CN113861277A

CN113861277A - Bovine rotavirus recombinant VP8 protein and application thereof

Info

Publication number: CN113861277A
Application number: CN202111159988.2A
Authority: CN
Inventors: 汤承; 岳华; 王远微; 姜晓明
Original assignee: Southwest Minzu University
Current assignee: Southwest Minzu University
Priority date: 2021-09-30
Filing date: 2021-09-30
Publication date: 2021-12-31

Abstract

The invention discloses a bovine rotavirus recombinant VP8 protein and application thereof. The amino acid sequence of the bovine rotavirus recombinant VP8 protein is shown in SEQ ID NO. 1. The recombinant VP8 protein has good antigenicity and immunogenicity, can be efficiently expressed in a prokaryotic system, can generate a high-level neutralizing antibody, and is suitable for being used as a rotavirus subunit vaccine.

Description

Bovine rotavirus recombinant VP8 protein and application thereof

Technical Field

The invention relates to the fields of molecular biology and genetic engineering, in particular to a bovine rotavirus recombinant VP8 protein and application thereof.

Background

Group a Rotavirus (RVA) is a zoonotic virus and an important pathogen causing acute diarrhea in children and young animals worldwide. Bovine Rotavirus (BRV) can be transmitted through a fecal oral route and a respiratory tract route, which brings great economic loss to the cattle industry all over the world, and in china, research of a plurality of scholars shows that the detectable rate of BRVA in diarrhea calves in China is 21.4-90.91%. RV VP4 determines the P genotype of rotavirus. To date, 51P-types have been discovered, 14 confirmed in BRVA, with the P1, P5, and P11 genotypes most common in BRVA. The P types detected in cattle group in China are P1, P5, P7, P11, among which the G6P 1 type BRVA is widely popular in cattle group in China. Researches of scholars in 2019-2020 prove that the dominant genotype of the Yak source BRV in the Qinghai-Tibet plateau area in China and the Yak source BRV in partial provinces in China is G6P [1], and the genetic relationship between the Yak source and the milk cow source BRV is recent, which indicates that the BRV of G6P [1] type is widely spread in the Yak and the milk cow in China.

The VP4 protein of BRV is encoded by segment 4 gene, its total length is about 2356bp, its complete ORF is 2331bp, and it encodes 776 amino acids. The VP4 protein can induce the body to produce neutralizing antigen, and is one of the important protective antigens of BRV. Under the action of trypsin, the VP4 protein can be cleaved into a VP8 subunit (amino acid position: 1-231) and a VP5 subunit (amino acid position: 248-776), and the VP8 protein has the main epitope of the VP4 protein and determines the specific serum neutralization reaction of the VP4 protein. Currently, 4 neutralizing epitopes (8-1, 8-2, 8-3 and 8-4) have been identified in the VP8 subunit, whose specific neutralizing antibodies show limited cross-neutralization between rotavirus strains. Therefore, the VP8 gene is an important target gene of the bovine rotavirus subunit vaccine. The research finds that the human RV VP8 protein can induce virus neutralizing antibodies and related protection of mice, and the VP8 protein expressed by bacteria can induce high-level virus neutralizing antibodies, so that the vaccine has considerable vaccine potential.

At present, no specific medicine exists for treating rotavirus, and prevention is generally performed by improving environmental sanitation and providing a clean water source, but the incidence rate cannot be reduced and the spread of the virus cannot be prevented only by the method. And the rotavirus vaccines which are on the market are attenuated live vaccines and have higher intussusception risk, so that the development of the bovine rotavirus subunit vaccine which is safer and more effective and can avoid the risk of virulence rejuvenation and virus dispersion has important significance.

Disclosure of Invention

The invention aims to provide a bovine rotavirus G6P [1] type recombinant VP8 protein and application thereof, the recombinant protein has high specificity, easy purification and preparation of soluble expression and low cost, can be used as an antigen, can stimulate an organism to generate a neutralizing antibody, and is suitable for preparing subunit vaccines for treating and/or preventing rotavirus.

In order to achieve the purpose, the invention adopts the following technical scheme:

the first purpose of the invention is to provide a bovine rotavirus VP8 recombinant protein, and the amino acid sequence of the recombinant protein is shown as SEQ ID NO. 1.

The second object of the present invention is to provide a gene encoding the recombinant protein according to claim 1.

Furthermore, the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

The third purpose of the invention is to provide a recombinant expression vector, which is obtained by adopting the gene optimization.

