestion treatment on the recovered and purified Cap gene and pVAX1 by using BamH I and Xho I restriction enzymes under the condition of 37 ℃ water bath for 4h, and recovering and purifying the Cap gene and pVAX1 enzyme digestion products by using a DNA gel recovery kit. T4 ligase is adopted, overnight connection is carried out at 16 ℃, a ligation product is transformed into DH5 alpha competent cells, single colony is selected for culture, suspected recombinant plasmid is extracted, PCR and double enzyme digestion identification are carried out, bacterial liquid containing positive plasmid is sent to Invitrogen company for sequencing identification, and positive recombinant plasmid pVAX-Cap is obtained.

The sequence of the artificially synthesized codon-optimized Cap gene is shown in SEQ ID NO. 7.

1.2.2 Cap Gene of fusion cell-penetrating peptide Gene sequence TAT (TAT-Cap)

Designing primers TAT-Cap-F, 5' -CG according to sequence TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA (SEQ ID NO.8) of TAT gene of cell-penetrating peptide and sequence of Cap gene in pVax-CapCTCGAGATGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAATGACCTACCCCC-3’(SEQ ID NO.11)，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3' (SEQ ID NO.16), and amplifying to obtain the TAT-cap gene.

1.2.3 Gene sequence of fusion penetrating peptide the Cap gene of ppTG20 (ppTG20-Cap)

According to the sequence GGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCA (SEQ ID NO.9) of the transmembrane peptide ppTG20 gene and the sequence of the Cap gene in pVax-Cap, a primer ppTG20-Cap-F1, 5' -CG is designedCTCGAGATGGGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACT-3’Xhol(SEQ ID NO.12)，ppTG20-cap-F2，5’-CTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCAATGACCTACCCCCGCCGCCG-3’(SEQ ID NO.13)，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3’(SEQ ID NO.16)，Two PCR amplifications yielded the ppTG20-cap gene.

1.2.4 Cap Gene fused with HBM Gene sequence (HBM-Cap)

Based on the HBM gene sequence ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATACATTTCTTACATCTATGCGGATCGA (SEQ ID NO.10) and the Cap gene sequence in pVax-Cap, primers HBM-Cap-F1, 5' -CG were designedCTCGAGATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATAC-3’Xhol(SEQ ID NO.14)，HBM-cap-F2，5’-TTTATGGTCGTATACATTTCTTACATCTATGCGGATCGAATGACCTACCCCCGCCGCCG-3’(SEQ ID NO.15)，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3' (SEQ ID NO.16), and obtaining the HBM-cap gene by two times of PCR amplification.

According to the technical scheme of FIG. 1, recombinant baculovirus is constructed.

TABLE 1 primers and sequences thereof for amplifying different gene fragments

1.3 construction of recombinant baculovirus expression plasmid

1.3.1 amplification of target Gene

The plasmid pVax-Cap was used as a template to amplify each corresponding Cap gene fragment by PCR using the primers described above. The membrane-penetrating peptide gene is brought to the N end of the cap gene by a secondary PCR method, for example, an upstream primer of HBM-F2 and cap-R are used for taking pVac-cap plasmid as a template, the amplified target gene band is subjected to gel cutting and then gel recovery and purification, secondary PCR is carried out by utilizing the upstream primer of HBM-F1 and cap-R for recovering a product as a template, and the target band is amplified and recovered. The amplification method of ppTG20-cap is the same as that of HBM-cap; TAT-cap can be obtained only by PCR once due to the relative short segment. PCR was performed using PrimeSTAR Mix Fidelity polymerase premix, and 25. mu.L of the reaction system contained PrimeSTAR Mix 10.5. mu.L, primers 1. mu.L each, template DNA 1. mu.L and dd H₂O11.5. mu.L. The reaction procedure was as follows: 35 cycles of 95 ℃ for 5min, 98 ℃ for 10sec, 58 ℃ for 5sec, 72 ℃ for 45s, and finally an extension at 72 ℃ for 10 min. The PCR product was identified by 1% gel electrophoresis.

1.3.2 cloning and identification of target genes

The PCR product was purified by gel recovery kit. Extracting and purifying target genes and a vector pFast-Bac-dual, and performing enzyme digestion respectively. The enzyme digestion system is as follows: 20/14 μ L of target gene/vector, 1.5 μ L of enzyme, 10 XBuffer 3 μ L and dd H2O 4/10 μ L. Ligation was performed after digestion for 4h at 37 ℃ and recovery of the gel. The 10. mu.L ligation was as follows: 7 mu L of target gene and 1 mu L, T4 of vector ligase 1 mu L, T4Buffer 1 mu L. And (3) connection reaction: the 16 ℃ ligase was ligated overnight. Coli DH 5. alpha. competent cells were prepared. mu.L of the ligation product was added to 100. mu.L of DH 5. alpha. competent cells, gently mixed and ice-cooled for 30 min. Thermally shocking at 42 deg.C for 90s, rapidly placing in ice water, and ice-cooling for 1 min; adding 800 μ L LB liquid culture medium, shaking at 37 deg.C and 220rpm for 45min, coating the transformed product of the vector and the target gene connection on 50 μ g/mL ampicillin LB plate, incubating overnight at 37 deg.C, selecting positive clone and extracting plasmid. And carrying out double enzyme digestion identification on the recombinant plasmid, and carrying out Kingsry sequencing after the identification is correct. The recombinant plasmid was named: pFast-Bac-HBM-cap, pFast-Bac-ppTG20-cap, pFast-Bac-TAT-cap and pFast-Bac-cap.

1.4 construction of recombinant baculovirus

1.4.1 construction and identification of recombinant Bacmid

Frozen DH10Bac strain was inoculated into 3ml LB medium containing 50. mu.g/ml kanamycin to prepare competent cells. Positive plasmid was transformed into competent cells DH10Bac and plated on LB plates containing 10. mu.g/mL tetracycline, 50. mu.g/mL kanamycin, 7. mu.g/mL gentamicin, 100. mu.g/mL X-gal and 40. mu.g/mL IPTG. Culturing at 37 ℃ in an incubator for 48 hours in the dark until remarkable blue-white colonies appear. A single white single colony is selected and inoculated in a liquid LB culture medium containing 10ug/ml tetracycline, 50ug/ml kanamycin and 7ug/ml gentamicin, is subjected to shaking culture at the temperature of 37 ℃ and the rpm of 250 for more than 12 hours, and the recombinant vector backbone Bacmid is extracted according to an improved alkaline lysis method in Bac-to-Bac baculovirus expression system specifications. The Nanjing Kingsrey biotech company determines the sequence of a target gene and identifies the correct recombinant Bacmid for subsequent transfection experiments.

