Disclosure of Invention
In order to overcome the defect that the prior art lacks a vaccine for simultaneously resisting porcine pseudorabies and porcine reproductive and respiratory syndrome, the invention adopts the combination of the Red/ET recombination technology and the Cre/loxP site-specific recombination system to finally obtain the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene, and the recombinant pseudorabies virus is expected to be used as a candidate vaccine strain of the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene.
The primary object of the present invention is to provide an intermediate transfer vector of the pBR322 vector containing the homology arm of the nonessential gene of PRV.
It is a second object of the present invention to provide a recombinant comprising the above-mentioned intermediate transfer vector.
The third purpose of the invention is to provide the application of the intermediate transfer vector in constructing the recombinant pseudorabies virus.
The fourth purpose of the invention is to provide the pseudorabies virus bacterial artificial chromosome recombinant plasmid pBeloBAC 11-Bartha-K61.
The fifth purpose of the invention is to provide a recombinant containing the rabies virus bacterial artificial chromosome recombinant plasmid pBeloBAC 11-Bartha-K61.
The sixth purpose of the invention is to provide the application of the recombinant plasmid pBeloBAC11-Bartha-K61 in constructing recombinant pseudorabies virus.
The seventh purpose of the invention is to provide a recombinant pseudorabies virus of porcine reproductive and respiratory syndrome virus genes.
The eighth purpose of the invention is to provide a construction method of the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene.
The ninth purpose of the invention is to provide the application of the prepared recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene.
The tenth object of the present invention is to provide a vaccine for a recombinant pseudorabies virus containing a porcine reproductive and respiratory syndrome virus gene.
The purpose of the invention is realized by the following technical scheme:
an intermediate transfer vector of pBR322 vector containing PRV non-essential gene homology arm is obtained by line recombination of pBR322 vector, target gene, resistance gene with loxP site and/or promoter through Red/ET homologous recombination technology.
Preferably, the target gene is porcine reproductive and respiratory syndrome virus GP3-GP5-M fusion fragment; the promoter is selected from any one of ori, CMV and CAGGS; the non-essential gene is TK gene and/or gG gene of PRV.
The three promoters are selected, wherein ori is already studied in literature and is used for expressing foreign genes, and the CMV promoter is mostly applied to expressing foreign genes mainly because the CMV promoter is easily obtained by PCR amplification. The CAGGS promoter is an artificially constructed combinatorial promoter consisting of Cytomegalovirus (CMV) early enhancer (early enhancer element) and chicken beta-actin promoter, and is considered to be the strongest promoter. However, because of the high GC content and the complicated DNA structure, DNA synthesis or PCR is difficult to obtain, and the accuracy is difficult to verify by sequencing, so that the conventional vector vaccine does not use the CAGGS promoter to express foreign genes. The research adopts the subcloning mediated by Red/ET homologous recombination to obtain a CAGGS promoter expression intermediate vector, the intermediate vector comprises a CAGGS promoter, a polyA sequence and a resistance screening gene, homologous sequences of target expression sites are added on two sides of the intermediate vector, and proper enzyme cutting sites are placed at two ends of the homologous sequences. The insertion of the CAGGS promoter expression cassette into infectious clone is realized through a Red recombination system by linearizing an intermediate vector, releasing a CAGGS promoter expression cassette linear fragment, exposing a homologous sequence of a target vector. Since the CAGGS promoter expression cassette did not pass PCR, sequencing validation was not required.
Preferably, before the linear recombination, the pBR322 vector, the target gene, the promoter, the resistance gene with the loxP site have homology arms at both ends, and when the non-essential gene is the TK gene of PRV, the pBR322 vector, the target gene, the promoter, the resistance gene with the loxP site are expressed by SEQ ID NO: 1-27 by amplification of a primer group sequence; when the non-essential gene is gG gene of PRV, the pBR322 vector with homologous arms at two ends, the target gene and the resistance gene with loxP sites are expressed by SEQ ID NO: 34-43 by amplification.
In order to ensure high fidelity of cloning, PCR sequencing identification is carried out in each step of homologous recombination to ensure that the obtained target fragment without mutation, especially the homologous arm part, needs to be verified whether base mutation occurs in the homologous recombination process by PCR. In order to reduce base mutation, the invention introduces an intermediate transfer vector, and considering that the molecular weight of the BAC vector is larger, if PRV virus homologous is directly amplified by PCR and is applied to the BAC vector, base mutation is easy to cause, if the base of a homologous arm is mutated, the subsequent homologous recombination efficiency is reduced, and in order to improve the homologous recombination efficiency, the base mutation is avoided.