Further, the nucleotide sequence obtained by optimization is shown as SEQ ID NO. 3;

furthermore, the nucleotide sequence has an enzyme cutting site Nde I at the 5 'end, an enzyme cutting site Xho I at the 3' end, and a His tag at the N-end.

When the expression vector is constructed, under the condition of knowing the gene sequence, the invention utilizes biological software to optimize the preferred codon of escherichia coli on the gene sequence, synthesizes the whole sequence of the modified sequence, does not need to separately design a primer for completely amplifying the target gene, avoids the influence on the experimental process caused by directly amplifying from a clinical sample or a laboratory culture, is convenient to optimize and modify the corresponding preferred codon of the expression system on the sequence, and is beneficial to improving the yield and the expression efficiency of the recombinant protein in the expression system.

Furthermore, the recombinant expression vector is a prokaryotic expression vector and is used for a prokaryotic recombinant expression system.

The prokaryotic expression vector includes but is not limited to one of pJLA50X series, pET series, pQE series, pMAL series, pGEX series and pBAD series vectors, and in the specific implementation mode of the invention, the prokaryotic expression vector is pET series, and further is pET30a expression vector.

Further, the preparation method of the prokaryotic recombinant expression system comprises the following steps: and transforming the recombinant expression vector into an escherichia coli cell, culturing in an LB liquid culture medium, and performing IPTG induced expression to obtain the recombinant protein.

The expression strain has simple culture mode and short culture period, and can synthesize a large amount of recombinant protein within a period of several days.

According to the invention, a large amount of excellent recombinant protein can be obtained in a short time through the prokaryotic expression system, the antigen protein is expressed into soluble expression through the prokaryotic expression system, the soluble protein does not need to be purified under a denaturation condition, the defects that the prokaryotic expression system lacks modification capability after expression of the eukaryotic system recombinant protein and cannot generate correct disulfide bonds are overcome, the renaturation steps are reduced, the expression time of the recombinant protein is shortened, and the production efficiency of the recombinant protein is improved.

The fourth purpose of the invention is to provide the application of the recombinant protein, the gene and the recombinant expression vector in preparing vaccines for preventing and/or treating animal diarrhea caused by rotavirus.

Further, the vaccine is a subunit vaccine.

Further, the vaccine also comprises a pharmaceutically acceptable adjuvant, and further comprises an adjuvant 201.

The invention has the following beneficial effects:

(1) the optimized recombinant protein has high specificity, easy purification and preparation and low cost, can be used as an antigen to stimulate an organism to generate a high-level neutralizing antibody, and is suitable for preparing rotavirus vaccines.

(2) The invention introduces the optimized G6P [1] type recombinant VP8 protein into rotavirus subunit vaccine, greatly improves the immune efficacy of the vaccine, obtains the vaccine with high neutralization potency, can realize large-scale production, and has good commercial development prospect.

(3) The optimized protein is non-replicative, does not proliferate in a body, does not have the risk of toxin dispersion, and has high safety.

Drawings

FIG. 1 is the identification chart of recombinant expression plasmid pET-30a-VP8 of the bovine rotavirus optimized recombinant VP8 gene of the invention;

FIG. 2 is a protein expression analysis diagram of the optimized recombinant VP8 gene of the bovine rotavirus after optimization;

FIG. 3 is a SDS-PAGE result of protein of the purified bovine rotavirus optimized recombinant VP8 gene;

FIG. 4 is a Western blot detection diagram of the bovine rotavirus optimized recombinant VP8 gene protein;

FIG. 5 is a graph of the growth and loss of rabbit serum antibodies detected by indirect ELISA method.

In FIG. 1, wherein M represents DNA standard DL2000 and 1 represents a gene amplification product; in FIG. 2, M represents a protein molecular weight standard, 1 represents total protein before induction, 2 represents supernatant at 20 ℃, 3 represents precipitation at 20 ℃, 4 represents supernatant at 37 ℃, and 5 represents precipitation at 37 ℃; in FIG. 3, M represents a protein molecular weight standard, 1 represents a sample solution, 2 represents an effluent solution, 3 represents 20mmol/L Imidazole-eluting fraction, 4 represents 50mmol/L Imidazole-eluting fraction, and 5 represents 500mmol/L Imidazole-eluting fraction; in FIG. 4, M represents a protein molecular mass standard, and 1 represents VP8 protein.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention.