1.4.2 acquisition and passage of recombinant baculovirus

Transfecting Sf9 cells with recombinant Bacmid by using a Lipofectamine2000 transfection reagent, incubating in an incubator at 27 ℃ for 6h, absorbing transfection mixed liquid, directly adding 2mL of Grace's complete culture medium containing 10% FBS, continuously culturing at 27 ℃ until obvious lesion appears in the Sf9 cells, and harvesting the cells and culture supernatant. Centrifuging at 500g for 5min, collecting supernatant, and storing at 4 ℃ in a dark place to obtain the F1 generation recombinant virus. Cells were used to identify protein expression. Infecting new Sf9 cells with the first generation recombinant virus according to the volume ratio of 1:10, culturing at 27 ℃ for 3 days until the cells have obvious lesion, centrifuging for 5min at 500g, removing cells and large cell debris, collecting supernatant, storing at 4 ℃ in a dark place to obtain the second generation virus, and obtaining the third generation virus by the same method.

1.5Western Blot identification of recombinant Cap

Recombinant baculovirus was expressed as 1:10 vol% infected Sf9 cells in logarithmic growth phase, while setting up a normal Sf21 cell control, and cell cultures were harvested aseptically 72h post infection. Collecting supernatant as seed poison, and storing at 4 deg.C; gently blowing down the cells with an appropriate amount of 0.01M PBS (phosphate Buffer) with pH7.2, centrifuging for 5min at 500g, resuspending the cell pellet with an appropriate amount of PBS, adding an appropriate amount of Loading Buffer, boiling, performing SDS-PAGE electrophoresis, transferring to a nitrocellulose membrane (NC membrane), rinsing with deionized water, sealing with PBST sealing solution containing 10% skim milk, and gently shaking at room temperature for 2 h. PCV2Cap monoclonal antibody (1: 2000 dilution) was added and shaken gently at room temperature for 1.5 h. The NC membrane was washed with PBST, goat anti-mouse Ig G-HRP (diluted with PBST 1: 10000) was added and shaken gently for 45min at room temperature. NC membranes were washed with PBST. Using a chemiluminescence kit to develop color, carrying out X-ray film development in a dark room, and observing a specific protein band.

1.6 Indirect immunofluorescence assay (I FA)

Recombinant virus was seeded in a monolayer of Sf9 cells in 96-well plates, with normal Sf9 cells as negative controls. Culturing at 27 deg.C for 2 days, removing culture supernatant before obvious pathological changes appear in cells, washing cells with PBS, fixing with precooled 80% acetone, and acting at 4 deg.C for 10 min. PBS was washed 2 times for 5min, and PCV2 monoclonal antibody diluted 1:500 was added and incubated at 37 ℃ for 1 h. Washing with PBS for 3 times, each for 5min, adding 1:200 diluted goat anti-mouse IgG-FITC, incubating at 37 deg.C for 45min, washing with PBS for 3 times, observing under fluorescent microscope, and recording the result.

1.7 determination of double antibody Sandwich ELISA

Recombinant baculovirus-infected Sf9 cell lysate solution was collected and PCV2 antigenicity was determined using a double antibody sandwich ELISA method. The sandwich ELISA comprises the following specific steps: coating: PCV2 monoclonal antibody 3E5 was diluted 500-fold with antigen coating solution and used for coating, 100ul per well, first left at 37 ℃ for 0.5h, then at 4 ℃ overnight. ② washing with PBST for 3 times, each time for 3min, preparing 5% skim milk with PBST, each well being 200ul, standing at 37 ℃ for 1 h. ③ washing with PBST for 3 times, adding the antigen to be detected, 100ul per well, and standing at 37 ℃ for 1 h. After washing, the treated rabbit anti-PCV 2 serum (1:3000 dilution) was added thereto, and the mixture was left at 37 ℃ for 1 hour at 100ul per well. Fifthly, washing with PBST for 4 times, adding goat anti-rabbit IgG-HRP diluted by 10000 times with PBST, 100ul per well, and standing at 37 ℃ for 1 h. Sixthly, adding TMB after washing, and developing for 10min at 37 ℃. Each hole is added with 50ul 2M H₂SO₄The reaction was stopped and the OD read with a microplate reader₄₅₀Numerical values.

1.8 Virus-like particle (VLP) Observation

The obtained recombinant baculovirus Bac-TAT-Cap is inoculated to Sf9 cells to express recombinant protein in large quantity. After inoculation, the cells are cultured in an incubator at 27 ℃ for 96h, and when the cells have obvious lesions, the cells are collected by centrifugation at 500g for 5 min. The cell pellet was resuspended with an appropriate amount of PBS, sonicated on ice for 10min, and centrifuged at 12000rpm at 4 ℃ for 15min to harvest the supernatant. And purifying the Cap protein in the supernatant by affinity chromatography. The method comprises the following specific steps: adding 2 mu L of PCV2 monoclonal antibody 3E5 into 400 mu L of protein sample, uniformly mixing, and then shaking in ice bath for 2 h; ② sucking 50 mu L protein A resin into a 1.5mL centrifuge tube, washing 3 times with PBS; thirdly, adding the protein sample into a centrifugal tube containing resin, and stirring for 2 hours in ice bath to keep the resin in a suspension state; fourthly, sucking the supernatant after low-speed centrifugation, and washing the resin for 3 times by PBS; sixthly, adding 50 mu L of eluent into the resin, and carrying out ice bath for 30 min; low speed centrifuging to collect supernatant and freezing at-20 deg.c for further use. The harvested protein is subjected to phosphotungstic acid negative staining and then observed by a transmission electron microscope, and whether virus-like particles are formed or not is detected.

2 results

2.1 construction and identification of recombinant plasmids

Carrying out agarose nucleic acid electrophoresis on the PCR product, wherein a specific band appears on the expected size position of the PCR product, and the size of HBM-cap is 774 bp; the size of ppTG20-cap is 768 bp; TAT-cap size is 741 bp.

Cloning the target gene amplified by PCR into pFast-Bac-dual, respectively, transforming E.coli DH5 alpha competent cells, and picking single colony to extract plasmids. And (3) performing double enzyme digestion analysis on the positive plasmids, and cutting out fragments with the same size as the target genes (figure 2) as the results, wherein the gene sequencing results are all correct, and the named recombinant plasmids are pFast-Bac-HBM-cap, pFast-Bac-ppTG20-cap, pFast-Bac-TAT-cap and pFast-Bac-cap.

2.2 acquisition of recombinant Bacmids and recombinant baculoviruses

Transforming the recombinant vector plasmid into competent DH10Bac, screening by two rounds of blue-white spots, picking 2 white colonies of each plasmid, oscillating overnight, extracting the plasmid by an alkaline lysis method, and respectively carrying out PCR identification on the target gene (shown in figure 3) by using a downstream primer or an upstream primer of a universal primer M13 and a target gene upstream or a downstream primer, namely the recombinant Bacmids.

After the Bacmids are transfected to the cells and cultured for 7-10 days, the cells have obvious lesions and are shown as enlarged, rounded and bright edges (figure 4), and viruses are harvested and named as rBac-HBM-cap, rBac-ppTG20-cap, rBac-TAT-cap and rBac-cap and are stored at 4 ℃.