The invention firstly constructs an intermediate transfer vector containing PRV TK gene or gG gene homologous arm, respectively places HPPRRSV and NADC30-like strain GP3-GP5-M gene at the downstream of three promoters (TK original promoter ori, CMV promoter, CAGGS promoter), places IL-18-IFN-gamma at the downstream of gG original promoter, designs primers, electrically converts each amplified linear fragment with homologous arm into E.coli GB05-dir competence for expressing RecET recombinase to carry out linear homologous recombination to form HPP plasmid containing target gene and loxP site, obtains correct clone pBR 322-spark-TK-ori-RRSV/NADC 30-like-GP3-GP 5-M-loxP-gene, pBR 322-spark-TK-CMV-30-like-NADC 3-NAPT 3-GP-5-GP 3526-loxP, pBR 322-spot-TK-CAGGS-HPPRRSV/NADC 30-like-GP3-GP5-M-loxP-genta, pBR 322-spot-gG-IL-18-gamma-loxP-kan.
More preferably, the GP3-GP5-M fusion fragment comprises HPPRRSV-GP3-GP5-M and NADC30-like-GP3-GP 5-M; when the non-essential gene to be replaced is TK gene of PRV, the intermediate transfer vectors are pBR 322-spot-TK-ori-HPPRRSV-GP 3-GP5-M-loxP-genta, pBR 322-spot-TK-ori-NADC 30-like-GP3-GP5-M-loxP-genta, pBR 322-spot-TK-CMV-HPPRRSV-GP 3-GP5-M-loxP-genta, pBR 322-spot-TK-CMV-NADC 30-like-GP3-GP 5-M-loxP-gene, pBR 322-spot-TK-CAGGS-HPPRRSV-GP 3-GP 5-M-loxP-gene, pBR 322-spot-TK-CAGGS-NADC 30-like-GP3-GP 5-M-loxP-gene; when the non-essential gene for replacement is the gG gene of PRV, the intermediate transfer vector is pBR 322-spectrum-gG-IL-18-gamma-loxP-kan.
The invention also provides a recombinant comprising the intermediate transfer vector. By using the obtained intermediate transfer vector, the desired recombinant pseudorabies virus can be obtained only by carrying out simple Red alpha beta mediated loop recombination and Cre induced recombination deletion resistance between loxP specific sites.
The invention also provides a pseudorabies virus bacterium artificial chromosome recombinant vector pBeloBAC11-Bartha-K61, and the preparation method of the infectious clone pBeloBAC11-Bartha-K61 comprises the following steps:
s1, taking sequences at two ends of PRV Bartha-K61 whole virus genome as left and right homology arms, and utilizing SEQ ID NO: 28-29, loading virus homologous arms to two ends of pBR322-amp-ccdB as a first recombinant fragment through PCR amplification;
s2, using two ends of pBeloBAC11 vector as homologous arms, and using SEQ ID NO: 30-31, loading BAC homologous arms to two ends of the first recombinant fragment through PCR amplification to obtain a second recombinant fragment;
s3, carrying out homologous recombination on the second recombinant fragment obtained in the step S2 and a pBeloBAC11 vector in E.coli GBdir-gyrA462 to obtain a pBeloBAC11 linear fragment with a virus homologous arm;
s4, carrying out homologous recombination on the pBeloBAC11 linear fragment with the virus homologous arm in the step S3 and the first recombinant fragment of S1 in E.coli GB05-dir to obtain the recombinant vector pBeloBAC 11-Bartha-K61.
According to the invention, when a recombinant vector pBeloBAC11-Bartha-K61 is constructed, homology arms are added at two ends of the whole genome, however, most of PRV Bartha-K61 homology arm positions are designed at two ends of TK or gG gene, so that TK or gG gene is deleted during recombination, but the invention aims to prepare a recombinant virus which replaces TK or gG position gene and contains a foreign gene, so that no deletion is made.
The invention also provides a recombinant comprising the recombinant vector pBeloBAC 11-Bartha-K61. By using the recombinant, a recombinant pseudorabies virus can be constructed.