The virus solution used in the examples was BRV G6P [1] stored in animal medicine laboratory of national university of southwest]Strain, TCID₅₀：10^-5.76。

It should be noted that those whose specific conditions are not specified in the examples were performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially. The values in the examples are mean values.

Example 1

A method for preparing recombinant VP8 gene protein of milk cow rotavirus comprises the following steps:

(1) amplification of the BRV G6P [1] VP8 Gene: through earlier stage on partial region dairy cattle in our country and yak rotavirus molecular epidemiological investigation in Qinghai-Tibet plateau in our country, it is shown that the SDA2 strain rotavirus is a dominant genotype of the bovine rotavirus. Taking a proper amount of feces sample with positive bovine rotavirus P1 type strain virus nucleic acid, which is preserved in animal medicine laboratory of southwest ethnic university, extracting total RNA and performing reverse transcription to synthesize cDNA according to a conventional method, performing RT-PCR amplification, and using a specific primer: GATGACACCATATGGAGCCTATCCTGGACG is used as a reference material; r: GACACCTCGAGCTGGATCGGCGGCAGGCC are provided. Splicing the gene fragments by using biological software to obtain a complete ORF sequence of the VP8 gene, wherein the size of the ORF sequence is 501bp, and the amino acid sequence of the ORF sequence is represented by SEQ ID NO: 1, and the nucleic acid sequence of the coding sequence is shown as SEQ ID NO: 2, respectively.

(2) The obtained VP8 gene sequence is optimized, under the condition of not changing any amino acid, the codon preference of the gene is close to that of Escherichia coli, and the optimized VP8 encoding gene is shown as SEQ ID No: 3, adding an enzyme cutting site Nde I at the 5 'position, adding an enzyme cutting site Xho I at the 3' position, adding a His label at the N end, and then sending the sequences to a primer synthesis company for synthesis, wherein the sequences of the Nde I site and the Xho I site are CATATG and CTCGAG respectively. The synthesized sequence is used as a template, Nde I and Xho I are subjected to double enzyme digestion, then the synthesized sequence is connected with a pET-30a vector subjected to double enzyme digestion by Nde I and Xho I to be transformed into TOP10 competence, a single colony is picked, and a colony PCR (polymerase chain reaction) is used for identifying a positive clone and is sequenced. The nucleotide sequence of the optimized VP8 encoding gene is shown in SEQ ID NO.3, which is in line with the expectation and proves that the pET-30a-VP8 expression plasmid is successfully obtained, and the size is 5923 bp. (see fig. 1).

(3) The pET-30a-VP8 expression plasmid obtained in step (2) was transformed into BL21(DE3), spread on LB solid medium (containing 30ug/ml kanamycin), and cultured overnight at 37 ℃ in a constant temperature incubator. The next day, single colonies were picked and inoculated into 10mL LB liquid medium (containing 30ug/mL kanamycin) and shake-cultured at 37 ℃ for 10 h.

(4) The next day, the strain was inoculated into 200mL LB liquid medium (containing 30ug/mL kanamycin) at a ratio of 1:100, shake-cultured at 37 ℃ until OD is about 0.6-0.8, and IPTG was added to a final concentration of 0.5mmol/L, one group was induced at 20 ℃ overnight, the other group was induced at 37 ℃ for 6 hours, and the group without IPTG was used as a negative control. The cells were collected by centrifugation, resuspended in PBS 1:100(W/V), sonicated, centrifuged, and the supernatant and pellet were collected separately, the pellet was solubilized with inclusion body lysate (8mol/L Urea, 50mmol/L Tris-HCl, 300mmol/L NaCl, pH8.0)1:20(W/V), and analyzed by SDS-PAGE using 12% separation gel, showing that the VP8 fusion protein was expressed in soluble form (see FIG. 2).

(5) The bovine rotavirus VP8 recombinant protein was expressed in large amount by induction, and the resulting lysate was purified by 5mL HisCap 6FF Ni ion column and SDS-PAGE electrophoresis using 12% gel according to the protocol of protein purification by nickel Sepharose affinity chromatography (see FIG. 3). After SDS-PAGE detection of the collected components, the components with the best purity are dialyzed to 50mmol/L Tris, 300mmol/L NaCl, pH8.0, concentrated by PEG20000, filtered by a 0.45 mu m filter membrane, subpackaged into 1 mL/tube, frozen and stored at-80 ℃, and the concentration of the recombinant protein after renaturation is determined according to the using method of the BCA protein concentration determination kit.