2.3 identification of recombinant baculovirus

Identifying Cap protein by Western blot: 3 kinds of recombinant viruses and rBac-Cap are respectively inoculated to Sf9 cells, and the cells are obviously diseased after being cultured for 4-5 days. Supernatant virus fluid was collected and cells were blown down and freeze-thawed three times with sterile PBS and then Western blotting was performed, the results are shown in figure 5. The sizes of the Cap, ppTG20-Cap, HBM-Cap and TAT-Cap recombinant proteins are about 29kd, wherein the expression levels of the ppTG20-Cap and the TAT-Cap are obviously higher than those of the Cap and HBM-Cap groups.

IFA identification of Cap protein: 3 kinds of recombinant viruses and rBac-Cap are respectively inoculated to Sf9 cells, cells are fixed for 3 days to carry out IFA identification, and the result is shown in figure 6, wherein the fluorescence quantity of rBac-TAT-Cap expression products is the largest.

2.4 comparison of antigenicity of recombinant proteins

3 kinds of recombinant viruses and rBac-Cap are respectively inoculated to Sf9 cells, and the cells are obviously diseased after being cultured for 5 days. Cells were harvested, freeze-thawed three times, and then subjected to sandwich ELISA, with results shown in table 2. TAT-cap and ppTG20-cap have higher antigenicity than HBM-cap, wherein TAT-cap has highest antigenicity, and the antigenicity is similar to that of 50-fold diluted Boringer's PCV2 subunit vaccine after 800-fold dilution.

TABLE 3 Sandwich ELISA method for detecting antigenicity of recombinant proteins

2.5 Electron microscopy

The recombinant virus is inoculated with Sf9 cells for expanded culture, the cells are cracked to obtain TAT-cap, ppTG20-cap and HBM-cap proteins, protein particles are purified by sucrose density gradient centrifugation, and transmission electron microscope observation is carried out, so that three recombinant proteins can form VLPs, and the size of the VLPs is about 20nm (figure 7).

Discussion of 3

The research utilizes different genes to fuse Cap proteins and explores the effect of the factors on the Cap proteins in a baculovirus expression system. Research results show that the cell-penetrating peptide can improve the expression amount of Cap in baculovirus, and HBM signal peptide has no effect of secreting and expressing Cap protein, which may be related to the nuclear localization sequence of Cap protein, and further research is needed. The penetrating peptide fused with the Cap gene has higher baculovirus protein expression level, probably because the penetrating peptide can guide baculovirus to enter cells more easily and promote the proliferation of virus in the cells, thereby improving the expression quantity of the Cap protein and enhancing the presentation of the Cap protein to the cell surface. According to the observation result of an electron microscope, the fusion of the polypeptides at the end N of the Cap does not influence the Cap to form virus-like particles, and an important basis is laid for the research of PCV2 recombinant subunit vaccines.

4 small knot

The research adopts a PCR method to fuse optimized codon genes of porcine circovirus type 2 (PCV2) ORF2 with genes of cell penetrating peptides ppTG20, TAT and bee signal peptide (HBM), 4 recombinant baculoviruses are successfully constructed and obtained and are identified by Western blot and immunofluorescence technology, and the result proves that the rBac-TAT-cap and the rBac-ppTG20-cap have the highest expression quantity and the best antigenicity, and the recombinant proteins can effectively form virus-like particles and can be used as candidate seed viruses of PCV2 recombinant subunit vaccines.

EXAMPLE two comparison of the immune characteristics of mice expressing four recombinant proteins PCV2Cap expressed by baculovirus

The research adopts 4 Cap proteins expressed by recombinant baculovirus rBac-TAT-Cap, rBac-ppTG20-Cap, rBac-HBM-Cap and rBac-Cap, and utilizes CP974S aqueous adjuvant to prepare PCV2 subunit vaccines TAT-Cap, ppTG20-Cap, HBM-Cap and Cap, and carries out mouse immunity test, and the result shows that 4 vaccines can induce to generate PCV2 antibody, but the neutralizing antibody and cell immunity level induced by the ppTG20-Cap and TAT-Cap recombinant virus subunit vaccines are obviously higher than those of the Cap subunit vaccines, so that the research has important application prospect.

1 materials and methods

1.1 Main materials and Experimental animals

Recombinant baculovirus rBac-TAT-Cap, rBac-ppTG20-Cap, rBac-HBM-Cap and rBac-Cap for expressing Cap protein are all constructed and stored in the laboratory. High Five cells (ATCC, usa) were stored in this laboratory; PCV2 monoclonal antibody 3E5 was prepared and stored by the laboratory.

CP974S water adjuvant: the formula is designed by the laboratory, and the preparation method comprises the following steps: adding 50-60 g of carbomer into 9800ml of distilled water, mixing uniformly after full swelling, sterilizing at 115 ℃ for 30 minutes under high pressure to form jelly, and standing at room temperature. Slowly adding a sterilized 5-6% sodium hydroxide solution (5-6 g/100mL) before use to convert the sodium hydroxide solution into a water-soluble property, adding 20-30 mu g/mL haemophilus parasuis capsular polysaccharide, 30-40 mu g/mL bacterial protein OMP, 20-30 mu g/mL bacterial DNA and 0.01-0.03% tocopherol aqueous solution (10-30 mg/100mL) (filtering and sterilizing by using a 0.45 mu m filter membrane), adding sterilized distilled water to 10000mL, fully stirring and uniformly mixing, and storing at 2-8 ℃ for no more than 12 months.

5-week-old clean grade ICR mice were tested for PCV2 antibody negativity by indirect ELISA.

1.2 vaccine preparation

The same titer of recombinant baculovirus (10)^5.0TCID₅₀/mL) inoculated with Sf9 insect cells 96 hours after infectionAnd collecting the cells with the pathological changes. Cell culture supernatants were first aspirated, each flask of cells (75 cm)²) Adding 1mL of 0.01mol/L PBS solution with pH value of 7.2, blowing down the cells, and then carrying out ultrasonic lysis on the cell suspension to obtain the cell lysate containing PCV2Cap protein. The content of Cap protein is measured by a sandwich ELISA method, and the concentration of the target protein is adjusted to be 30 mug/mL. Mixing target protein antigen and CP974S adjuvant at a ratio of 4:1, stirring at 300r/min, mixing thoroughly for 10min to obtain 4 kinds of vaccines including TAT-cap, ppTG20-cap, HBM-cap and cap, and storing at 4 deg.C for use.

1.3 mouse Immunity test

50 clean-grade mice were randomly divided into 5 groups, 1-4 groups were TAT-cap, ppTG20-cap, HBM-cap and cap vaccination groups, and 5 groups were PBS control groups. Mice were acclimated for 2 days before first immunization by dorsal subcutaneous multipoint injection at a vaccine immunization dose of 200 μ L. Booster immunizations were performed 14d after prime, and the dose and method of booster immunizations were the same as before. At 28 th and 42 th days after primary immunization, randomly taking 5 mouse eyeballs from each group, collecting blood, separating serum, and respectively determining the titer of an ELISA antibody and a neutralizing antibody; spleen of mouse is picked up aseptically, and lymphocyte is separated after being ground by adding sterilized PBS, and lymphocyte proliferation reaction is measured.

