CN107841507A - A kind of porcine circovirus 2 type Cap cell-penetrating peptides antigen-4 fusion protein gene of high efficient expression and its application - Google Patents

Abstract

The present invention discloses porcine circovirus 2 type Cap cell-penetrating peptides antigen-4 fusion protein gene and its application of a kind of high efficient expression, and the encoding gene of the fusion protein is any one in (1)~(3)：(1) the Cap genes of cell-penetrating peptide TAT gene orders are merged；(2) the Cap genes of cell-penetrating peptide ppTG20 gene orders are merged；(3) the Cap genes of honeybee signal peptide HBM gene orders are merged.The research of this seminar finds that cell-penetrating peptide can improve its level of immune response in Mice Body with the DNA vaccination that pVAX Cap plasmids are mixed with.This research merges TAT, ppTG20, HBM with PCV2 Cap protein N-terminals, successfully builds recombinant baculovirus, realizes Cap protein effective expression, is laid a good foundation for the research of PCV2 recombinant vaccines.

Description

A kind of porcine circovirus 2 type Cap- cell-penetrating peptides antigen-4 fusion protein gene of high efficient expression and It is applied

Technical field

The invention belongs to biological immune technical field, and in particular to a kind of porcine circovirus 2 type Cap- of high efficient expression is worn Film peptide fusion protein gene and its application.

Background technology

Porcine circovirus 2 type (Porcine circovirus type 2, PCV2) is the important disease for endangering world's pig industry It is former.The capsid cap albumen of PCV2ORF2 gene codes has important immanoprotection action, is that the PCV2 restructuring researched and developed at present is sub- single The important antigen gene of position vaccine.PCV2 recombinates shaft-like subunit vaccine and has been carried out commercialization, but production of vaccine cost is higher. Many molecule adjuvants, such as some cell factors, IL-18, GMSF etc. produce good exempt from immunogene Co stituation body Epidemic disease response, so as to improve the immune effect of vaccine.

Honeybee melittin secreting signal peptide (Honey Bee Melittin secretion peptide, HBM) has side The effect of target gene secreting, expressing is helped, makes recombinant protein that there is complete biological function.Cell-penetrating peptide (Cell Penetrating Peptide, CPP) therapeutic substance can be delivered enter cell, the tat peptide contained in human immunodeficiency virus's Tat albumen is at first The cell-penetrating peptide being found, it can effectively pass through cell membrane.There are some researches prove, medicine, polypeptide or albumen, oligonucleotides/ The materials such as DNA/RNA, nanoparticle, liposome, bacteriophage, fluorescent dye, quantum dot can be effectively delivered to cell It is interior.Because CPPs deliveries target substance is in extensive range, and antigen can be delivered to antigen presenting cell (APC), improve body Immune response, so, it has great potential in disease treatment and vaccines arts.

The content of the invention

It is an object of the invention to provide a kind of porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes.

Another object of the present invention is to provide a kind of porcine circovirus 2 type Cap- cell-penetrating peptide fusion proteins.

Another object of the present invention is to provide the application of above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptide fusion proteins.

The purpose of the present invention can be achieved through the following technical solutions：

A kind of porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes, the gene are any one in (1)~(3)：

(1) the Cap genes of cell-penetrating peptide TAT gene orders are merged；

(2) the Cap genes of cell-penetrating peptide ppTG20 gene orders are merged；

(3) the Cap genes of honeybee signal peptide HBM gene orders are merged.

Above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes, it is：

The nucleotide sequence of the Cap genes of the fusion cell-penetrating peptide TAT gene orders is as shown in SEQ ID NO.1；

The nucleotide sequence of the Cap genes of the fusion cell-penetrating peptide ppTG20 gene orders is as shown in SEQ ID NO.3；

The nucleotide sequence of the Cap genes of the fusion honeybee signal peptide HBM gene orders is as shown in SEQ ID NO.5.

Above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes, it is：

The preparation process of Cap genes of the fusion cell-penetrating peptide TAT gene orders is：According to cell-penetrating peptide TAT gene orders Cap gene orders in TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA and pVax-cap, primer TAT-cap-F is designed, 5’-CGCTCGAGATGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAATGACCTACCCCC-3 ', Cap-R, 5 '- CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3 ', using recombinant plasmid pVax-cap as template, amplification Obtain TAT-cap genes；

The preparation process of Cap genes of the fusion cell-penetrating peptide ppTG20 gene orders is：According to cell-penetrating peptide ppTG20 bases Because of sequence GGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACTGCTGCTGCG AGCA and pVax-cap Middle Cap gene orders, design primer ppTG20-cap-F1,5 '-CGCTCGAGATGGGTCTGTTCCGAGCACTGCTGCGACTG CTGCGATCTCTGTGGCGACT-3 ' Xhol, ppTG20-cap-F2,5 '-CTGCTGCGATCTCTGTGGCGACTGCTGCTGCG - the CG of AGCAATGACCTACCCCCGCCGCCG-3 ', Cap-R, 5 'GGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCA GGG-3 ', using recombinant plasmid pVax-cap as template, twice PCR expands to obtain ppTG20-cap genes；

The preparation process of Cap genes of the fusion honeybee signal peptide HBM gene orders is：According to honeybee signal peptide HBM Gene order ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATACATTTCTTACAT CTATGCGGATCGA With Cap gene orders in pVax-cap, design primer HBM-cap-F1,5 '-CGCTCGAGATGAAATTCTTAGTCAACGTTGC CCTTGTTTTTATGGTCGTATAC-3 ' Xhol, HBM-cap-F2,5 '-TTTATGGTCGTATACATTTCTTACATCTATGCG - the CG of GATCGAATGACCTACCCCCGCCGCCG-3 ', Cap-R, 5 'GGTACCTCAATGGTGATGGTGATGATGCTTGGGGTT CAGGG-3 ', using recombinant plasmid pVax-cap as template, twice PCR expands to obtain HBM-cap genes.

Include the expression cassettes of above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes, recombinant expression carrier, again Group baculoviral, transgenic cell line or transgenosis recombinant bacterium.

A kind of recombinant baculovirus, is prepared using procedure below：Above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptides are merged Protein gene cloning is to after baculovirus vector pFast-Bac-Dual, by the conversion DH10Bac impressions of positive recombinant vector plasmid State, homologous recombination, restructuring Bacmid is obtained, restructuring Bacmid transfection Sf9 cells are carried out into culture obtains recombinant baculovirus.

By the porcine circovirus 2 type Cap- cell-penetrating peptide fusion proteins of above-mentioned gene code.It is any in preferably a~c It is a kind of：A, the amino acid sequence as shown in SEQ ID NO.2；B, the amino acid sequence as shown in SEQ ID NO.4；C, such as SEQ Amino acid sequence shown in ID NO.6.

The preparation process of above-mentioned fusion protein is：By above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes After being cloned into baculovirus vector pFast-Bac-Dual, positive recombinant vector plasmid is converted into DH10Bac competence, it is homologous heavy Group, restructuring Bacmid is obtained, restructuring Bacmid transfection Sf9 cells are carried out into culture obtains recombinant baculovirus, shaft-like by recombinating Virus is expressed to obtain fusion protein.

Application of the above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptides fusion protein in PVC2 subunit vaccines are prepared.

A kind of PVC2 subunit vaccines, include above-mentioned porcine circovirus 2 type Cap- cell-penetrating peptide fusion proteins.In the vaccine Also include CP974S aqueous adjuvants.

Beneficial effects of the present invention：

This seminar previous research find, cell-penetrating peptide and the DNA vaccination that pVAX-Cap plasmids are mixed with can improve its Immune response in Mice Body is horizontal.This research merges TAT, ppTG20, HBM with Porcine circovirus type 2 Cap N-terminal, successfully structure weight Group baculoviral, realizes Cap protein effective expression, is laid a good foundation for the research of PCV2 recombinant vaccines.