(6) Taking a purified recombinant protein sample, carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) by using 12% separation gel, transferring the recombinant protein to a nitrocellulose membrane, and sealing the nitrocellulose membrane by using 5% skimmed milk overnight; adding rabbit anti-bovine rotavirus positive serum and fetal calf serum diluted by 1:500 times respectively, incubating for 2h at 37 ℃ in a shaking table, and washing for 3 times and 10 min/time by TBST; adding HRP-labeled goat anti-rabbit secondary antibody diluted by 1:5000 times, incubating for 1h in a shaking table at 37 ℃, washing for 3 times by TBST, and then carrying out ECL (as shown in figure 4), wherein the result shows that the target protein is about 20kD and can be identified by rabbit anti-bovine rotavirus positive serum, thereby proving that the recombinant VP8 protein has biological activity and good immunogenicity.

Example 2

Preparation of rotavirus recombinant VP8 protein subunit vaccine

(1) Diluting the recombinant VP8 protein purified in example 1 to 1mg/mL, heating the diluted recombinant VP8 protein and 201 adjuvant in water bath to 31 ℃, mixing the two, stirring the mixture in a stirrer at the rotating speed of 350r/min for 5min, and after stirring, standing the vaccine at 4 ℃ overnight for vaccine quality detection.

(2) And (3) sterility detection: the VP8 recombinant protein subunit vaccine is coated on an LB culture medium, and no bacteria grow after being cultured for 24h at 37 ℃.

(3) Detecting the dosage form; and (3) sucking a small amount of VP8 subunit vaccine and dripping the vaccine into deionized water, and uniformly mixing the vaccine and the deionized water, wherein the vaccine is a water-in-oil-in-water recombinant protein subunit vaccine.

(4) And (3) primary stability test: 1mL of the vaccine is sucked into a 1.5mL centrifuge tube, and the centrifugal tube is centrifuged for 15min at 3000r/min and 4 ℃, so that the vaccine does not have the layering phenomenon.

(5) Safety test (animal vaccination): the VP8 recombinant protein subunit vaccine is warmed up at room temperature, BALB/c pregnant mother mouse with 6-8 weeks old is injected subcutaneously into the neck, the inoculation dose is 0.5mL, the mouse after inoculation has good mental state and normal appetite, the injection part has no abnormal conditions such as red swelling and unhairing, and the pregnant mother mouse has no abortion.

(6) Determination of immunogenicity: 10 New Zealand white rabbits were divided into experimental and control groups of 5 rabbits each. All rabbits were bled from the pre-immune marginal vein and tested for serum IgG by ELISA. The mode of subcutaneous injection immunization is adopted, 1mL (1) of prepared VP8 recombinant protein subunit vaccine is injected into an experimental group, 1mLPBS is injected into a control group, and second immunization is carried out 2 times after one immunization at an interval of 2 weeks. Ear vein blood was collected once a week after priming for 5 weeks and serum-specific antibodies were detected by indirect ELISA.

The indirect ELISA detection procedure and conditions were as follows: mu.l (1. mu.g/ml) of recombinant VP8 protein of the present invention was coated on the microplate at 4 ℃ overnight. After PBST washing, 4% PEG6000 was added for blocking for 1 h. After PBST washing, the serum to be detected was added at a dilution of 1:64000 and the temperature was 37 ℃ for 1 hour. After PBST washing, 1:20000 diluted goat anti-rabbit enzyme-labeled secondary antibody is added, and the temperature is 37 ℃ for 1 h. Washing PBST, adding color developing solution, developing at 37 deg.C in dark for 15min, addingStop solution read OD 450nm₄₅₀. ELISA test results (FIG. 5) showed that the rabbit produced detectable serum antibody after immunization, indicating that the recombinant VP8 protein has good immunogenicity.

(7) Determination of neutralizing antibody titer: 20 New Zealand white rabbits were divided into 1-4 groups of 5 rabbits each. Group 1 is a control group, group 2 is a VP8 subunit vaccine group, group 3 is a rotavirus whole virus inactivated vaccine group, and group 4 is a single BRV attenuated live vaccine group of NCDV strain G6 approved by the United states USDA. Immunizing rabbits according to the immunization program of each vaccine group, collecting blood from ear vein of all rabbits before immunization, performing second immunization 14d after the first immunization, totally immunizing for 2 times, collecting positive serum of each rabbit group 14 days after the second immunization, and determining the neutralizing antibody titer of each group.