1.4ELISA antibody detection

The envelope antigen is the CapC prepared, purified and stored in the laboratory, and the protein is expressed by Escherichia coli. Diluting with pH9.6 carbonate buffer solution to final concentration of 5ug/ml, coating with ELISA plate, performing reaction at 37 deg.C for 2 hr, and coating at 4 deg.C overnight; washing for 3 times, each for 3-5 min; adding 200 μ L of 0.15% BSA blocking solution to each well, and allowing the solution to act at 37 deg.C for 2 hr; washing; diluting the serum to be detected by PBS (phosphate buffer solution) in a multiple ratio, adding 100 mu L of the serum to each hole in one line of each sample, and acting for 1h at 37 ℃; washing; then adding enzyme-labeled goat anti-mouse IgG (1:5000 times dilution), 100 mu L/hole, and acting for 1h at 37 ℃; washing; adding substrate solution TMB for color development, and finally using 2mM H₂SO₄The reaction was terminated. And (4) judging a result: OD of serum to be detected₄₅₀Value/negative serum OD₄₅₀The value is more than or equal to 2.1, and the positive result is obtained.

1.5 detection of neutralizing antibodies

Inactivating the serum to be detected in 56 deg.C water bath for 30min 1After sterilization by centrifugation at 2000rpm for 10min, the supernatant was aspirated into a sterilized EP tube. The treated serum was diluted in a maintenance solution at a ratio of 1: 4, 1:8, 1: 16, 1: 32, … … in this order, and the proliferated PCV2 was diluted to 200TCID in the maintenance solution₅₀0.1mL, then mixed with serum of different dilutions in equal volume, and subjected to water bath at 37 ℃ for 1 h. The nutrient solution in the 96-well plate with PK15 cells was discarded, the cells were washed once with pure DMEM, and the water-bathed serum virus mixture was added to the wells in 3 replicates per serum dilution set at 100. mu.L per well for 72h at 37 ℃. And simultaneously setting a negative serum control, a negative serum virus control and a blank control. After 72h, the neutralizing antibody titer of the serum was measured by indirect immunofluorescence assay (IFA), and the maximum dilution of the serum capable of inhibiting 50% PCV2 infection was used as the neutralizing antibody titer of the serum to be tested.

1.6 lymphocyte proliferation assay

Blood was collected from the eyeballs of the mice, and the mice were sacrificed by cervical dislocation. Under aseptic conditions, the spleen was removed and connective and adipose tissues were excised from the spleen with scissors. Placing the spleen obtained by separation into a 200-mesh filter screen membrane, adding 3ml PBS, performing aseptic grinding, transferring the spleen cell suspension into a centrifuge tube containing lymphocyte separation liquid, and centrifuging at 2000rpm for 15 min. Sucking the gray cells in the middle layer by using a suction tube, putting the gray cells into another test tube, adding 5mL of erythrocyte lysate, uniformly mixing the spleen cells, standing for 5min, centrifuging at 2000rpm for 10min after the erythrocytes are completely crushed, and removing the erythrocytes by discarding the supernatant. The cell pellet was washed again by adding 5mL of pure 1640, centrifuged at 2000rpm for 10min, the supernatant was discarded, and diluted to 5X 10 with 10% 1640⁶one/mL, added to 96-well plates, 100. mu.L per well. PCV2 was used as a stimulating antigen and ConA as a control, cultured at a final concentration of 10. mu.g/mL for 72h at 37 ℃ with 20. mu.L of MTT (5mg/mL) added to each well, 3 replicates each, and cultured at 37 ℃ for an additional 6 h. The culture medium in 96 wells was discarded, DMSO was added, 100 μ L of each well was shaken to melt the purple crystals, and the OD value at a wavelength of 570nm was measured to calculate the stimulation index (SI ═ OD value of stimulated well/OD value of non-stimulated well).

1.7 statistical analysis of data

Statistical analysis was performed on the experimental data using SPSS software and the differences between the values of each group were compared, where P <0.05 indicated significant differences and P <0.01 indicated very significant differences.

2 results

2.1ELISA antibodies

The results are shown in FIG. 8. The vaccine TAT-cap, ppTG20-cap, HBM-cap and cap can induce PCV2 antibody after being immunized for 14 days for the first time, and 28 days and 42 days after the first immunization, all four vaccine immunization groups generate high-level ELISA antibody, while the negative control group does not detect PCV2 specific antibody.

2.2 neutralizing antibodies

The results are shown in FIG. 9. 28 and 42 days after the first immunization, the level of neutralizing antibodies of PCV2 in the TAT-cap and ppTG20-cap vaccine immunization group is obviously higher than that in the HBM-cap and cap vaccine immunization group (P < 0.05). Meanwhile, no neutralizing antibody of PCV2 was detected in the negative control group.

2.3 cellular immune response

The results are shown in FIG. 10. 28-42 days after the first immunization, PCV2 specific SI of TAT-cap and ppTG20-cap vaccine immunization groups is obviously higher than that of HBM-cap and cap vaccine immunization groups (P is less than 0.05).

3 conclusion

The research prepares the recombinant Cap protein subunit vaccine expressed by recombinant baculovirus rBac-TAT-Cap, rBac-ppTG20-Cap, rBac-HBM-Cap and rBac-Cap. The four vaccines can induce mice to generate PCV2ELISA antibodies and neutralizing antibodies, but the neutralizing antibodies and cellular immunity level of the TAT-cap and ppTG20-cap vaccines are obviously higher than those of the HBM-cap and cap vaccines, and the humoral immunity level and the cellular immunity level of the TAT-cap and ppTG20-cap recombinant protein vaccines are similar, so that the vaccine has an important application prospect.

EXAMPLE three PCV2Cap protein recombinant baculovirus vaccine pig body immune protective efficacy research

The research uses recombinant proteins expressed by recombinant baculovirus rBac-TAT-cap and rBac-ppTG20-cap to prepare vaccines, carries out swine immune protection tests, and compares the results with imported commercial PCV2 subunit vaccines, wherein the results are as follows: ELISA antibodies were detected 2 weeks after immunization, and 4 weeks after immunization, the neutralizing antibody levels in the TAT-Cap group, ppTG20-Cap and commercial vaccine groups were 1:90, 1:85 and 1:72, respectively. When a challenge test is carried out 4 weeks after immunization, both the TAT-Cap and ppTG20-Cap vaccines can provide immune protection for the challenged piglets, the viremia of the immunized pigs, the pathological changes of tissues of lymph nodes and lungs and the virus load of the tissues of the lymph nodes are all obviously lower than those of a non-immune control group, the immune effect is slightly better than that of a commercial PCV2 subunit vaccine, and the vaccine has an important application prospect.