Brief description of the drawings

Fig. 1 TAT, ppTG20, HBM and Cap fusion recombinant baculovirus structure technology path

The digestion identification of Fig. 2 recombinant plasmids

Wherein, A.pFast-Bac-ppTG20-cap；B.pFast-Bac-TAT-cap；C.pFast-Bac-HBM-cap； D.pFast-Bac-cap

A:M.DL5000DNA marker；1.ppTG20-cap；2.digestion product of pFast-Bac- ppTG20-cap；3.plasmid digestion control；

B:M.DL5000DNA marker；1.TAT-cap；2.digestion product of pFast-Bac-TAT- cap；3.plasmid digestion control；

C:M.DL5000DNA marker；1.HBM-cap；2.digestion product of pFast-Bac-HBM- cap；3.plasmid digestion control；

D:M2.DL5000DNA marker；1.digestion product of pFast-Bac-cap；2.plasmid digestion control

The PCR identifications of Fig. 3 recombinant plasmids

M.DL5000DNA marker；1-2.PCR product of rBac-ppTG20-cap using M13F+ ppTG-F,2489bp；3-4.PCR product of rBac-HBM-cap using M13F+HBM-F,2496bp；5.PCR product of rBac-TAT-cap using M13F+TAT-F,2459bp；6.PCR product of rBac-cap using M13F+cap-F,2393bp

The cytopathy occurred after Fig. 4 SF9 cell infection recombinant baculovirus

Fig. 5 recombinant baculovirus Western blotting are identified

Fig. 6 recombinant baculovirus IFA identifies (200 ×)

Fig. 7 virus-like particle electron microscopic observations

Mouse PCV2ELISA TPPA results are immunized in Fig. 8 differences recombinant protein

The detection of mouse PCV2 neutralizing antibodies is immunized in Fig. 9

The testing result of mouse lymphocyte breeder reaction is immunized in Figure 10

ELISA antibody levels testing result after Figure 11 piglet immunologicals

The horizontal testing result of neutralizing antibody after Figure 12 piglet immunologicals

Each group pig determines with respect to daily gain after Figure 13 attacks poison

Each group swine disease toxaemia detects after Figure 14 attacks poison

The detection of viral level in Figure 15 lymphoid tissues

PCV2 antigen Is HC testing results in Figure 16 lymph node tissues (HE is dyed, 400 ×)

Embodiment

Embodiment one, the structure of porcine circovirus 2 type recombinant baculovirus and identification

Porcine circovirus 2 type (PCV2) ORF2 is optimized codon gene and cell-penetrating peptide by the present embodiment using PCR method PpTG20, TAT and honeybee signal peptide (HBM) Gene Fusion, are cloned into baculovirus vector pFast-Bac-Dual, through digestion and After gene sequencing identification is correct, DH10Bac competence is converted respectively, and correct swivel base is screened to Bacmid gram through blue white two-wheeled spot It is grand, extract genome and transfected Bacmids into Sf9 insect cells with liposome, collecting cell after cytopathy appearance splits Product is solved, recombinant baculovirus rBac-cap, rBac-ppTG20-cap, rBac-TAT-cap and rBac-HBM-cap is obtained, adopts Identified, as a result shown, four kinds of recombinant viruses can express Cap protein, and two kinds are worn with Western blot and immunofluorescence technique Film peptide merges Cap genes expression quantity in baculovirus expression system and recombinates disease apparently higher than honeybee signal peptide-Cap fusions Poison, TAT-cap and ppTG20-cap recombinant protein antigens are substantially better than HBM-cap and cap, TAT-cap, ppTG20-cap and HBM-cap can form virus-like particle, be laid a good foundation for the research of PCV2 recombinant vaccines.

1 materials and methods

1.1 main material

Insect baculovirus expression system (Baculovirus Expression System, BEVS) is purchased from Invitrogen companies, including pFastBacHT B, pFastBacDual plasmids, DH10Bac bacterial strains, Sf9 insect cells.Large intestine Bacillus DH5 α are preserved by this laboratory, and restriction enzyme used, T4DNA ligases, Taq enzyme are purchased from this experiment Takara companies.DNA QIAquick Gel Extraction Kits and plasmid extraction kit are purchased from Ding Guo companies.Cultivate the Grace cultures of insect cell Base, Express Five serum free mediums and FBS are Gibco Products.Transfection reagent Lipofectamine 2000 is purchased In Invitrogen companies.The goat anti-mouse igg of HRP marks and the SPA of FITC marks are purchased from doctor's moral company.

The monoclonal antibody 3E5 of Porcine circovirus type 2 Cap is prepared and preserved by this laboratory.The monoclonal antibody is by preserving number CGMCC NO.8169 hybridoma cell strain secretion.Preparation process is as follows：Take 6~8 week old Healthy female Balb/c mouse, abdomen Chamber injection sterilized liquid paraffin 0.5mL/ is only；After 7 days, every mouse peritoneal inoculation 1~2 × 10⁶Individual hybridoma.Inoculation Before, hybridoma discards nutrient solution, washs cell twice with the RPMI 1640 culture mediums of serum-free, washes away serum egg as far as possible In vain, dispel cell and be made into concentration as 4~5 × 10⁶Individual/mL cell suspension.Under aseptic condition, 0.5mL cell suspensions are injected Enter mouse peritoneal.Hybridoma amount reproduction in mouse peritoneal in the form of ascites tumor, after 7~10 days, mouse web portion is bright Aobvious to swell, that touches has fluctuation, and shows as state One's spirits are drooping, that hair is in disorder, now collects ascites.Gather ascites When, left hand catches mouse nape part skin, left back leg and tail, belly towards experimenter, and make head in 45 degree diagonally downward. With No. 12 syringe needles from after groin inserts abdominal cavity, make mouse head downward with belly upward rapidly, ascites flows out and collected naturally. After spending two, three days, belly swells, and can collect again, typically collects 2~3 times.Ascites is collected to centrifuge tube, 4000rpm from Heart 10min, takes middle water white transparency layer liquid, as monoclonal antibody 3E5 ascites, 20 DEG C freeze it is standby.

1.2PCV2Cap target gene MOLECULE DESIGNs

The following 4 kinds of PCV2Cap gene molecules of design, are expanded using PCR method, for building recombinant baculovirus.

1.2.1 the PCV2Cap genes of Codon sequences optimization and recombinant plasmid pVax-cap structure

Codon gene order design PCV2Cap genes (as follows) are had a liking for according to eukaryotic, by Invitrogen companies Synthesis, and pVax plasmids are cloned into, obtain recombinant plasmid pVax-cap, target gene both ends I containing BamH and Xho I.Specific structure Construction method is：The Cap genes of recovery purifying and pVAX1 are subjected to double digestion processing with BamH I and Xho I restriction enzymes, Endonuclease reaction condition is 37 DEG C of water-bath 4h, uses DNA glue reclaim kit recovery purifying Cap genes and pVAX1 digestion products.Adopt With T4 ligases, 16 DEG C of connections overnight, connection product is converted into DH5 α competent cells, picking single bacterium colony culture, extraction is doubted Like recombinant plasmid, after PCR and double digestion identification, the bacterium solution containing positive plasmid is sent and is sequenced by Invitrogen companies Identification, obtain positive recombinant plasmid pVAX-Cap.

The Cap gene orders of artificial synthesized codon optimization are as shown in SEQ ID NO.7.

1.2.2 the gene order TAT of cell-penetrating peptide Cap genes (TAT-cap) are merged

According to cell-penetrating peptide TAT gene orders TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA (SEQ ID NO.8) and Cap gene orders in pVax-cap, design primer TAT-cap-F, 5 '-CGCTCGAGATGTATGGCAGGAAGAAGCGGAGACA GCGACGAAGAATGACCTACCCCC-3 ' (SEQ ID NO.11), Cap-R, 5 '-CGGGTACCTCAATGGTGATGGTGATGA TGCTTGGGGTTCAGGG-3 ' (SEQ ID NO.16), amplification obtain TAT-cap genes.

1.2.3 the gene order ppTG20 of cell-penetrating peptide Cap genes (ppTG20-cap) are merged

According to cell-penetrating peptide ppTG20 gene orders GGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGA Cap gene orders in CTGCTGCTGCGAGCA (SEQ ID NO.9) and pVax-cap, design primer ppTG20-cap-F1,5 '- CGCTCGAGATGGGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACT-3’Xhol(SEQ ID NO.12), ppTG20-cap-F2,5 '-CTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCAATGACCTACCCCCGCCG CCG-3 ' (SEQ ID NO.13), Cap-R, 5 '-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3’ (SEQ ID NO.16), twice PCR expands to obtain ppTG20-cap genes.

1.2.4 the Cap genes (HBM-cap) of HBM gene orders are merged

According to HBM gene orders ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATACATTTCTTAC Cap gene orders in ATCTATGCGGATCGA (SEQ ID NO.10) and pVax-cap, design primer HBM-cap-F1,5 '- CGCTCGAGATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATAC-3 ' Xhol (SEQ ID NO.14), HBM-cap-F2,5 '-TTTATGGTCGTATACATTTCTTACATCTATGCGGATCGAATGACCTACCCCCGCCG CCG-3 ' (SEQ ID NO.15), Cap-R, 5 '-CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3’(SEQ ID NO.16), twice PCR expands to obtain HBM-cap genes.

By Fig. 1 technology paths, recombinant baculovirus is built.

Table 1 is used for the primer and its sequence for expanding different genes fragment

The structure of 1.3 recombinant baculovirus expression plasmids

1.3.1 target gene expands

Using plasmid pVax-cap as template, using previously described each pair of primer, expanded respectively by PCR each corresponding Cap genetic fragments.Cell-penetrating peptide gene is brought into the N-terminal of cap genes using secondary PCR method, for example drawn with HBM-F2 upstreams For thing with cap-R using pVac-cap plasmids as template, the target gene band amplified cuts glue reclaim purifying after glue, recycles HBM- F1 upstreams carry out secondary PCR using recovery product as template with cap-R, expand purpose band and reclaim.PpTG20-cap amplification sides The same HBM-cap of method；TAT-cap needs a PCR to obtain for relatively short due to fragment.PrimeSTAR Mix fidelities gather Synthase premixed liquid enters performing PCR, μ L of 25 μ L reaction systems Mix containing PrimeSTAR 10.5, each 1 μ L of primer, the μ L of template DNA 1 and dd H₂O 11.5μL.Response procedures are as follows：95 DEG C of 5min, 98 DEG C of 10sec, 58 DEG C of 5sec, 72 DEG C of 45s carry out 35 circulations, most 72 DEG C of extension 10min afterwards.PCR primer is identified through 1% gel electrophoresis.