The invention also provides a recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene, wherein the recombinant pseudorabies virus is obtained by replacing the TK gene of PRV by a porcine reproductive and respiratory syndrome virus GP3-GP5-M fusion fragment; the porcine reproductive and respiratory syndrome virus GP3-GP5-M fusion fragment comprises HPPRRSV-GP3-GP5-M and NADC30-like-GP3-GP 5-M.
Preferably, the method for constructing the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene is characterized by comprising the following steps of:
(1) constructing a TK intermediate transfer vector for replacing the TK gene position of PRV, wherein the TK intermediate transfer vector is obtained by a pBR322 vector, a target gene GP3-GP5-M fusion fragment, a promoter and a resistance gene with a loxP site through line recombination by a Red/ET homologous recombination technology, and two ends of the TK intermediate transfer vector after the line recombination are provided with homologous arms capable of performing line loop recombination with the TK position gene of PRV;
(2) enzyme cutting TK intermediate transfer vector to obtain linear fragment with target gene GP3-GP5-M fusion fragment, promoter and loxP action site;
(3) and (3) performing loop recombination on the linear fragment obtained in the step (2) and pBeloBAC11-Bartha-K61 infectious clone by a Red/ET homologous recombination technology, and inducing the expression of Cre recombinase to eliminate resistance by using a Cre/loxP site specific recombination system to obtain the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene.
The intermediate transfer vector in the step (2) is subjected to enzyme digestion through a preset XhoI or AflII enzyme digestion site to obtain linear fragments, and both ends of the linear fragments are provided with a TK gene of a modified pBeloBAC11-Bartha-K61 or a homology arm and a resistance selection gene of a gG gene; linear fragments with target genes and loxP action sites are electrically transformed into E.coli GB05-Red competent cells expressing Red alpha beta recombinase to carry out loop recombination with pBeloBAC11-Bartha-K61 plasmid to obtain recombinant plasmid with target genes and loxP sites, and then the infectious clone of the recombinant virus is obtained by Cre induction of recombination deletion resistance among loxP specific sites.
As a specific implementation mode, the construction method of the recombinant pseudorabies virus replacing the TK gene porcine reproductive and respiratory syndrome virus gene comprises the following steps:
s1, by SEQ ID NO: 1-27 to obtain a pBR322 vector pBR 322-selection with homologous arms at two ends, a target gene GP3-GP5-M fusion fragment, a promoter ori/CMV/CAGGS and a resistance gene fragment with a loxP site, performing linear recombination in an escherichia coli GB05-dir competence by a Red/ET homologous recombination technology to respectively obtain a homologous arm intermediate transfer vector pBR 322-selection-TK-ori-HPPRRSV-GP 3-GP 5-M-loxP-gene, a pBR 322-selection-TK-ori-NADC 30-like-GP 3-5-M-loxP-gene, a pBR 322-selection-TK-RRSV-GP-3-GP 5-M-loxP-gene, a pBR 322-selection-TK-CMV-RRSV-GP-3-GP-5-M-loxP-gene, a gene and a gene fragment with loxP sites at two ends, wherein the homologous arms can perform linear recombination with PRV, pBR 322-spot-TK-CMV-NADC 30-like-GP3-GP 5-M-loxP-gene, pBR 322-spot-TK-CAGGS-HPPRRSV-GP 3-GP 5-M-loxP-gene, pBR 322-spot-TK-CAGGS-NADC 30-like-GP3-GP 5-M-loxP-gene;
s2, obtaining a linear fragment with target gene GP3-GP5-M fusion fragment, promoter ori/CMV/CAGGS and loxP action site through enzyme digestion of a preset enzyme digestion site;
s3, performing loop recombination on the linear fragment of S2 and PRV infectious clone pBeloBAC11-Bartha-K61 in Escherichia coli GB05-Red competence by Red/ET homologous recombination technology, inducing the expression of Cre recombinase to eliminate resistance by using a Cre/loxP site-specific recombination system, and finally obtaining infectious clone pBeloBAC 11-Bartha-K61-delta TK/ori-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/HPPR RRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-RRSV-NAGP 3-GP5-M, pBeloBAC 11-Bartha-K61-TK/TK 36ori-DC 61-lipgp-61-363672-Bartha 61-61-CMV-61-CGP 61-36lipb pBeloBAC 11-Bartha-K61-delta TK/CAGGS-NADC30-like-GP3-GP 5-M.