1 materials and methods

1.1 Main materials and reagents

Porcine circovirus type 2SH strain (PCV2SH, a virus strain which is conventionally separated) is separated, identified and stored by the laboratory; PK15 cells and SF9 cells (ATCC, usa) were stored by the laboratory; recombinant baculovirus rBac-TAT-Cap and rBac-ppTG20-Cap for expressing Cap protein are constructed and stored in the laboratory; freund's complete adjuvant, incomplete adjuvant, keyhole limpet hemocyanin and thioglycollic acid medium were purchased from SIGMA company, and CP940S water adjuvant was prepared in this laboratory; PCV2 monoclonal antibody 3E5 was prepared and stored by the laboratory; goat anti-mouse IgG-HRP, SPA-HRP, goat anti-mouse IgG-FITC and DAB color development kits were purchased from Dr. Wuhan bioengineering company; the virus DNA extraction kit is purchased from OMEGA; the human peripheral blood lymphocyte separation solution was purchased from Tianjin N.P.biol.Ltd. Other conventional reagents are analytically pure.

1.2 Experimental animals

5-week-old clean-grade ICR mice are detected to be PCV2 antibody negative by indirect ELISA; after the detection, the antigen antibodies of PCV2 and PRRSV are negative in the 30-day-old weaned piglets, and the weaned piglets are isolated and raised.

1.3 preparation of the vaccine

Recombinant baculovirus rBac-TAT-cap and rBac-ppTG20-cap (10) are taken^7.5TCID₅₀/ml) inoculated with Sf9 insect cells (10)^6.0One cell/ml), culturing for 96 hours, centrifuging at low speed, removing supernatant, adding PBS solution (0.01mol/L, pH 7.2) with the same volume as the original volume, carrying out ultrasonic lysis to obtain two PCV2Cap protein liquids, mixing the two PCV2Cap protein liquids with CP974S water-soluble adjuvant according to the volume ratio of 4:1 to prepare two vaccines TAT-Cap and ppTG20-Cap, and storing at 4 ℃ for later use.

1.4 piglet immune protection test

Screening 25 weaned piglets with age of 30 days, detecting that PCV2 and PRRSV antigen-antibody are negative and randomly dividing the negative into 5Groups, 5 in each group, and each group is isolated and raised. The first group was inoculated with PCV2TAT-cap subunit vaccine, i.e. 1mL intramuscular, the second group was inoculated with PCV2ppTG20-cap subunit vaccine, the third group was inoculated with CiroFLEX imported commercial subunit vaccine (briringer), the fourth group was not inoculated as Challenge Control (CC), and the fifth group was not inoculated as blank control (NC). Blood was collected 14, 21 and 28 days after immunization and sera were isolated for ELISA and neutralizing antibody detection. The piglets in the immunization group and the challenge group are challenged 28 days after immunization, and PCV2SH strain (containing 10 strains)^6.0TCID₅₀And/ml) dripping into nose of 1ml, intramuscular injecting of 2ml, and isolated feeding. 4 th day and 7 th day after challenge, all pigs were inoculated with keyhole limpet hemocyanin (KLH/ICFA, 0.5mg/ml) emulsified with Freund's incomplete adjuvant at 4 spots in the axilla and hip of each pig, 1ml (4 ml/head) was inoculated at each spot, and simultaneously, thioglycolic acid medium was inoculated at 10 ml/head in the abdominal cavity; the 11 th day and 19 th day after the challenge were inoculated with thioglycollic acid medium again, 10 ml/head. All piglets were body temperature measured every morning after challenge and were observed for clinical performance. Blood is collected 7, 19 and 28 days after the virus attack, and serum is separated for detecting viremia. The weight of each pig was weighed 0 and 28 days after challenge, respectively, and the relative daily gain (RDWG) was calculated. All piglets are killed and dissected 28 days after the virus attack, the pathological changes of the lung, lymph nodes and other organs of each pig are observed, and the lymph nodes and the lung are fixed in 4% paraformaldehyde for tissue section preparation and immunohistochemical tests.

1.5ELISA antibody detection

The envelope antigen is the CapC prepared, purified and stored in the laboratory, and the protein is expressed by Escherichia coli. Diluting with pH9.6 carbonate buffer solution to final concentration of 5ug/ml, coating with ELISA plate, performing reaction at 37 deg.C for 2 hr, and coating at 4 deg.C overnight; washing for 3 times, each for 3-5 min; adding 200 μ L of 0.15% BSA blocking solution to each well, and allowing the solution to act at 37 deg.C for 2 hr; washing; diluting the serum to be detected by PBS (phosphate buffer solution) in a multiple ratio, adding 100 mu L of the serum to each hole in one line of each sample, and acting for 1h at 37 ℃; washing; then adding enzyme-labeled SPA (diluted by 1:10000 times), 100 mu L/hole, and acting at 37 ℃ for 1 h; washing; adding substrate solution TMB for color development, and finally using 2mM H₂SO₄The reaction was terminated. And (4) judging a result: OD of serum to be detected₄₅₀Value/negativitySerum OD₄₅₀The value is more than or equal to 2.1, and the positive result is obtained. The maximum serum dilution that was judged positive was taken as the antibody titer of the sample.

1.6 detection of neutralizing antibodies

The serum to be detected is inactivated in 56 ℃ water bath for 30min, and after centrifugation at 12000rpm for 10min to sterilize, the supernatant is sucked out to a sterilized EP tube. The treated serum was diluted in a maintenance solution at a ratio of 1: 4, 1:8, 1: 16, 1: 32, … … in this order, and the proliferated PCV2 was diluted to 200TCID in the maintenance solution₅₀0.1mL, then mixed with serum of different dilutions in equal volume, and subjected to water bath at 37 ℃ for 1 h. The nutrient solution in the 96-well plate with PK15 cells was discarded, the cells were washed once with pure DMEM, and the water-bathed serum virus mixture was added to the wells in 3 replicates per serum dilution set at 100. mu.L per well for 72h at 37 ℃. And simultaneously setting a negative serum control, a negative serum virus control and a blank control. After 72h, the neutralizing antibody titer of the serum was measured by indirect immunofluorescence assay (IFA), and the maximum dilution of the serum capable of inhibiting 50% PCV2 infection was used as the neutralizing antibody titer of the serum to be tested.