1.3.2 target gene clone identification

PCR primer is purified through gel reclaims kit.Extraction purification target gene and carrier pFast-Bac-dual Digestion respectively.Digestion system is as follows：μ L of target gene/carrier 20/14, μ L of enzyme 1.5, μ L and the dd H2O 4/ of 10 × Buffer 3 10μL.It is attached after 37 DEG C of digestion 4h and gel recovery.10 μ L linked systems are as follows：μ L of target gene 7, μ L of carrier 1, T4 connect Meet the μ L of enzyme 1, T4Buffer 1 μ L.Coupled reaction：16 DEG C of connection instrument connections are overnight.Prepare bacillus coli DH 5 alpha competent cell. Take 10 μ L connection product to be added to 100 μ L DH5 α competent cells, flick mixing, ice bath 30min.42 DEG C of heat shock 90s, it is fast Speed is positioned in frozen water, ice bath 1min；Add 800 μ L LB fluid nutrient mediums, 37 DEG C of 220rpm shaking culture 45min, carrier Converted product is connected with target gene and is coated on 50 μ g/mL ammonia benzyl LB flat boards, 37 DEG C of incubator overnight incubations, positive colony is chosen and carries Take plasmid.Double digestion identification is carried out to recombinant plasmid, send Jin Sirui to be sequenced after identification is correct.Recombinant plasmid is named as：pFast- Bac-HBM-cap, pFast-Bac-ppTG20-cap, pFast-Bac-TAT-cap and pFast-Bac-cap.

The structure of 1.4 recombinant baculovirus

1.4.1 Bacmid structures and identification are recombinated

Take the DH10Bac bacterium solutions frozen to be inoculated in the 3ml LB culture mediums containing 50 μ g/ml kanamycins, prepare competence Cell.By positive plasmid transformed competence colibacillus cell DH10Bac, coating is containing 10 μ g/mL tetracyclines, 50 μ g/mL kanamycins, 7 μ g/ The LB flat boards of mL gentamicins, 100 μ g/mL X-gal and 40 μ g/mL IPTG.37 DEG C of incubator lucifuge culture 48h, extremely show Write blue white bacterium colony.The single white single bacterium colony of picking is inoculated in the tetracycline containing 10ug/ml, 50ug/ml kanamycins and 7ug/ In the LB liquid medium of ml gentamicin, more than 37 DEG C of 250rpm shaken cultivations 12h, by Bac-to-Bac baculoviral tables The alkaline lysis method of extracting recombinant vector skeleton Bacmid improved up in system specification.Surveyed by Nanjing Jin Sirui biotech companies Determine objective gene sequence, identify that correctly restructuring Bacmid is used for follow-up transfection experiment.

1.4.2 the acquisition and passage of recombinant baculovirus

Bacmid transfection Sf9 cells will be recombinated using Lipofectamine2000 transfection reagents, 27 DEG C of incubators are incubated 6h Afterwards, transfection cocktail is sucked, is directly added into Grace ' s complete mediums of the 2mL containing 10%FBS, 27 DEG C to continue culture thin to Sf9 There is obvious lesion, harvesting and culture supernatant in born of the same parents.500g centrifugations 5min collects supernatant, and 4 DEG C are kept in dark place, as F1 generation weight Group virus.Cell is used to identify protein expression.First generation recombinant virus is pressed 1:10 volume ratio infects new Sf9 cells, and 27 When obvious lesion occurs in DEG C culture 3 days to cell, 500g centrifugation 5min, cell and big cell fragment are removed, collects 4 DEG C of supernatant It is kept in dark place, as second generation virus, third generation virus is obtained with same method.

1.5Western Blot identification recombinant Cs ap

Recombinant baculovirus is pressed 1：10 volume ratios infect the Sf9 cells of exponential phase, while it is thin to set up normal Sf21 Born of the same parents compare, and 72h is sterile after infection collects cell culture.Collect supernatant and give over to kind of a poison, 4 DEG C of preservations；With appropriate 0.01M pH 7.2 PBS gently blows down cell, 500g centrifugation 5min, cell precipitation is resuspended with appropriate PBS, adds appropriate Loading Buffer is used for SDS-PAGE electrophoresis after boiling, and is transferred to nitrocellulose filter (NC films), deionized water rinsing, with containing 10% The PBST confining liquids closing of skimmed milk, room temperature jog 2h.Add PCV2Cap monoclonal antibodies (1：2000 dilutions), room temperature jog 1.5h.NC films are washed with PBST, sheep anti-Mouse Ig G-HRP is added and (uses PBST 1：10000 dilutions), room temperature jog 45min.With PBST washs NC films.Developed the color with chemical luminescence reagent kit, carry out X-ray development in darkroom, observe specific protein band.

1.6 indirect immunofluorescences identify (I FA)

The malicious individual layer Sf9 cells being inoculated in 96 orifice plates will be recombinated, while set normal Sf9 cells as negative control.27 DEG C culture 2 days, before obvious lesion occurs in cell, abandons culture supernatant, is fixed after PBS washing cells with 80% acetone of precooling, 4 DEG C effect 10min.PBS is washed 2 times, each 5min, adds 1:The PCV2 monoclonal antibodies of 500 dilutions, 37 DEG C of incubation 1h.PBS Wash 3 times, each 5min, add 1:Sheep anti-mouse igg-the FITC of 200 dilutions, 37 DEG C of incubation 45min, PBS is washed 3 times, in fluorescence Micro- Microscopic observation, record result.

The measure of 1.7 double-antibody sandwich elisas

The Sf9 cell lysate solutions of recombinate shape virus infection are collected, are determined using double-antibodies sandwich ELISA PCV2 antigenicities.Sandwich ELISA comprises the following steps that：1. it is coated with：PCV2 monoclonal antibodies 3E5 dilutes 500 with antigen coat liquid It is used to be coated with after times, 100ul first places 0.5h at 37 DEG C, stood overnight then at 4 DEG C per hole.2. wash 3 times with PBST, every time 3min, with the skimmed milk of PBST configurations 5%, per hole 200ul, 37 DEG C of placement 1h.3. being washed 3 times with PBST, to be checked resist is added Original, 100ul is per hole, 37 DEG C of placement 1h.4. add treated rabbit-anti PCV2 serum (1 after washing:3000 dilutions), 100ul is every Hole, 37 DEG C of placement 1h.5. being washed 4 times with PBST, add and dilute 10000 times of goat anti-rabbit igg-HRP, 100ul per hole with PBST, 37 DEG C of placement 1h.6. TMB is added after washing, 37 DEG C of colour developing 10min.7. 50ul 2M H are added per hole₂SO₄Terminating reaction, it is used in combination ELIASA reads OD₄₅₀Numerical value.

1.8 virus-like particles (VLP) are observed

The recombinant baculovirus Bac-TAT-Cap of acquisition is inoculated in Sf9 cells, great expression recombinant protein.After inoculation In 27 DEG C of incubator culture 96h, when notable lesion occurs in cell, 500g centrifugations 5min collects cell.Add appropriate PBS that cell is resuspended Precipitation, in ultrasonic degradation 10min on ice, 4 DEG C of 12000rpm centrifugation 15min harvest supernatants.In affinity chromatography purifying supernatant Cap protein.Comprise the following steps that：1. 2 μ L PCV2 monoclonal antibody 3E5 are added in 400 μ L protein samples, be well mixed after 2h is rocked in ice bath；2. drawing 50 μ L protein A resins in 1.5mL centrifuge tubes, washed 3 times with PBS；3. by albumen sample Product are added in the centrifuge tube containing resin, and 2h is stirred in ice bath, resin is in suspended state；4. on being drawn after low-speed centrifugal Clearly, then with PBS resin is washed 3 times；6. plus 50 μ L eluents are into resin, ice bath 30min；5. low-speed centrifugal collects supernatant, freeze Be stored in -20 DEG C it is standby.The albumen of harvest transmission electron microscope observing after phosphotungstic acid negative staining, detect whether the shape of virus-like particle Into.

2 results

2.1 construction of recombinant plasmid and identification

PCR primer is subjected to agarose nucleic acid electrophoresis, PCR special band, HBM-cap sizes occurs on expected size position For 774bp；PpTG20-cap sizes are 768bp；TAT-cap sizes are 741bp.