And (3) carrying out a virus serum neutralization experiment after carrying out water bath on each group of rabbit serum at 56 ℃ for 30min, and respectively measuring the neutralization titer of each group of rabbit serum by using a fixed virus dilution serum method. The rabbit serum of the experimental group is firstly diluted by 50 times by DMEM nutrient solution, and then diluted by multiple times in a 96-well plate by DMEM nutrient solution (2)¹、2²、2³、……、2¹⁰) Thereafter, 100. mu.L of 200-fold TCID50 virus solution was added to each well, and the mixture was incubated in an incubator at 37 ℃ for 1 hour and then added to a 96-well plate of MA104 cells, while positive control wells (100. mu.L of virus solution plus 100. mu.L of maintenance solution) and negative control wells (200. mu.L of maintenance solution) were set up and observed up to 4d daily.

The neutralizing titer of serum of each group is calculated by a Reed-Muench method, the number of cell pores with CPE is recorded in experiments, and the results show that (table 1) the neutralizing titer of serum immunity of a control group is 0, the average neutralizing titer of VP8 subunit vaccine after immunity is 1:17222, the average neutralizing titer of BRV inactivated vaccine after immunity is 1:11120, and the average neutralizing titer of NCDV strain BRV attenuated live vaccine after immunity is 1: 14666. The VP8 subunit vaccine has the highest neutralization titer after immunization.

TABLE 1 neutralizing titer of rabbit pre-and post-immune serum antibodies

The optimized recombinant VP8 protein is used as an antigen, and the rotavirus subunit vaccine prepared by mixing the optimized recombinant VP8 protein with an adjuvant is used for subcutaneous injection immunization to induce an organism to generate a detectable high-level serum neutralizing antibody, and can be used for treating and/or preventing diarrhea symptoms of young animals caused by rotavirus.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all changes in equivalent flow or equivalent structure, which are made by using the description of the present invention and are directly or indirectly applied to other related technical fields should be covered by the scope of the present invention.