The prepared recombinant virus infectious clone can be used as a genetic engineering vaccine through virus rescue, or used as immunogen for preparing a specific antibody, and the specific antibody can be used for treating porcine reproductive and respiratory syndrome virus and porcine pseudorabies virus infection; can also prevent the infection of porcine reproductive and respiratory syndrome virus and porcine pseudorabies virus; other diseases directly caused by porcine reproductive and respiratory syndrome virus and porcine pseudorabies virus infection can also be prevented or treated.
The invention therefore also provides a vaccine (typically a viral live vector vaccine) comprising a recombinant pseudorabies virus replacing the TK gene in the porcine reproductive and respiratory syndrome virus gene.
The invention also provides a specific antibody prepared by taking the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene as an immunogen.
The invention also provides a medicine of the specific antibody prepared by taking the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene as an immunogen.
Because PRV has many regions for inserting exogenous gene, the invention also provides the application of the recombinant pseudorabies virus of porcine reproductive and respiratory syndrome virus gene as vaccine carrier.
The invention also provides a recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene and the gG gene, wherein the recombinant pseudorabies virus is obtained by replacing the TK gene of PRV and replacing the gG gene of PRV by IL-18-IFN-gamma in sequence through a porcine reproductive and respiratory syndrome virus GP3-GP5-M fusion fragment.
Preferably, the method for constructing the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene and the gG gene comprises the following steps:
(1) constructing a TK intermediate transfer vector for replacing the TK gene position of PRV, wherein the TK intermediate transfer vector is obtained by a pBR322 vector, a target gene GP3-GP5-M fusion fragment, a promoter and a resistance gene with a loxP site through line recombination by a Red/ET homologous recombination technology, and two ends of the TK intermediate transfer vector after the line recombination are provided with homologous arms capable of performing line loop recombination with the TK position gene of PRV;
(2) enzyme cutting TK intermediate transfer vector to obtain linear fragment with target gene GP3-GP5-M fusion fragment, promoter and loxP action site;
(3) performing loop recombination on the linear fragment obtained in the step (2) and pBeloBAC11-Bartha-K61 infectious clone by a Red/ET homologous recombination technology, and inducing the expression of Cre recombinase to eliminate resistance by using a Cre/loxP site specific recombination system to obtain a recombinant plasmid for replacing the TK gene position of PRV;
(4) constructing a gG intermediate transfer vector for replacing the gG gene position of PRV, wherein the gG intermediate transfer vector is obtained by a pBR322 vector, a target gene IL-18-IFN-gamma fragment and a resistance gene with a loxP site through line recombination by a Red/ET homologous recombination technology, and two ends of the gG intermediate transfer vector after the line recombination are provided with homologous arms capable of performing line loop recombination with the gG position gene of PRV;
(5) digesting the gG intermediate transfer vector to obtain a linear fragment with a target gene IL-18-IFN-gamma fragment and a loxP action site;
(6) and (3) performing loop recombination on the linear fragment obtained in the step (5) and the recombinant plasmid obtained in the step (3) and replacing the PRV TK gene position through a Red/ET homologous recombination technology, inducing the expression of a Cre recombinase to eliminate resistance by using a Cre/loxP site specific recombination system, and finally obtaining the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the PRV TK gene position and the gG gene position.
As a specific embodiment, the construction method of the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene and the gG gene comprises the following steps:
S1-S3: as above, omitted;
s4, by SEQ ID NO: 34-43 to obtain a pBR322 vector pBR 322-spread-gG with homologous arms at two ends, a target gene IL-18-IFN-gamma fragment and a resistance gene fragment with a loxP site, performing linear recombination in an escherichia coli GB05-dir competence by a Red/ET homologous recombination technology to respectively obtain a homologous arm intermediate transfer vector pBR 322-spread-gG-IL-18-gamma-loxP-kan with homologous arms at two ends capable of performing linear recombination with a PRV gG position gene;
s5, performing enzyme digestion through a preset enzyme digestion site to obtain a linear fragment with a target gene IL-18-IFN-gamma fragment and a loxP action site;
s6, performing loop recombination on the linear fragment of S5 and the recombinant plasmid obtained from S3 in Escherichia coli GB05-Red competence by Red/ET homologous recombination technology, inducing expression of Cre recombinase to eliminate resistance by using Cre/loxP site-specific recombination system, and finally obtaining infectious clones pBeloBAC 11-Bartha-K61-delta TK/ori-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-delta TK/CMV-RRSV-GP 3-GP 2-M-delta gG/IL-18-gamma, pBeloBAC NA 11-Bartha-K61-delta TK/CAGGS-HPPSV-GP 3-GP 8-M-delta gG/IL-18-gamma, pBeloBAC NAK 5966-Bartha-61-K6327-M-delta gG 30-delta G-18-gamma, and pBeloBAC-LRSV-GP-9-GP 30-9-delta G-gamma, respectively GP 5-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-delta TK/CMV-NADC30-like-GP3-GP 5-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-NADC30-like-GP3-GP 5-M-delta gG/IL-18-gamma.