By PCR amplification target gene gram respectively it is grand enter pFast-Bac-dual in, Transformed E .coli DH5 α competence is thin Born of the same parents, choose single bacterium colony extraction plasmid.Take positive plasmid to carry out double digestion analysis, as a result cut out and of the same size of target gene Section (Fig. 2), gene sequencing result is all correct, and name recombinant plasmid is pFast-Bac-HBM-cap, pFast-Bac- PpTG20-cap, pFast-Bac-TAT-cap and pFast-Bac-cap.

2.2 restructuring Bacmids and recombinant baculovirus acquisition

By transfer vector plasmid transformed competence colibacillus DH10Bac, screened through two-wheeled indigo plant hickie, every kind of 2 whites of plasmid picking Bacterium colony shaken overnight, with alkaline lysis method of extracting plasmid, respectively with universal primer M13 anti-sense primer or upstream and purpose base Contain target gene (Fig. 3) because upstream or anti-sense primer enter performing PCR identification, as recombinate Bacmids.

By Bacmids transfectional cells, there is obvious lesion in cell after cultivating 7-10 days, shows as cell and becomes big, is rounded, side Edge is bright (Fig. 4), harvest virus, is named as rBac-HBM-cap, rBac-ppTG20-cap, rBac-TAT-cap and rBac- Cap, 4 DEG C of preservations.

2.3 recombinant baculovirus are identified

Western blot identify Cap protein：3 kinds of recombinant viruses and rBac-Cap are inoculated with Sf9 cells respectively, cultivate 4- There is obvious lesion in cell after 5 days.Collect viral supernatant liquid, and with sterilizing PBS by cell blow down and freeze thawing three times then carry out Western blotting, are as a result shown in Fig. 5.Cap, ppTG20-cap, HBM-cap, TAT-cap recombinant protein size about 29kd are left The right side, wherein ppTG20-cap and TAT-cap expression quantity are apparently higher than Cap and HBM-cap groups.

IFA identifies Cap protein：3 kinds of recombinant viruses and rBac-Cap are inoculated with Sf9 cells respectively, cultivate 3 days fixed cells IFA identifications are carried out, as a result see Fig. 6, the fluorescence volume of rBac-TAT-cap expression products is most.

2.4 recombinant protein antigens compare

3 kinds of recombinant viruses and rBac-Cap are inoculated with Sf9 cells respectively, obvious lesion occurs in cell after cultivating 5 days.Collect Cell, freeze thawing carry out sandwich ELISA, the results are shown in Table 2 afterwards three times.TAT-cap and ppTG20-cap antigenicities are apparently higher than HBM- Cap, wherein TAT-cap antigenicities highest, the antigen after 800 times of dilutions with the Bo Linge of 50 times of dilutions PCV2 subunit vaccines Property is similar.

The sandwich ELISA method of table 3 detects recombinant protein antigen

2.5 electron microscopic observation

Recombinant virus is inoculated with Sf9 cell expansion cultures, cell lysis obtains TAT-cap, ppTG20-cap and HBM-cap Albumen, using sucrose density gradient centrifugation purifying protein particle, transmission electron microscope observing is carried out, it is equal that three kinds of recombinant proteins can be seen VLP, size about 20nm (Fig. 7) can be formed.

3 discuss

This research and utilization different genes merge Cap protein, probe into these factor pair Cap proteins in baculovirus expression system In effect.Result of study shows, cell-penetrating peptide can improve expression quantity of the Cap in baculoviral, and HBM signal peptides are without making The effect of Cap protein secreting, expressing, this may be relevant with the nuclear localization sequence of Cap protein, it is also necessary to further research.Cell-penetrating peptide The baculovirus protein expression for merging Cap genes is higher, it may be possible to because cell-penetrating peptide can guide baculoviral more easily Into cell, promote propagation of the virus in cell, so as to improve the expression quantity of Cap protein, and Cap protein can be strengthened to thin Cellular surface is offered.According to electron microscopic observation result, these peptide fusions do not influence Cap in Cap N-terminals and form virus-like particle, are Important foundation has been established in the research of PCV2 recombinant subunit vaccines.

4 brief summaries

Porcine circovirus 2 type (PCV2) ORF2 is optimized codon gene and cell-penetrating peptide by this research using PCR method PpTG20, TAT and honeybee signal peptide (HBM) Gene Fusion, successfully build 4 kinds of recombinant baculovirus of acquisition and pass through Western Blot and immunofluorescence technique identification, are as a result proved, rBac-TAT-cap and rBac-ppTG20-cap expression quantity highests, antigen Property it is best, recombinant protein can be effectively formed virus-like particle, can be used as PCV2 recombinant subunit vaccines candidate plant poison.

Four kinds of PCV2Cap recombinant protein mouse immune Property comparisons of embodiment two, baculovirus expression

This research using recombinant baculovirus rBac-TAT-cap, rBac-ppTG20-cap, rBac-HBM-cap and 4 kinds of Cap proteins of rBac-cap expression, using CP974S aqueous adjuvants, prepare PCV2 subunit vaccines TAT-cap, ppTG20- Cap, HBM-cap and cap, mouse immuning test being carried out, is as a result shown, 4 kinds of vaccines, which can induce, produces PCV2 antibody, but The neutralizing antibody and cellular immune level of ppTG20-cap and TAT-cap recombinant viruses subunit vaccine induction are apparently higher than cap Subunit vaccine, there is important application prospect.

1 materials and methods

1.1 main materials and experimental animal

Express Cap protein recombinant baculovirus rBac-TAT-cap, rBac-ppTG20-cap, rBac-HBM-cap and RBac-cap builds and preserved by this laboratory.High Five cells (U.S. ATCC) are preserved by this laboratory；PCV2 Dan Ke Grand antibody 3E5 is prepared and preserved by this laboratory.

CP974S water adjuvants：It is formulated by this lab design, compound method is：50~60g of carbomer is taken, adds to 9800ml In distilled water, after abundant swelling, mix, 115 DEG C of autoclavings 30 minutes, in gelatin, room temperature is placed.Slowly added using preceding Enter 5%~6% sodium hydroxide solution (5~6g/100ml) of sterilizing, it is converted into water-soluble character, add 20~30 μ g/mL Haemophilus parasuis capsular polysaccharide, 30~40 μ g/mL bacterioproteins OMP, 20~30 μ g/mL DNA of bacteria and 0.01%~ The 0.03% tocopherol aqueous solution (10~30mg/100ml) (degerming with 0.45 μm of membrane filtration), adds sterile purified water extremely 10000ml, mixing is sufficiently stirred, 2~8 DEG C of preservations, should be no more than 12 months.

5 week old cleaning grade ICR mouse, PCV2 negative antibodies are detected through indirect ELISA.

It is prepared by 1.2 vaccines

By the recombinant baculovirus (10 of identical titre^5.0TCID₅₀/ mL) inoculation Sf9 insect cells, 96 hours after infection Collect the cell that lesion occurs.Inhale first and abandon cells and supernatant, every bottle of cell (75cm²) add 1mL 0.01mol/L pH 7.2PBS solution, cell is blown down, then ultrasonic treatment is carried out to cell suspension, obtain the cell cracking containing Porcine circovirus type 2 Cap Liquid.Its Cap protein content is determined with sandwich ELISA method, adjustment destination protein concentration is 30 μ g/mL.By destination protein antigen 4 are pressed with CP974S adjuvants:1 ratio mixes, and is stirred, is sufficiently mixed 10 minutes with 300r/min, 4 kinds of vaccine TAT-cap of configuration, PpTG20-cap, HBM-cap and cap, be stored in 4 DEG C it is standby.

1.3 mouse immuning test

50 cleaning grade mouse are randomly divided into 5 groups, 1-4 groups are TAT-cap, ppTG20-cap, HBM-cap and cap Vaccine inoculation group, the 5th group is PBS control group.Mouse carries out head after adapting to 2 days and exempted from, and immunization method is dorsal sc multi-point injection, Vaccine immunity dosage is 200 μ L.Head exempts from rear 14d and carries out booster immunization, and the dosage and method of booster immunization are as before.Head exempts from Afterwards the 28th, 42d, every group takes 5 eyeball of mouse blood samplings at random, separates serum, determines ELISA antibody and neutralizing antibody drop respectively Degree；It is sterile to win mouse spleen, lymphocyte is separated after adding sterilizing PBS grindings, determines lymphproliferation response.

1.4ELISA antibody test

Envelope antigen is the CapC that this laboratory prepares purification storage, and this albumen is by Bacillus coli expression.With pH9.6 carbonic acid Salt buffer is diluted to final concentration of 5ug/ml, coated elisa plate, 100 μ L/ holes, and 4 DEG C of coatings are overnight after 37 DEG C of effect 2h；Washing 3 times, each 3-5min；200 μ L 0.15%BSA confining liquids are added to close plank, 37 DEG C of effect 2h per hole；Washing；By blood to be checked It is clear to use PBS doubling dilutions, each sample a line, 100 μ L, 37 DEG C of effect 1h are added per hole；Washing；Then enzyme mark sheep anti mouse is added IgG(1:5000 times of dilutions), 100 μ L/ holes, 37 DEG C of effect 1h；Washing；Substrate solution TMB is added to develop the color, finally with 2mM H₂SO₄Eventually Only react.Result judgement：Serum OD to be checked₄₅₀Value/negative serum OD₄₅₀Value >=2.1 is the positive.