<110> university of southwest ethnic group

<120> bovine rotavirus recombinant VP8 protein and application thereof

<130> 1

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 168

<212> PRT

<213> VP8 recombinant protein

<400> 1

Glu Pro Ile Leu Asp Gly Pro Tyr Gln Pro Thr Thr Phe Asn Pro Pro

1 5 10 15

Val Ser Tyr Trp Met Leu Leu Ala Pro Thr Asn Ala Gly Val Val Ala

20 25 30

Glu Gly Thr Asn Asn Thr Asn Arg Trp Leu Ala Thr Ile Leu Ile Glu

35 40 45

Pro Asn Val Gln Ser Val Glu Arg Thr Tyr Thr Leu Phe Gly Gln Gln

50 55 60

Val Gln Ile Thr Val Ser Asn Asp Ser Gln Thr Lys Trp Lys Phe Val

65 70 75 80

Asp Val Ser Lys Gln Thr Gln Asp Gly Ser Tyr Ser Gln His Gly Pro

85 90 95

Leu Leu Ser Thr Pro Lys Leu Tyr Gly Val Met Lys His Gly Gly Lys

100 105 110

Ile Tyr Thr Tyr Asn Gly Glu Thr Pro Asn Ala Asn Ile Gly Tyr Tyr

115 120 125

Ser Thr Thr Asn Tyr Asp Ser Val Asn Met Thr Ala Tyr Cys Asp Phe

130 135 140

Tyr Ile Ile Pro Leu Ala Gln Glu Glu Lys Cys Thr Glu Tyr Ile Asn

145 150 155 160

Asn Gly Leu Pro Pro Ile Gln Leu

165

<210> 2

<211> 501

<212> DNA

<213> VP8 Gene

<400> 2

gaaccaatat tagacggacc atatcaaccg acgactttca acccaccggt gagttattgg 60

atgttactcg ctccgactaa cgcaggagtg gtagctgaag gcacaaataa tacaaatagg 120

tggctagcga caatattaat agaaccaaac gtgcagtcag ttgaaaggac ctacacatta 180

tttggtcagc aagtacaaat tacagtgtca aacgattctc aaacgaaatg gaaatttgta 240

gatgttagca aacaaacgca agatggcagc tattcacagc atggaccatt gttatcaaca 300

ccaaagctgt atggagtaat gaaacacgga ggtaaaatat atacatataa tggagaaaca 360

ccgaacgcga acatagggta ttattcaaca acaaattatg actctgttaa tatgacagcg 420

tattgcgatt tttatataat accattagcg caagaggaaa aatgtactga gtatataaat 480

aatggattac caccgataca a 501

<210> 3

<211> 513

<212> DNA

<213> VP8 optimized Gene

<400> 3

catatggagc ctatcctgga cggtccatat caaccaacta ctttcaaccc gcctgtcagc 60

tactggatgc tgctggcacc gactaatgca ggtgttgttg ctgaaggtac taacaacact 120

aaccgttggc tggctaccat cctgatcgaa ccgaacgttc aaagcgtcga acgcacctat 180

acgctgttcg gtcagcaggt acagattacc gtaagcaacg actctcagac caagtggaaa 240

ttcgtggacg tgtctaaaca gacccaggat ggttcttact cccagcatgg tccgctgctg 300

tctaccccga aactgtacgg cgttatgaaa cacggcggca aaatttacac gtacaacggc 360

gaaaccccga atgcgaacat tggctattac tccacgacca actacgattc cgtgaacatg 420

accgcgtact gtgattttta tatcatcccg ctggcccagg aagagaaatg caccgaatat 480

atcaacaacg gcctgccgcc gatccagctc gag 513

<210> 4

<211> 176

<212> PRT

<213> VP8 optimized amino acids

<400> 4

Met Glu Pro Ile Leu Asp Gly Pro Tyr Gln Pro Thr Thr Phe Asn Pro

1 5 10 15

Pro Val Ser Tyr Trp Met Leu Leu Ala Pro Thr Asn Ala Gly Val Val

20 25 30

Ala Glu Gly Thr Asn Asn Thr Asn Arg Trp Leu Ala Thr Ile Leu Ile

35 40 45

Glu Pro Asn Val Gln Ser Val Glu Arg Thr Tyr Thr Leu Phe Gly Gln

50 55 60

Gln Val Gln Ile Thr Val Ser Asn Asp Ser Gln Thr Lys Trp Lys Phe

65 70 75 80

Val Asp Val Ser Lys Gln Thr Gln Asp Gly Ser Tyr Ser Gln His Gly

85 90 95

Pro Leu Leu Ser Thr Pro Lys Leu Tyr Gly Val Met Lys His Gly Gly

100 105 110

Lys Ile Tyr Thr Tyr Asn Gly Glu Thr Pro Asn Ala Asn Ile Gly Tyr

115 120 125

Tyr Ser Thr Thr Asn Tyr Asp Ser Val Asn Met Thr Ala Tyr Cys Asp

130 135 140

Phe Tyr Ile Ile Pro Leu Ala Gln Glu Glu Lys Cys Thr Glu Tyr Ile

145 150 155 160

Asn Asn Gly Leu Pro Pro Ile Gln Leu Glu His His His His His His

165 170 175

Claims

1. A bovine rotavirus VP8 recombinant protein is characterized in that the amino acid sequence of the recombinant protein is shown as SEQ ID NO. 1.

2. A gene encoding the recombinant protein of claim 1.

3. The gene of claim 2, wherein the nucleotide sequence is as shown in SEQ ID No. 2.

4. A recombinant expression vector optimized using the gene of claim 2 or 3.

5. The recombinant expression vector according to claim 4, wherein the nucleotide sequence of the optimized gene is shown in SEQ ID No. 3;

6. The recombinant expression vector according to claim 4, wherein the recombinant expression vector is a prokaryotic expression vector for use in a prokaryotic recombinant expression system.

7. The recombinant expression vector according to claim 4, wherein the preparation method of the prokaryotic recombinant expression system comprises the following steps: transforming Escherichia coli cells with the recombinant expression vector of claim 6, culturing in LB liquid medium, and performing IPTG induced expression to obtain recombinant protein.

8. Use of the recombinant protein of claim 1, the gene of claim 2 or 3, the recombinant expression vector of any one of claims 4 to 6 in the preparation of a vaccine for preventing and/or treating diarrhea in animals caused by rotavirus.

9. The use according to claim 8, wherein the vaccine is a subunit vaccine.

10. The use according to claim 8, wherein the vaccine further comprises a pharmaceutically acceptable adjuvant, further adjuvant 201.