Infectious clones of the recombinant virus prepared as described above pBeloBAC 11-Bartha-K61-delta TK/ori-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-delta TK/CMV-HPPRRSV-GP3-GP 23-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K8-delta TK/CAGGS-HPPRRSV-GP3-GP 6342-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-TK/ori-NADC 84-LIDC-GP 3-GP 5-M-gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-CMV-5-NADC 375857323-GP-24-GP-M-delta-gamma, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-NADC30-like-GP3-GP 5-M-delta gG/IL-18-gamma is transfected to Vero cells through liposome, and then passage is carried out on PK-15 cells to obtain 6 recombinant viruses; the proliferation characteristics, gene transcription level, genetic stability and the like of the rescued 6 recombinant viruses on PK-15 cells were analyzed. The virus growth curve measurement result shows that the overall growth trend is consistent and no significant difference exists (p is more than 0.05) compared with the vaccine strain (Bartha-K61) and the rescued virus (rBartha-K61). The gene transcription level results show that the expression quantity of the exogenous genes of the six recombinant viruses on the mRNA level is continuously improved along with the infection time, and the expression quantity tends to be stable after reaching the peak value, and the exogenous protein IL-18 can be expressed.
Therefore, the recombinant pseudorabies virus replacing the TK gene and the gG gene of the porcine reproductive and respiratory syndrome virus gene can be used as a genetic engineering vaccine or an immunogen for preparing a specific antibody, and the specific antibody can be used for treating the infection of the porcine reproductive and respiratory syndrome virus and the porcine pseudorabies virus; can also prevent the infection of porcine reproductive and respiratory syndrome virus and porcine pseudorabies virus; other diseases directly caused by porcine reproductive and respiratory syndrome virus and porcine pseudorabies virus infection can also be prevented or treated.
The invention therefore likewise provides a vaccine (generally a viral live vector vaccine) comprising a recombinant pseudorabies virus replacing the TK gene and the gG gene in the porcine reproductive and respiratory syndrome virus gene.
The invention also provides a specific antibody prepared by taking the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene and the gG gene as an immunogen.
The invention also provides a medicine of the specific antibody prepared by taking the recombinant pseudorabies virus of the porcine reproductive and respiratory syndrome virus gene replacing the TK gene and the gG gene as immunogen.
Because PRV has many regions for inserting exogenous gene, the invention also provides the application of the recombinant pseudorabies virus of porcine reproductive and respiratory syndrome virus gene as vaccine carrier replacing TK gene and gG gene.