1.5 neutralizing antibodies detect

Serum to be checked is inactivated in 56 DEG C of water-bath 30min, after 12000rpm centrifugations 10min is degerming, suctions out supernatant to going out In the EP pipes of bacterium.The serum handled well is subjected to doubling dilution with maintaining liquid again, is 1: 4,1: 8,1: 16,1: 32 ... ... successively At the same time, the PCV2 of propagation is diluted to 200TCID with maintaining liquid₅₀/ 0.1mL, then from the body such as the serum of different dilution factors Product mixing, 37 DEG C of water-baths act on 1h.The nutrient solution in 96 orifice plates with PK15 cells is discarded, cell one is washed with pure DMEM Time, then serum-virus mixture after water-bath is acted on is added in hole, and each serum dilution sets 3 repetitions, and 100 μ L are every Hole, 37 DEG C of culture 72h.Negative serum control, negative serum virus control and blank control are set simultaneously.With exempting from indirectly after 72h Epidemic disease fluorescence method (IFA) determine serum neutralize antibody titers, using can suppress 50%PCV2 infection serum greatest dilution as The neutralize antibody titers of serum to be checked.

1.6 lymphocyte proliferation assay

Eyeball of mouse is taken a blood sample, mouse is put to death with cervical dislocation.Under aseptic condition, spleen is taken out, and cut off with scissors Coupled connective tissue and adipose tissue.The spleen for separating acquisition is put into the worry nethike embrane of 200 mesh, after adding 3mLPBS Sterile grinding, splenocyte suspension is transferred in the centrifuge tube containing lymphocyte separation medium, 2000rpm centrifugations 15min.With suction Pipe draws the grey leucocyte in intermediate layer, is put into another test tube, adds erythrocyte cracked liquid 5mL, mixes splenocyte, stands 5min, treat that red blood cell is completely broken, 2000rpm centrifugation 10min, abandon supernatant and remove red blood cell.5mL pure 1640 is added to wash again Cell precipitation, 2000rpm centrifugation 10min, discards supernatant, 5 × 10 is diluted to the 1640 of 10%⁶Individual/mL, 96 orifice plates are added, 100 μ L are per hole.Using PCV2 as stimulator antigen, ConA is as control, final concentration 10 μ g/mL, cultivates 72h at 37 DEG C, adds per hole Enter 20 μ L MTT (5mg/mL), every group of 3 repetitions, continue to cultivate 6h at 37 DEG C.The nutrient solution in 96 holes is discarded, adds DMSO, 100 μ L vibrate per hole and melt purple crystal, measure wavelength 570nm OD values, calculating stimulus index (the OD values in SI=stimulations hole/ The OD values in hole are not stimulated).

1.7 data statistic analysis

Statistical analysis is carried out to experimental data using SPSS softwares, and compares the difference of each group numerical value, wherein P<0.05 table Show significant difference, P<0.01 represents that difference is extremely notable.

2 results

2.1ELISA antibody

As a result Fig. 8 is seen.TAT-cap, ppTG20-cap, HBM-cap and cap vaccine first immunisation can induce and produces for 14 days PCV2 antibody, head exempt from after 28 days and 42 days, four kinds of vaccine immunity groups produce the ELISA antibody of higher level, and negative control Group is then not detected by PCV2 specific antibodies.

2.2 neutralizing antibody

As a result such as Fig. 9.Head exempts from latter 28 and 42 days, TAT-cap and ppTG20-cap vaccine immunity group PCV2 neutralizing antibody water Put down apparently higher than HBM-cap and cap vaccine immunity groups (P<0.05).Meanwhile negative control group is then not detected by PCV2 and resisted Body.

2.3 cellullar immunologic response

As a result such as Figure 10.Head exempts from latter 28-42 days, TAT-cap and ppTG20-cap vaccine immunity group PCV2 specificity SI is bright It is aobvious to be higher than HBM-cap and cap vaccine immunity groups (P<0.05).

3 conclusions

This research be prepared for recombinant baculovirus rBac-TAT-cap, rBac-ppTG20-cap, rBac-HBM-cap and The recombinant Cap protein subunit vaccine of rBac-cap expression.Four kinds of vaccines can induce mouse and produce PCV2ELISA antibody with And antibody, but TAT-cap and ppTG20-cap vaccines neutralizing antibody and cellular immune level are apparently higher than HBM-cap and cap epidemic diseases Seedling, TAT-cap with ppTG20-cap recombinant protein vaccine humoral immunities are similar with cellular immune level, before having important application Scape.

The Porcine circovirus type 2 Cap recombinant baculovirus vaccine pig body immune protection effectiveness research of embodiment three

The recombinant protein that this research is expressed with recombinant baculovirus rBac-TAT-cap and rBac-ppTG20-cap prepares epidemic disease Seedling, carry out pig body Immunoprotection test, and compared with import PCV2 subunit vaccines, as a result for：2 weeks after immune Detectable ELISA antibody, 4 weeks after being immunized, TAT-Cap groups, ppTG20-Cap and commercially available vaccine group neutralizing antibody are horizontal respectively For 1:90、1:85 and 1:72.Carry out challenge test within 4 weeks after immune, TAT-Cap and ppTG20-Cap vaccines can be to attack malicious piglet Immunoprotection is provided, immune swine viremia virusemia, lymph node and lung tissue pathological change and lymph node tissue virus load are aobvious Work is less than nonimmune control group, and immune effect is slightly better than commercialization PCV2 subunit vaccines, has important application prospect.

1 materials and methods

1.1 main materials and reagent

Porcine circovirus 2 type SH strains (PCV2SH, for the virus stain routinely separated) separate identification by this laboratory and preserved； PK15 cells and SF9 cells (U.S. ATCC) are preserved by this laboratory；Express the recombinant baculovirus rBac-TAT- of Cap protein Cap and rBac-ppTG20-cap is built and preserved by this laboratory；Freund's complete adjuvant, Freund's incomplete adjuvant, keyhole limpet hemocyanin SIGMA companies are purchased from thioglycollate medium, CP940S water adjuvant is configured by this laboratory；PCV2 monoclonal antibodies 3E5 by This laboratory prepares and preserved；Goat anti-mouse igg-HRP, SPA-HRP, goat anti-mouse igg-FITC and the purchase of DAB colour reagents box From Wuhan doctor's moral bio-engineering corporation；Viral DNA extracts kit is purchased from OMEGA companies；Human peripheral lymphocyte separates Liquid is purchased from Tianjin Hao sun biological products Co., Ltd.Other conventional reagents are that analysis is pure.

1.2 experimental animal

5 week old cleaning grade ICR mouse, PCV2 negative antibodies are detected through indirect ELISA；30 age in days weanling pigs, after testing PCV2 and PRRSV antigen-antibody is feminine gender, isolated rearing.

The preparation of 1.3 vaccines

Take recombinant baculovirus rBac-TAT-cap and rBac-ppTG20-cap (10^7.5TCID₅₀/ ml) inoculation Sf9 insects Cell (10^6.0Individual cell/ml), cultivate 96 hours, low-speed centrifugal abandons supernatant, add former isometric PBS solution (0.01mol/L, PH 7.2), ultrasonic treatment, obtain two kinds of Porcine circovirus type 2 Cap liquid, respectively with CP974S water-soluble adjuvants, by 4:1 volume ratio is mixed Two kinds of vaccines TAT-cap and ppTG20-cap are made in conjunction, are saved backup in 4 DEG C.

1.4 piglet immunological protection tests

25 first 30 age in days weanling pigs are screened, PCV2 and PRRSV antigen-antibodies are feminine gender after testing, are randomly divided into 5 groups, Every group 5, each group isolated rearing.First group of inoculation PCV2TAT-cap subunit vaccine, intramuscular injection 1mL, second group of inoculation PCV2ppTG20-cap subunit vaccines, the 3rd group of inoculation CiroFLEX imports subunit vaccine (Bo Linge companies), 4th group is not inoculated with as malicious control group (CC) is attacked, and the 5th group is not inoculated with as blank control group (NC).14,21 and 28 after immune Its blood sampling, separation serum is used for ELISA antibody and neutralizing antibody detects.Immune group was carried out with poison group piglet is attacked in 28 days after immune Poison is attacked, (contains 10 with PCV2SH strains^6.0TCID₅₀/ ml) collunarium 1ml, intramuscular injection 2ml, isolated rearing.Attack after poison the 4th, 7, point Not in the both sides oxter of every pig and the both sides buttocks keyhole that totally 4 points are emulsified to all pig inoculations with incomplete Freund's adjuvant Hemocyanin (KLH/ICFA, 0.5mg/ml), each point inoculation 1ml (4ml/ heads), while intraperitoneal inoculation thioglycollate medium, 10ml/ heads；After attacking poison intraperitoneal inoculation thioglycollate medium, 10ml/ heads are distinguished again within the 11st day and 19 days.Attack after poison per in the sky Noon measures the body temperature of all piglets, and observes the clinical manifestation of piglet.Taken a blood sample within 7,19,28 days after attacking poison, separation serum is used for disease Toxaemia detects.0 and 28 natural gift also known as measure every pig body weight after attacking poison, calculate relative daily gain (RDWG).Cutd open within 28 days after attacking poison All piglets are killed, the organ disease situation such as every pig lungs and lymph node is observed, takes lymph node, lungs in 4% paraformaldehyde It is fixed, for histotomy making and immunohistochemical assay.