1.7Real-time PCR quantitative detection of PCV2

Extracting sample DNA: taking 200 mul serum or lymph node tissue suspension, adding 400 mul PBS, SDS with the final concentration of 1 percent and proteinase K with the final concentration of 50 mug/mL, carrying out water bath at 56 ℃ for 30min, adding phenol with the same volume, uniformly mixing by oscillation, and centrifuging at 12000rpm for 10 min; carefully sucking the supernatant into a new EP tube, adding phenol/chloroform with the same volume, shaking and uniformly mixing, and centrifuging at 12000rpm for 10 min; carefully sucking the supernatant into a new EP tube, adding chloroform with the same volume, shaking and uniformly mixing, and centrifuging at 12000rpm for 10 min; carefully pipette the supernatant into a new EP tube, add 1/10 volumes of 3M sodium acetate (pH5.2) and 2.5 volumes of pre-cooled absolute ethanol, precipitate DNA overnight at-20 ℃; centrifuging at 12000rpm for 15min, removing supernatant, washing precipitate with 75% ethanol, and drying at room temperature; finally, 20. mu.L of sterile double distilled water is added to dissolve the DNA, and the DNA is stored at-20 ℃ for later use.

Real-time PCR: the reaction system is as follows: mu.L of DNA, 10. mu.L of 2 XPower SYBR Green PCR MasterMix (TOYOBO Co.), 1. mu.L of each of the primers F/R (final concentration 400nM, F: 5'-CCAGGAGGGCGTTCTGACT-3'; R: 5'-CGTTACCGCTGGAGAAGGAA-3'), sterile double distilled water to make up the volume to 20. mu.L. The reaction is carried out on an ABI 7300real time PCR instrument, and the reaction program is as follows: pre-denaturation at 95 ℃ for 2min, 95 ℃ for 15s, 60 ℃ for 1min, 40 cycles. Setting negative control, diluting positive plasmid template pT-SH by 10 times, drawing standard curve, and calculating corresponding copy number according to Ct value and standard curve.

1.8 pathological observations

Pathological dissection is carried out according to a conventional method, pathological changes of organs are observed, 10% paraformaldehyde of organs such as lung, spleen, lymph node and the like is collected and fixed, paraffin sections are prepared, HE staining is carried out, and pathological changes of tissues are observed by a microscope. And (3) storing the prepared section in a section box, and observing the pathological changes of the tissue section under a microscope after the xylene is completely volatilized.

1.9 immunohistochemistry

The slide glass is processed according to the conventional method, paraffin sections of the bronchial lymph node and the inguinal lymph node are prepared, and PCV2 antigen is detected by an immunohistochemical method: (1) paraffin sections were routinely dewaxed into water. (2) 3% H₂O₂And incubating for 5-10 min by using deionized water, and washing for 3 times by using distilled water. (3) Antigen heat repair: the slices are immersed in 0.01M citrate buffer (pH6.0), heated to boiling in a microwave oven, and then cooled for 20 min. After cooling, washing with PBS (0.01M, pH7.2-7.6) for 1-2 times. (4) 5% goat serum confining liquid is dripped, incubated in an incubator at 37 ℃ for 30min, and the redundant liquid is thrown off. (5) Mouse anti-PCV 2 monoclonal antibody (1:100) was added dropwise, incubated at 37 ℃ for 4h, and washed 2min X3 times with PBS. (6) HRP-labeled goat anti-mouse IgG was added dropwise, incubated at 37 ℃ for 1 hour, and washed with PBS 2min X3 times. (7) DAB color development: using a DAB color development kit, adding about 50ul of reagent 1 into 1mL of reagent 2(DAB substrate solution), uniformly mixing, adding into slices, developing at room temperature, controlling the reaction time for 5-20 min under a mirror until cells are stained brown, and washing with distilled water. (8) And (5) performing mild counterstaining by hematoxylin and mounting. (9) The PCV2 antigen is judged to be positive by observing with a microscope, wherein the number of brown staining cells in the lymph follicles is more than or equal to 10%.

1.10 statistical analysis of data

2 results

2.1 humoral immune response

The results of indirect ELISA antibody detection are expressed as S/P values when serum is diluted 100 times, and the specific results are shown in FIG. 11. After 2 weeks of immunization, three immunization groups all had varying degrees of PCV2 antibody production, and after 4 weeks of immunization, antibody levels continued to rise in both immunization groups.

Neutralizing antibody results are shown in FIG. 12, and the neutralizing antibody levels in TAT-Cap group, ppTG20-Cap and commercial vaccine group were 1:90, 1:85 and 1:72, respectively, with no significant difference between the groups (P > 0.05).

2.2 post-challenge clinical symptoms in piglets

After 4 weeks of immunization, PCV2 challenge was performed, and body temperature was measured daily for three consecutive weeks, and the results showed that there was no persistent fever (greater than 40 ℃) in all three immunization groups and the blank control group, and no obvious clinical symptoms were observed. In the non-immune toxin counteracting group, two pigs have slight clinical symptoms of body temperature rise, emaciation, rough and disordered hair, mental depression and the like within 3 to 4 days. The weight of each pig is weighed at 0 day and 28 days after the challenge, the relative daily gain is calculated, the result is shown in figure 13, the relative daily gain of the three vaccine immunization groups is obviously higher than that of a challenge control group (P is less than 0.05), and the TAT-Cap and ppTG20-Cap vaccine groups generate immune protection effect on piglets and promote the growth of the piglets.

2.4 post-challenge detection of viremia in piglets

Blood was collected 7, 19, and 28 days after challenge, and serum was isolated for viremia test, with the results shown in fig. 14. All pigs developed viral hemoglobinopathy, but the TAT-Cap and ppTG20-Cap vaccine groups were significantly lower than the challenge control group (P <0.05), similar to the commercial vaccine group (P > 0.05).

2.5 Virus assay in lymph node tissue

After 28 days of challenge, all pigs were killed and DNA was extracted from inguinal lymph nodes and used in Real-time PCR to determine PCV2 content therein, as shown in FIG. 15. The presence of virus was detected in all lymph nodes of pigs, but was similar between the three immunization groups (P >0.05), but was significantly lower than the challenge control group (P <0.05), indicating that both the TAT-Cap and ppTG20-Cap vaccine groups were effective in reducing PCV2 infection.

2.6 pathological changes and immunohistochemical results

The observation results of the histological pathological changes of the lymph nodes and the lung show that the lymph nodes and the lung tissues of the blank control group and the three vaccine immunity groups have no obvious lesions, the lymph follicular boundary of the lymph nodes of the challenge control group is fuzzy, the lymphocyte is absent, and the phenomena of interstitial widening, alveolus reduction, bleeding and consolidation of the lung occur. Immunohistochemical detection of lymph node tissue revealed that more brown-yellow cells were present in lymph tissue of the challenge group, while TAT-Cap, ppTG20-Cap and the commercial vaccine immunization group had no specific stained cells (FIG. 16).

3 conclusion

In conclusion, the two PCV2Cap protein subunit vaccines prepared by the research can induce organisms to generate ELISA antibodies and neutralizing antibodies with PCV2 specificity, have a protective effect on PCV2 virus attack, and lay a foundation for developing novel PCV2 vaccines.