Conventional recombinant viruses generally have only 1 to 2 foreign gene fragments inserted into the viral vector, and rarely have more than 2 foreign gene fragments inserted into the viral vector because: a. the size and the number of the inserted exogenous gene fragments are related to the capacity of the vector, the capacity of the general vector is limited, and when the number of the inserted exogenous gene fragments is large, the vector is easy to be unstable; b. the insertion of a plurality of exogenous genes can obviously influence the expression quantity of the exogenous genes; the invention selects PRV virus as the carrier of the exogenous gene because the PRV virus carrier has larger capacity and theoretically allows the insertion of a plurality of exogenous gene segments, but in order to ensure that three exogenous genes can be successfully inserted into the PRV virus carrier and can be successfully expressed, at least the following difficulties are required to be overcome: (1) because the variety of the inserted exogenous genes is more, different spacer sequences are screened through experiments aiming at the difference of a specifically constructed recombinant virus, the exogenous genes to be inserted and selected plasmids or vectors, the used spacer sequences ensure that the three exogenous genes GP3, GP5 and M can form a fusion fragment, IL-18 and gamma interferon form a fusion fragment, and the recombinant virus can respectively express the product (such as protein) of each exogenous gene by introducing a proper enzyme cutting site; the present invention introduces a spacer 2A ribosome skip sequence (P2A ribosomal skipping sequence), commonly used 2A ribosome skip sequences are derived from porcine Teschovirus-1(P2A), foot and mouth disease virus (F2A), Thosea asigna virus (T2A) and equine rhinitis A virus (E2A). All short 18-22 AA peptides mediate ribosome skipping between the c-terminal glycine and proline, resulting in isolated polypeptides. The invention mainly uses P2A and T2A sequences, introduces P2A sequence between IL-18 and gamma interferon, introduces P2A sequence between GP3 and GP5, introduces T2A sequence between GP5 and M gene. The P2A/T2A sequences are publicly known at the amino acid level, and the amino acids are converted into different DNA sequences by software, and the DNA sequences of three sequences are inconsistent, so that the repeated sequences are avoided in the vector construction process. (2) Selection of foreign gene insertion site: the early-stage research finds that the insertion site of the exogenous gene obviously influences the expression efficiency of the exogenous gene, and the exogenous gene can be effectively expressed through the selected insertion site after a plurality of experiments are designed, so that the exogenous gene is verified by a fluorescence report gene; (3) because 3 exogenous gene fragments are inserted into a virus vector at the same time, the conventional gene recombination method needs to be subjected to multiple enzyme digestion connection, the sequencing of a product obtained by the conventional gene recombination method is difficult, and in addition, because the pBeloBAC11 vector is too large, if homologous arms of the virus are directly loaded at two ends of the pBeloBAC11 vector through PCR amplification, mutation is easily caused, so that the invention firstly constructs a pBR322 intermediate transfer vector, facilitates the sequencing of the homologous arms, and simultaneously improves the recombination rate so as to facilitate the insertion of the exogenous genes and the sequencing verification of the product.
Compared with the prior art, the invention has the following beneficial effects:
the recombinant plasmid constructed by the invention carries out replacement modification on TK and gG genes on pBeloBAC11-Bartha-K61 infectious clone in sequence. The TK gene is replaced by the GP3-GP5-M gene with three different promoters (TK original promoter ori, CMV promoter and CAGGS promoter) HPPRRSV or a strain similar to NADC30, and then the gG gene is replaced by IL-18-IFN-gamma, so that the recombinant virus which is further attenuated and expresses three antigen genes and two immunologic adjuvant factors is successfully obtained. The invention successfully constructs 6 recombinant pseudorabies virus infectious clones expressing GP3-GP5-M gene of PRRSV by taking IL-18 and IFN-gamma as immune adjuvants, and the GP3-GP5-M gene and the IL-18-IFN-gamma recombinant pseudorabies virus of the chimeric PRRSV can generate stable lesion after continuous passage for at least 15 generations on PK-15 cells, and stably expresses the recombinant pseudorabies virus of an exogenous gene, thereby showing that the 6 recombinant viruses have good genetic stability and in vitro replication capacity.
Detailed Description
The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.
The test methods used in the following experimental examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Example 1 construction of pBR322 intermediate transfer vector that can replace the TK Gene location on the PRV genome
The principle of primer design: when designing primers, XhoI restriction sites are preset at two ends of a target insertion gene of a vector pBR322, homology arms are designed among amplification primer sequences, the primers are overlapped by 30-60 bp, and the primers are shown in Table 1 and synthesized by Shanghai Productivity engineering Co., Ltd.
TABLE 1 pBR322 vector Linear fragment amplification primers
PCR amplification procedure: 4min at 94 ℃; setting 32 cycles at 98 ℃ for 15s, 55 ℃ for 5s and 72 ℃ for 1 min; extending for 10min at 72 ℃, and storing at 4 ℃.
The PCR amplification reaction system is as follows: PrimeSTAR Max DNA Polymearse 25. mu.L, upstream and downstream primers (10 pmol/. mu.L) each 0.5. mu.L, template 1. mu.L, plus ddH2The content of O is filled to 50 mu L.
1. Preparation of fusion fragment of GP3-GP5-M Gene
Respectively taking cDNA of HPPRRSV and like NADC30 strains as templates, designing primers, obtaining GP3, GP5 and M gene fragments through PCR amplification, and recovering linear fragments from gel for later use after gel electrophoresis.