1.5ELISA antibody test

Envelope antigen is the CapC that this laboratory prepares purification storage, and this albumen is by Bacillus coli expression.With pH9.6 carbonic acid Salt buffer is diluted to final concentration of 5ug/ml, coated elisa plate, 100 μ L/ holes, and 4 DEG C of coatings are overnight after 37 DEG C of effect 2h；Washing 3 times, each 3-5min；200 μ L 0.15%BSA confining liquids are added to close plank, 37 DEG C of effect 2h per hole；Washing；By blood to be checked It is clear to use PBS doubling dilutions, each sample a line, 100 μ L, 37 DEG C of effect 1h are added per hole；Washing；Then enzyme target SPA (1 is added: 10000 times of dilutions), 100 μ L/ holes, 37 DEG C of effect 1h；Washing；Substrate solution TMB is added to develop the color, finally with 2mM H₂SO₄Terminate anti- Should.Result judgement：Serum OD to be checked₄₅₀Value/negative serum OD₄₅₀Value >=2.1 is the positive.To judge positive serum maximum dilution Spend the antibody titer as the sample.

1.6 neutralizing antibodies detect

Serum to be checked is inactivated in 56 DEG C of water-bath 30min, after 12000rpm centrifugations 10min is degerming, suctions out supernatant to going out In the EP pipes of bacterium.The serum handled well is subjected to doubling dilution with maintaining liquid again, is 1: 4,1: 8,1: 16,1: 32 ... ... successively At the same time, the PCV2 of propagation is diluted to 200TCID with maintaining liquid₅₀/ 0.1mL, then from the body such as the serum of different dilution factors Product mixing, 37 DEG C of water-baths act on 1h.The nutrient solution in 96 orifice plates with PK15 cells is discarded, cell one is washed with pure DMEM Time, then serum-virus mixture after water-bath is acted on is added in hole, and each serum dilution sets 3 repetitions, and 100 μ L are every Hole, 37 DEG C of culture 72h.Negative serum control, negative serum virus control and blank control are set simultaneously.With exempting from indirectly after 72h Epidemic disease fluorescence method (IFA) determine serum neutralize antibody titers, using can suppress 50%PCV2 infection serum greatest dilution as The neutralize antibody titers of serum to be checked.

1.7Real-time PCR quantitatively detect PCV2

Sample DNA extracts：Take 200 μ l serum or lymph node tissue suspension, add 400 μ lPBS, the SDS of final concentration 1% and The μ g/mL of final concentration 50 Proteinase K, 56 DEG C of water-bath 30min, isometric phenol is added, vibration mixes, 12000rpm centrifugations 10min；Careful supernatant of drawing is managed to new EP, adds isometric phenol/chloroform, and vibration mixes, 12000rpm centrifugations 10min； Careful supernatant of drawing is managed to new EP, adds isometric chloroform, and vibration mixes, 12000rpm centrifugations 10min；It is careful to draw Managed to new EP clearly, add the 3M sodium acetates (pH5.2) of 1/10 volume and the absolute ethyl alcohol of the precooling of 2.5 times of volumes, -20 DEG C of mistakes Night precipitates DNA；12000rpm centrifuges 15min, abandons supernatant, and precipitation washed once with 75% ethanol, drying at room temperature；It is eventually adding 20 μ L aseptic double-distilled water dissolving DNAs, -20 DEG C save backup.

Real-time PCR：Reaction system is：μ L, the 2 × Power SYBR Green PCR MasterMix of DNA 2 Each 1 μ L of (TOYOBO companies) 10 μ L, primers F/R (final concentration 400nM, F:5’-CCAGGAGGGCGTTCTGACT-3’；R:5’- CGTTACCGCTGGAGAAGGAA-3 '), aseptic double-distilled water supplies volume to 20 μ L.Put in ABI 7300real time PCR instruments Carry out, response procedures are：Pre-degeneration 95 DEG C of 2min, 95 DEG C of 15s, 60 DEG C of 1min, carry out 40 circulations.Concurrently set negative control And by the use of 10 times of doubling dilutions of positive plasmid template pT-SH as template, operate in the same way, standard curve is drawn, according to sample Product Ct values and standard curve calculate corresponding copy number.

1.8 pathological observation

Pathological anatomy is carried out according to a conventional method, observes internal organs pathological change, and gather the internal organs such as lungs, spleen, lymph node After 10% paraformaldehyde is fixed, paraffin section, HE dyeing, microscope tissues observed lesion are prepared.The section made is preserved In box of cutting into slices, after dimethylbenzene volatilization completely, the pathological change of tissues observed section under the microscope.

1.9 SABC

Slide is handled according to a conventional method, is prepared bronchial lymph nodes and inguinal lymph nodes paraffin section, is used immune group Change method detects PCV2 antigens：(1) paraffin section routinely dewaxes into water.(2) 3%H₂O₂Deionized water is incubated 5~10min, distillation Washing 3 times.(3) antigen hot repair is answered：0.01M citrate buffers (pH6.0) are immersed into section, after micro-wave oven is heated to boiling Low fiery 20min.Washed 1~2 time with PBS (0.01M, pH7.2~7.6) after cooling.(4) 5% sheep blood serum confining liquid of dropwise addition, 37 DEG C Incubation 30min, gets rid of surplus liquid.(5) the anti-PCV2 monoclonal antibodies (1 of mouse are added dropwise:100), 37 DEG C of incubation 4h, are used PBS washes 2min × 3 time.(6) goat anti-mouse igg of HRP marks is added dropwise, 37 DEG C of incubation 1h, 2min × 3 time are washed with PBS.(7)DAB Colour developing：Using DAB colour reagent boxes, about 50ul reagents 1 are added in 1mL reagents 2 (DAB substrate solutions), well mixed add to is cut Piece, color development at room temperature, between controlling 5~20min of the reaction time under mirror, untill thering is cell dye in brown, distillation water washing. (8) haematoxylin is slightly redyed, mounting.(9) micro- sem observation, brown the judgement PCV2 of dye cell number >=10% and resisted in lymph follicle It is Antigen positive hybridomas.

1.10 data statistic analysis

Statistical analysis is carried out to experimental data using SPSS softwares, and compares the difference of each group numerical value, wherein P<0.05 table Show significant difference, P<0.01 represents that difference is extremely notable.

2 results

2.1 humoral immune response

Indirect ELISA antibody test, as a result represent that concrete outcome is shown in Figure 11 with S/P values during 100 times of serum-dilution.Exempt from After epidemic disease 2 weeks, three immune groups have different degrees of PCV2 antibody to produce, after being immunized 4 weeks, the antibody levels of two immune groups after Height of continuing rising.

Neutralizing antibody result such as Figure 12, TAT-Cap groups, ppTG20-Cap and commercially available vaccine group neutralizing antibody level are respectively 1:90、1:85 and 1:72, there is no significant difference (P between each group>0.05).

2.2 attack piglet clinical symptoms after poison

4 weeks after immune, carry out PCV2 and attack poison, measure body temperature daily, continuous three weeks, as a result show, three immune groups and sky White control group does not occur the phenomenon (being more than 40 DEG C) generated heat persistently, without obvious clinical symptoms.It is nonimmune to attack malicious group and have There is body temperature rise in 3-4 days in two pig, becomes thin, the mild clinical symptom such as the thick unrest of hair and spirit are depressed.Attack after poison 0 day and 28 days Weigh the body weight of each pig, calculate relative daily gain, as a result see Figure 13, the relative daily gain of three vaccine immunity groups is substantially high In attacking malicious control group (P<0.05), illustrate that TAT-Cap and ppTG20-Cap vaccine groups all generate immanoprotection action to piglet, Promote the growth of piglet.

2.4 attack piglet viremia virusemia detection after poison

Taken a blood sample within 7,19,28 days after attacking poison, separation serum detects for viremia virusemia, as a result such as Figure 14.All pigs are all ill Toxaemia occurs, but TAT-Cap and ppTG20-Cap vaccine groups are significantly lower than and attack malicious control group (P<0.05), with commercially available vaccine group Similar (P>0.05).

Virus measure in 2.5 lymph node tissues

Poison is attacked after 28 days, cuts open the DNA for killing all pigs and extracting inguinal lymph nodes, for Real-time PCR, and then is surveyed Fixed PCV2 contents therein, are as a result shown in Figure 15.The presence of virus can be detected in the lymph node of all pigs, but three immune (P similar between group>0.05) it is significantly lower than, but and attacks malicious control group (P<0.05) TAT-Cap and ppTG20-Cap vaccines, are shown Group effectively reduces PCV2 infection.