Sequence listing

<110> Nanjing university of agriculture

<120> high-efficiency expression porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 741

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtatggca ggaagaagcg gagacagcga cgaagaatga cctacccacg ccggcgcttt 60

cggcgccgcc ggcatcgccc tcgctcccat ctgggccaaa tcctccggcg gcggccttgg 120

ctcgtgcatc cccggcaccg gtatcgctgg cgccggaaga acggcatctt caatacccgc 180

ctgtcccgca ccatcggcta caccgtgaag aagaccaccg tgcggacacc aagctggaat 240

gtggacatga tgcgcttcaa cattaacgac ttcctccctc ccggaggcgg gagcaacccc 300

ctgaccgtgc cattcgagta ctatcgcatc cggaaagtga aggtggagtt ctggccatgc 360

tcccccatta cacagggcga ccggggagtc ggcagcaccg ccgtgatcct ggacgacaac 420

ttcgtgacca aagccaacgc tctgacatac gacccctacg tcaattactc cagccggcac 480

accatcaccc agcccttcag ctaccacagc cgctacttca cccccaagcc cgtgctggac 540

cggaccatcg actacttcca acccaacaac aagcgcaacc agctgtggct gcgcctgcaa 600

accacaggca acgtggacca cgtcggcctg gggaccgctt ttgagaacag catctacgac 660

caggactaca acatccgcat caccatgtac gtgcagttcc gcgaattcaa cctgaaggac 720

ccccctctca atcccaagtg a 741

<210> 2

<211> 248

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Ala Thr Met Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Met Thr

1 5 10 15

Tyr Pro Arg Arg Arg Phe Arg Arg Arg Arg His Arg Pro Arg Ser His

20 25 30

Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro Arg His

35 40 45

Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg Leu Ser

50 55 60

Arg Thr Ile Gly Tyr Thr Val Lys Lys Thr Thr Val Arg Thr Pro Ser

65 70 75 80

Trp Asn Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu Pro Pro

85 90 95

Gly Gly Gly Ser Asn Pro Leu Thr Val Pro Phe Glu Tyr Tyr Arg Ile

100 105 110

Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr Gln Gly

115 120 125

Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn Phe Val

130 135 140

Thr Lys Ala Asn Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr Ser Ser

145 150 155 160

Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr Phe Thr

165 170 175

Pro Lys Pro Val Leu Asp Arg Thr Ile Asp Tyr Phe Gln Pro Asn Asn

180 185 190

Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Thr Gly Asn Val Asp

195 200 205

His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp Gln Asp

210 215 220

Tyr Asn Ile Arg Ile Thr Met Tyr Val Gln Phe Arg Glu Phe Asn Leu

225 230 235 240

Lys Asp Pro Pro Leu Asn Pro Lys

245

<210> 3

<211> 768

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgggtctgt tccgagcact gctgcgactg ctgcgatctc tgtggcgact gctgctgcga 60

gcaatgacct acccacgccg gcgctttcgg cgccgccggc atcgccctcg ctcccatctg 120

ggccaaatcc tccggcggcg gccttggctc gtgcatcccc ggcaccggta tcgctggcgc 180

cggaagaacg gcatcttcaa tacccgcctg tcccgcacca tcggctacac cgtgaagaag 240

accaccgtgc ggacaccaag ctggaatgtg gacatgatgc gcttcaacat taacgacttc 300

ctccctcccg gaggcgggag caaccccctg accgtgccat tcgagtacta tcgcatccgg 360

aaagtgaagg tggagttctg gccatgctcc cccattacac agggcgaccg gggagtcggc 420

agcaccgccg tgatcctgga cgacaacttc gtgaccaaag ccaacgctct gacatacgac 480

ccctacgtca attactccag ccggcacacc atcacccagc ccttcagcta ccacagccgc 540

tacttcaccc ccaagcccgt gctggaccgg accatcgact acttccaacc caacaacaag 600

cgcaaccagc tgtggctgcg cctgcaaacc acaggcaacg tggaccacgt cggcctgggg 660

accgcttttg agaacagcat ctacgaccag gactacaaca tccgcatcac catgtacgtg 720

cagttccgcg aattcaacct gaaggacccc cctctcaatc ccaagtga 768

<210> 4

<211> 257

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Ala Thr Met Gly Leu Phe Arg Ala Leu Leu Arg Leu Leu Arg Ser Leu

1 5 10 15

Trp Arg Leu Leu Leu Arg Ala Met Thr Tyr Pro Arg Arg Arg Phe Arg

20 25 30

Arg Arg Arg His Arg Pro Arg Ser His Leu Gly Gln Ile Leu Arg Arg

35 40 45

Arg Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg Arg Lys

50 55 60

Asn Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Ile Gly Tyr Thr Val

65 70 75 80

Lys Lys Thr Thr Val Arg Thr Pro Ser Trp Asn Val Asp Met Met Arg

85 90 95

Phe Asn Ile Asn Asp Phe Leu Pro Pro Gly Gly Gly Ser Asn Pro Leu

100 105 110

Thr Val Pro Phe Glu Tyr Tyr Arg Ile Arg Lys Val Lys Val Glu Phe

115 120 125

Trp Pro Cys Ser Pro Ile Thr Gln Gly Asp Arg Gly Val Gly Ser Thr

130 135 140

Ala Val Ile Leu Asp Asp Asn Phe Val Thr Lys Ala Asn Ala Leu Thr

145 150 155 160

Tyr Asp Pro Tyr Val Asn Tyr Ser Ser Arg His Thr Ile Thr Gln Pro

165 170 175

Phe Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro Val Leu Asp Arg

180 185 190

Thr Ile Asp Tyr Phe Gln Pro Asn Asn Lys Arg Asn Gln Leu Trp Leu

195 200 205

Arg Leu Gln Thr Thr Gly Asn Val Asp His Val Gly Leu Gly Thr Ala

210 215 220

Phe Glu Asn Ser Ile Tyr Asp Gln Asp Tyr Asn Ile Arg Ile Thr Met

225 230 235 240

Tyr Val Gln Phe Arg Glu Phe Asn Leu Lys Asp Pro Pro Leu Asn Pro

245 250 255

Lys

<210> 5

<211> 774

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaaattct tagtcaacgt tgcccttgtt tttatggtcg tatacatttc ttacatctat 60

gcggatcgaa tgacctaccc acgccggcgc tttcggcgcc gccggcatcg ccctcgctcc 120

catctgggcc aaatcctccg gcggcggcct tggctcgtgc atccccggca ccggtatcgc 180

tggcgccgga agaacggcat cttcaatacc cgcctgtccc gcaccatcgg ctacaccgtg 240

aagaagacca ccgtgcggac accaagctgg aatgtggaca tgatgcgctt caacattaac 300

gacttcctcc ctcccggagg cgggagcaac cccctgaccg tgccattcga gtactatcgc 360

atccggaaag tgaaggtgga gttctggcca tgctccccca ttacacaggg cgaccgggga 420

gtcggcagca ccgccgtgat cctggacgac aacttcgtga ccaaagccaa cgctctgaca 480

tacgacccct acgtcaatta ctccagccgg cacaccatca cccagccctt cagctaccac 540

agccgctact tcacccccaa gcccgtgctg gaccggacca tcgactactt ccaacccaac 600

aacaagcgca accagctgtg gctgcgcctg caaaccacag gcaacgtgga ccacgtcggc 660

ctggggaccg cttttgagaa cagcatctac gaccaggact acaacatccg catcaccatg 720

tacgtgcagt tccgcgaatt caacctgaag gacccccctc tcaatcccaa gtga 774

<210> 6

<211> 259

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Ala Thr Met Lys Phe Leu Val Asn Val Ala Leu Val Phe Met Val Val