2.6 pathological changes and SABC testing result

Lymph node and lung histology Pathologic Observation result show, blank control group and three vaccine immunity group lymphs Knot and lung tissue attack the lymph follicle obscurity boundary of malicious control group lymph node, Lymphocyte depletion without obvious lesion, and lungs go out Show the phenomenon of broadening interstitial, alveolar diminution, bleeding and consolidation.Lymph node tissue SABC testing result is shown, attacks poison group leaching More pale brown cytochrome be present in bar tissue, and TAT-Cap, ppTG20-Cap and commercially available vaccine immune group are then without specificity Pigmented cells (Figure 16).

3 conclusions

In summary, it is special that two kinds of Porcine circovirus type 2 Cap subunit vaccines that prepared by this research can induce body to produce PCV2 The ELISA antibody and neutralizing antibody of the opposite sex, poison is attacked to PCV2 and produces protective effect, and base has been established for PCV2 new generation vaccine developments Plinth.

Sequence table

<110>Agricultural University Of Nanjing

<120>A kind of porcine circovirus 2 type Cap- cell-penetrating peptides antigen-4 fusion protein gene of high efficient expression and its application

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 741

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

atgtatggca ggaagaagcg gagacagcga cgaagaatga cctacccacg ccggcgcttt 60

cggcgccgcc ggcatcgccc tcgctcccat ctgggccaaa tcctccggcg gcggccttgg 120

ctcgtgcatc cccggcaccg gtatcgctgg cgccggaaga acggcatctt caatacccgc 180

ctgtcccgca ccatcggcta caccgtgaag aagaccaccg tgcggacacc aagctggaat 240

gtggacatga tgcgcttcaa cattaacgac ttcctccctc ccggaggcgg gagcaacccc 300

ctgaccgtgc cattcgagta ctatcgcatc cggaaagtga aggtggagtt ctggccatgc 360

tcccccatta cacagggcga ccggggagtc ggcagcaccg ccgtgatcct ggacgacaac 420

ttcgtgacca aagccaacgc tctgacatac gacccctacg tcaattactc cagccggcac 480

accatcaccc agcccttcag ctaccacagc cgctacttca cccccaagcc cgtgctggac 540

cggaccatcg actacttcca acccaacaac aagcgcaacc agctgtggct gcgcctgcaa 600

accacaggca acgtggacca cgtcggcctg gggaccgctt ttgagaacag catctacgac 660

caggactaca acatccgcat caccatgtac gtgcagttcc gcgaattcaa cctgaaggac 720

ccccctctca atcccaagtg a 741

<210> 2

<211> 248

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 2

Ala Thr Met Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Met Thr

1 5 10 15

Tyr Pro Arg Arg Arg Phe Arg Arg Arg Arg His Arg Pro Arg Ser His

20 25 30

Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro Arg His

35 40 45

Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg Leu Ser

50 55 60

Arg Thr Ile Gly Tyr Thr Val Lys Lys Thr Thr Val Arg Thr Pro Ser

65 70 75 80

Trp Asn Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu Pro Pro

85 90 95

Gly Gly Gly Ser Asn Pro Leu Thr Val Pro Phe Glu Tyr Tyr Arg Ile

100 105 110

Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr Gln Gly

115 120 125

Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn Phe Val

130 135 140

Thr Lys Ala Asn Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr Ser Ser

145 150 155 160

Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr Phe Thr

165 170 175

Pro Lys Pro Val Leu Asp Arg Thr Ile Asp Tyr Phe Gln Pro Asn Asn

180 185 190

Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Thr Gly Asn Val Asp

195 200 205

His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp Gln Asp

210 215 220

Tyr Asn Ile Arg Ile Thr Met Tyr Val Gln Phe Arg Glu Phe Asn Leu

225 230 235 240

Lys Asp Pro Pro Leu Asn Pro Lys

245

<210> 3

<211> 768

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

atgggtctgt tccgagcact gctgcgactg ctgcgatctc tgtggcgact gctgctgcga 60

gcaatgacct acccacgccg gcgctttcgg cgccgccggc atcgccctcg ctcccatctg 120

ggccaaatcc tccggcggcg gccttggctc gtgcatcccc ggcaccggta tcgctggcgc 180

cggaagaacg gcatcttcaa tacccgcctg tcccgcacca tcggctacac cgtgaagaag 240

accaccgtgc ggacaccaag ctggaatgtg gacatgatgc gcttcaacat taacgacttc 300

ctccctcccg gaggcgggag caaccccctg accgtgccat tcgagtacta tcgcatccgg 360

aaagtgaagg tggagttctg gccatgctcc cccattacac agggcgaccg gggagtcggc 420

agcaccgccg tgatcctgga cgacaacttc gtgaccaaag ccaacgctct gacatacgac 480

ccctacgtca attactccag ccggcacacc atcacccagc ccttcagcta ccacagccgc 540

tacttcaccc ccaagcccgt gctggaccgg accatcgact acttccaacc caacaacaag 600

cgcaaccagc tgtggctgcg cctgcaaacc acaggcaacg tggaccacgt cggcctgggg 660

accgcttttg agaacagcat ctacgaccag gactacaaca tccgcatcac catgtacgtg 720

cagttccgcg aattcaacct gaaggacccc cctctcaatc ccaagtga 768

<210> 4

<211> 257

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 4

Ala Thr Met Gly Leu Phe Arg Ala Leu Leu Arg Leu Leu Arg Ser Leu

1 5 10 15

Trp Arg Leu Leu Leu Arg Ala Met Thr Tyr Pro Arg Arg Arg Phe Arg

20 25 30

Arg Arg Arg His Arg Pro Arg Ser His Leu Gly Gln Ile Leu Arg Arg

35 40 45

Arg Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg Arg Lys

50 55 60

Asn Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Ile Gly Tyr Thr Val

65 70 75 80

Lys Lys Thr Thr Val Arg Thr Pro Ser Trp Asn Val Asp Met Met Arg

85 90 95

Phe Asn Ile Asn Asp Phe Leu Pro Pro Gly Gly Gly Ser Asn Pro Leu

100 105 110

Thr Val Pro Phe Glu Tyr Tyr Arg Ile Arg Lys Val Lys Val Glu Phe

115 120 125

Trp Pro Cys Ser Pro Ile Thr Gln Gly Asp Arg Gly Val Gly Ser Thr

130 135 140

Ala Val Ile Leu Asp Asp Asn Phe Val Thr Lys Ala Asn Ala Leu Thr

145 150 155 160

Tyr Asp Pro Tyr Val Asn Tyr Ser Ser Arg His Thr Ile Thr Gln Pro

165 170 175

Phe Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro Val Leu Asp Arg

180 185 190

Thr Ile Asp Tyr Phe Gln Pro Asn Asn Lys Arg Asn Gln Leu Trp Leu

195 200 205

Arg Leu Gln Thr Thr Gly Asn Val Asp His Val Gly Leu Gly Thr Ala

210 215 220

Phe Glu Asn Ser Ile Tyr Asp Gln Asp Tyr Asn Ile Arg Ile Thr Met

225 230 235 240

Tyr Val Gln Phe Arg Glu Phe Asn Leu Lys Asp Pro Pro Leu Asn Pro

245 250 255

Lys

<210> 5

<211> 774

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

atgaaattct tagtcaacgt tgcccttgtt tttatggtcg tatacatttc ttacatctat 60

gcggatcgaa tgacctaccc acgccggcgc tttcggcgcc gccggcatcg ccctcgctcc 120

catctgggcc aaatcctccg gcggcggcct tggctcgtgc atccccggca ccggtatcgc 180

tggcgccgga agaacggcat cttcaatacc cgcctgtccc gcaccatcgg ctacaccgtg 240

aagaagacca ccgtgcggac accaagctgg aatgtggaca tgatgcgctt caacattaac 300

gacttcctcc ctcccggagg cgggagcaac cccctgaccg tgccattcga gtactatcgc 360

atccggaaag tgaaggtgga gttctggcca tgctccccca ttacacaggg cgaccgggga 420

gtcggcagca ccgccgtgat cctggacgac aacttcgtga ccaaagccaa cgctctgaca 480

tacgacccct acgtcaatta ctccagccgg cacaccatca cccagccctt cagctaccac 540

agccgctact tcacccccaa gcccgtgctg gaccggacca tcgactactt ccaacccaac 600

aacaagcgca accagctgtg gctgcgcctg caaaccacag gcaacgtgga ccacgtcggc 660

ctggggaccg cttttgagaa cagcatctac gaccaggact acaacatccg catcaccatg 720

tacgtgcagt tccgcgaatt caacctgaag gacccccctc tcaatcccaa gtga 774

<210> 6

<211> 259

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 6

Ala Thr Met Lys Phe Leu Val Asn Val Ala Leu Val Phe Met Val Val

1 5 10 15

Tyr Ile Ser Tyr Ile Tyr Ala Asp Arg Met Thr Tyr Pro Arg Arg Arg

20 25 30

Phe Arg Arg Arg Arg His Arg Pro Arg Ser His Leu Gly Gln Ile Leu

35 40 45

Arg Arg Arg Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg

50 55 60

Arg Lys Asn Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Ile Gly Tyr

65 70 75 80

Thr Val Lys Lys Thr Thr Val Arg Thr Pro Ser Trp Asn Val Asp Met

85 90 95

Met Arg Phe Asn Ile Asn Asp Phe Leu Pro Pro Gly Gly Gly Ser Asn

100 105 110

Pro Leu Thr Val Pro Phe Glu Tyr Tyr Arg Ile Arg Lys Val Lys Val

115 120 125

Glu Phe Trp Pro Cys Ser Pro Ile Thr Gln Gly Asp Arg Gly Val Gly

130 135 140

Ser Thr Ala Val Ile Leu Asp Asp Asn Phe Val Thr Lys Ala Asn Ala

145 150 155 160

Leu Thr Tyr Asp Pro Tyr Val Asn Tyr Ser Ser Arg His Thr Ile Thr

165 170 175

Gln Pro Phe Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro Val Leu

180 185 190

Asp Arg Thr Ile Asp Tyr Phe Gln Pro Asn Asn Lys Arg Asn Gln Leu

195 200 205

Trp Leu Arg Leu Gln Thr Thr Gly Asn Val Asp His Val Gly Leu Gly

210 215 220

Thr Ala Phe Glu Asn Ser Ile Tyr Asp Gln Asp Tyr Asn Ile Arg Ile

225 230 235 240

Thr Met Tyr Val Gln Phe Arg Glu Phe Asn Leu Lys Asp Pro Pro Leu

245 250 255

Asn Pro Lys

<210> 7

<211> 705

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

atgacctacc cacgccggcg ctttcggcgc cgccggcatc gccctcgctc ccatctgggc 60

caaatcctcc ggcggcggcc ttggctcgtg catccccggc accggtatcg ctggcgccgg 120

aagaacggca tcttcaatac ccgcctgtcc cgcaccatcg gctacaccgt gaagaagacc 180

accgtgcgga caccaagctg gaatgtggac atgatgcgct tcaacattaa cgacttcctc 240

cctcccggag gcgggagcaa ccccctgacc gtgccattcg agtactatcg catccggaaa 300

gtgaaggtgg agttctggcc atgctccccc attacacagg gcgaccgggg agtcggcagc 360

accgccgtga tcctggacga caacttcgtg accaaagcca acgctctgac atacgacccc 420

tacgtcaatt actccagccg gcacaccatc acccagccct tcagctacca cagccgctac 480

ttcaccccca agcccgtgct ggaccggacc atcgactact tccaacccaa caacaagcgc 540

aaccagctgt ggctgcgcct gcaaaccaca ggcaacgtgg accacgtcgg cctggggacc 600

gcttttgaga acagcatcta cgaccaggac tacaacatcc gcatcaccat gtacgtgcag 660

ttccgcgaat tcaacctgaa ggacccccct ctcaatccca agtga 705

<210> 8

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

tatggcagga agaagcggag acagcgacga aga 33

<210> 9

<211> 60

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

ggtctgttcc gagcactgct gcgactgctg cgatctctgt ggcgactgct gctgcgagca 60

<210> 10

<211> 69

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

atgaaattct tagtcaacgt tgcccttgtt tttatggtcg tatacatttc ttacatctat 60

gcggatcga 69

<210> 11

<211> 57

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

cgctcgagat gtatggcagg aagaagcgga gacagcgacg aagaatgacc taccccc 57

<210> 12

<211> 58

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

cgctcgagat gggtctgttc cgagcactgc tgcgactgct gcgatctctg tggcgact 58

<210> 13

<211> 56

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 13

ctgctgcgat ctctgtggcg actgctgctg cgagcaatga cctacccccg ccgccg 56

<210> 14

<211> 53

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

cgctcgagat gaaattctta gtcaacgttg cccttgtttt tatggtcgta tac 53

<210> 15

<211> 59

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 15

tttatggtcg tatacatttc ttacatctat gcggatcgaa tgacctaccc ccgccgccg 59

<210> 16

<211> 43

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 16

cgggtacctc aatggtgatg gtgatgatgc ttggggttca ggg 43

Claims (10)

1. A kind of 1. porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes, it is characterised in that：The gene is in (1)~(3) Any one：

   (1) the Cap genes of cell-penetrating peptide TAT gene orders are merged；

   (2) the Cap genes of cell-penetrating peptide ppTG20 gene orders are merged；

   (3) the Cap genes of honeybee signal peptide HBM gene orders are merged.
2. 2. porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes according to claim 1, it is characterised in that：

   The nucleotide sequence of the Cap genes of the fusion cell-penetrating peptide TAT gene orders is as shown in SEQ ID NO.1；

   The nucleotide sequence of the Cap genes of the fusion cell-penetrating peptide ppTG20 gene orders is as shown in SEQ ID NO.3；

   The nucleotide sequence of the Cap genes of the fusion honeybee signal peptide HBM gene orders is as shown in SEQ ID NO.5.
3. 3. porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes according to claim 1 or 2, it is characterised in that：

   The preparation process of Cap genes of the fusion cell-penetrating peptide TAT gene orders is：According to cell-penetrating peptide TAT gene orders Cap gene orders in TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA and pVax-cap, primer TAT-cap-F is designed, 5’-

   CGCTCGAGATGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAATGACCTACCCCC-3 ', Cap-R, 5 '- CGGGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3 ', using recombinant plasmid pVax-cap as template, amplification Obtain TAT-cap genes；

   The preparation process of Cap genes of the fusion cell-penetrating peptide ppTG20 gene orders is：According to cell-penetrating peptide ppTG20 gene sequences Arrange Cap in GGTCTGTTCCGAGCACTGCTGCGACTGCTGCGATCTCTGTGGCGACTGCTGCTGCG AGCA and pVax-cap Gene order, design primer ppTG20-cap-F1,5 '-CGCTCGAGATGGGTCTGTTCCGAGCACTGCTGCGACTGCTGCG - the CTGCTGCGATCTCTGTGGCGACTGCTGCTGCGAGCAATGAC of ATCTCTGTGGCGACT-3 ', ppTG20-cap-F2,5 ' - the CG of CTACCCCCGCCGCCG-3 ', Cap-R, 5 'GGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG-3 ', with Recombinant plasmid pVax-cap is template, and twice PCR expands to obtain ppTG20-cap genes；

   The preparation process of Cap genes of the fusion honeybee signal peptide HBM gene orders is：According to honeybee signal peptide HBM genes Sequence ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATACATTTCTTACAT CTATGCGGATCGA and Cap gene orders in pVax-cap, design primer HBM-cap-F1,5 '-CGCTCGAGATGAAATTCTTAGTCAACGTTGCCC - the TTTATGGTCGTATACATTTCTTACATCTATGCGGATCGA of TTGTTTTTATGGTCGTATAC-3 ', HBM-cap-F2,5 ' - the CG of ATGACCTACCCCCGCCGCCG-3 ', Cap-R, 5 'GGTACCTCAATGGTGATGGTGATGATGCTTGGGGTTCAGGG- 3 ', using recombinant plasmid pVax-cap as template, twice PCR expands to obtain HBM-cap genes.
4. 4. include the expression of any porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes in claims 1 to 3 Box, recombinant expression carrier, recombinant baculovirus, transgenic cell line or transgenosis recombinant bacterium.
5. A kind of 5. recombinant baculovirus, it is characterised in that：Prepared using procedure below：Described in will be any in claims 1 to 3 After porcine circovirus 2 type Cap- cell-penetrating peptide antigen-4 fusion protein genes are cloned into baculovirus vector pFast-Bac-Dual, by the positive Transfer vector plasmid converts DH10Bac competence, homologous recombination, obtains restructuring Bacmid, by restructuring Bacmid transfection Sf9 cells Carry out culture and obtain recombinant baculovirus.
6. 6. by the porcine circovirus 2 type Cap- cell-penetrating peptide fusion proteins of any described gene code in claims 1 to 3.
7. 7. porcine circovirus 2 type Cap- cell-penetrating peptide fusion proteins according to claim 6, it is characterised in that be in a~c Any one：

   A, the amino acid sequence as shown in SEQ ID NO.2；

   B, the amino acid sequence as shown in SEQ ID NO.4；

   C, the amino acid sequence as shown in SEQ ID NO.6.
8. 8. the porcine circovirus 2 type Cap- cell-penetrating peptides fusion protein described in claim 6 or 7 is in PVC2 subunit vaccines are prepared Application.
9. A kind of 9. PVC2 subunit vaccines, it is characterised in that：Worn comprising the porcine circovirus 2 type Cap- described in claim 6 or 7 Film peptide fusion protein.
10. 10. PVC2 subunit vaccines according to claim 9, it is characterised in that：Also include CP974S water in the vaccine Property adjuvant.