1 5 10 15

Tyr Ile Ser Tyr Ile Tyr Ala Asp Arg Met Thr Tyr Pro Arg Arg Arg

20 25 30

Phe Arg Arg Arg Arg His Arg Pro Arg Ser His Leu Gly Gln Ile Leu

35 40 45

Arg Arg Arg Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg

50 55 60

Arg Lys Asn Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Ile Gly Tyr

65 70 75 80

Thr Val Lys Lys Thr Thr Val Arg Thr Pro Ser Trp Asn Val Asp Met

85 90 95

Met Arg Phe Asn Ile Asn Asp Phe Leu Pro Pro Gly Gly Gly Ser Asn

100 105 110

Pro Leu Thr Val Pro Phe Glu Tyr Tyr Arg Ile Arg Lys Val Lys Val

115 120 125

Glu Phe Trp Pro Cys Ser Pro Ile Thr Gln Gly Asp Arg Gly Val Gly

130 135 140

Ser Thr Ala Val Ile Leu Asp Asp Asn Phe Val Thr Lys Ala Asn Ala

145 150 155 160

Leu Thr Tyr Asp Pro Tyr Val Asn Tyr Ser Ser Arg His Thr Ile Thr

165 170 175

Gln Pro Phe Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro Val Leu

180 185 190

Asp Arg Thr Ile Asp Tyr Phe Gln Pro Asn Asn Lys Arg Asn Gln Leu

195 200 205

Trp Leu Arg Leu Gln Thr Thr Gly Asn Val Asp His Val Gly Leu Gly

210 215 220

Thr Ala Phe Glu Asn Ser Ile Tyr Asp Gln Asp Tyr Asn Ile Arg Ile

225 230 235 240

Thr Met Tyr Val Gln Phe Arg Glu Phe Asn Leu Lys Asp Pro Pro Leu

245 250 255

Asn Pro Lys

<210> 7

<211> 705

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgacctacc cacgccggcg ctttcggcgc cgccggcatc gccctcgctc ccatctgggc 60

caaatcctcc ggcggcggcc ttggctcgtg catccccggc accggtatcg ctggcgccgg 120

aagaacggca tcttcaatac ccgcctgtcc cgcaccatcg gctacaccgt gaagaagacc 180

accgtgcgga caccaagctg gaatgtggac atgatgcgct tcaacattaa cgacttcctc 240

cctcccggag gcgggagcaa ccccctgacc gtgccattcg agtactatcg catccggaaa 300

gtgaaggtgg agttctggcc atgctccccc attacacagg gcgaccgggg agtcggcagc 360

accgccgtga tcctggacga caacttcgtg accaaagcca acgctctgac atacgacccc 420

tacgtcaatt actccagccg gcacaccatc acccagccct tcagctacca cagccgctac 480

ttcaccccca agcccgtgct ggaccggacc atcgactact tccaacccaa caacaagcgc 540

aaccagctgt ggctgcgcct gcaaaccaca ggcaacgtgg accacgtcgg cctggggacc 600

gcttttgaga acagcatcta cgaccaggac tacaacatcc gcatcaccat gtacgtgcag 660

ttccgcgaat tcaacctgaa ggacccccct ctcaatccca agtga 705

<210> 8

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tatggcagga agaagcggag acagcgacga aga 33

<210> 9

<211> 60

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggtctgttcc gagcactgct gcgactgctg cgatctctgt ggcgactgct gctgcgagca 60

<210> 10

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgaaattct tagtcaacgt tgcccttgtt tttatggtcg tatacatttc ttacatctat 60

gcggatcga 69

<210> 11

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cgctcgagat gtatggcagg aagaagcgga gacagcgacg aagaatgacc taccccc 57

<210> 12

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgctcgagat gggtctgttc cgagcactgc tgcgactgct gcgatctctg tggcgact 58

<210> 13

<211> 56

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ctgctgcgat ctctgtggcg actgctgctg cgagcaatga cctacccccg ccgccg 56

<210> 14

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgctcgagat gaaattctta gtcaacgttg cccttgtttt tatggtcgta tac 53

<210> 15

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tttatggtcg tatacatttc ttacatctat gcggatcgaa tgacctaccc ccgccgccg 59

<210> 16

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgggtacctc aatggtgatg gtgatgatgc ttggggttca ggg 43

Claims

1. A porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene is characterized in that: the gene is any one of (1) to (2):

the nucleotide sequence of the Cap gene of the fusion transmembrane peptide ppTG20 gene sequence is shown in SEQ ID NO. 3.

2. The porcine circovirus type 2 Cap-penetrating peptide fusion protein gene of claim 1, which is characterized in that: the preparation process of the Cap gene fused with the sequence of the TAT gene of the cell-penetrating peptide comprises the following steps: designing primers TAT-Cap-F, 5' -CG according to sequence TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA of TAT gene of cell-penetrating peptide and sequence of Cap gene in pVax-CapCTCGAGATGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAATGACCTACCCCC -3’，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3', using the recombinant plasmid pVax-cap as a template to amplify to obtain TAT-cap gene;

the preparation process of the Cap gene of the fusion transmembrane peptide ppTG20 gene sequence comprises the following steps: according to the sequence GGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCA of the cell-penetrating peptide ppTG20 gene and the sequence of the Cap gene in pVax-Cap, a primer ppTG20-Cap-F1, 5' -CG is designedCTCGAGATGGGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACT-3’，ppTG20-cap-F2，5’-CTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCAATGACCTACCCCCGCCGCCG-3’，Cap-R，5’-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3', and using the recombinant plasmid pVax-cap as a template to obtain the ppTG20-cap gene by two times of PCR amplification.

3. An expression cassette, a recombinant expression vector, a recombinant baculovirus, a transgenic cell line or a transgenic recombinant bacterium comprising the porcine circovirus type 2 Cap-transmembrane peptide fusion protein gene of claim 1 or 2.

4. A recombinant baculovirus, characterized in that: the preparation method comprises the following steps: cloning the porcine circovirus type 2 Cap-penetrating peptide fusion protein gene of claim 1 or 2 to a baculovirus vector pFast-Bac-Dual, transforming the positive recombinant vector plasmid into DH10Bac competence, carrying out homologous recombination to obtain recombinant Bacmid, transfecting the recombinant Bacmid into Sf9 cells, and culturing to obtain the recombinant baculovirus.