Firstly, GP3 and GP5 gel recovery fragments are taken as templates, PCR amplification is carried out to obtain GP3-GP5 fusion fragments, the gel recovery fragments and the M gene gel recovery fragments are taken as templates after the gel recovery, primers are designed, secondary fusion PCR is carried out to obtain the GP3-GP5-M gene fusion fragments (respectively marked as HPPRRSV-GP3-GP5-M and PRRSV-NADC30-like-GP3-GP5-M) of PRRSV and NADC30 strains, and the gel is recovered for standby.
2. preparation of pBR 322-spark-CMV-amp-ccdB-BGH-loxP-gene
And performing PCR amplification to obtain linear fragments of pBR 322-spot, CMV promoter, amp-ccdB and loxP action site, wherein the two ends of the linear fragments are provided with homologous arms. Then, after T4 ligase treatment, the strain is electrically transformed into Escherichia coli GB05-dir competence for recombination.
3. preparation of pBR 322-spot-CAGGS-amp-ccdB-BGH-loxP-gene
The gene recombination process is similar to the preparation of step 2pBR 322-spot-CMV-amp-ccdB-BGH-loxP-gene, except that: the promoter fragments are not identical, and the CAGGS promoter fragment is obtained by enzyme digestion of pCAGGS-cm-ccdB (the CAGGS promoter fragment can also be obtained by enzyme digestion of pCAGGS-Cre-IRES-puro).
4. Preparation of other Linear fragments
Primers (shown in Table 1) were designed, and a linear fragment was obtained by PCR amplification using pBR 322-spot-CMV-amp-ccdB-BGH-loxP-gene prepared in step 2 as a template: pBR 322-spot, CMV-loxP-gene; and then taking the pBR 322-spectrum-CAGGS-amp-ccdB-BGH-loxP-genta prepared in the step 3 as a template, and removing amp-ccdB by preset BamHI enzyme digestion to obtain a linear fragment: pBR 322-spot-CAGGS-loxP-gene; and then taking the pBR 322-spot-CMV-amp-ccdB-BGH-loxP-gene prepared in the step 2 as a template, and obtaining a linear fragment through PCR amplification: pBR 322-spot, ori-loxP-gene; all the linear fragments obtained above were recovered by gel recovery for use.
And (3) recovering an amplification product from the gel: each PCR product was electrophoresed on a 1% agarose gel, and the voltage and time on the electrophoresis apparatus were set to 125V for 30min, respectively. After the electrophoresis was completed, the gel was carefully excised from the band of the target fragment under the irradiation of an ultraviolet lamp of a gel imager, and placed in a sterilized 2mL EP tube, and the DNA fragment was recovered according to the instructions of the gel recovery kit (TIANGEN, DP 214-03).
A schematic diagram of the construction of the pBR322 intermediate transfer vector described above, which can replace the TK gene location on the PRV genome, is shown in FIG. 1.
5. Preparation of pBR322 intermediate transfer vector capable of replacing TK gene position on PRV genome
(1)pBR322-spect-TK-ori-HPPRRSV-GP3-GP5-M-loxP-genta
pBR 322-spectrum-TK-ori-HPP-RRSV-GP 3-GP 5-M-loxP-gene is obtained by recombining fragments pBR 322-spectrum, ori-loxP-gene, GP3, GP5 and M of HPPRRSV in E.coli GB05-dir competence by using a primer group (respectively comprising primers HGP3-R, HGP5-L, HGP5-R, HM-L, ori-HGP3-F, ori-HM-R, pBR 322-spectrum-F, pBR 322-spectrum-R, ori-loxP-genta-F, loxP-genta-R) in Table 1, and homologous arms are arranged at two ends of each fragment after amplification.
(2)pBR322-spect-TK-ori-NADC30-like-GP3-GP5-M-loxP-genta
The pBR 322-spectrum-TK-ori-NADC 30-like-GP3-GP 5-M-loxP-gene is obtained by recombining fragments pBR 322-spectrum, ori-loxP-gene, GP3, GP5 and M similar to NADC30 in E.coli GB05-dir competence by using a primer group (respectively comprising primers LGP3-R, LGP5-L, LGP5-R, LM-L, ori-LGP3-F, ori-LM-R, pBR 322-spectrum-F, pBR322-sepct-R, ori-loxP-gene-F, loxP-gene) in Table 1, and homologous arms are arranged at two ends of each fragment after amplification.
(3)pBR322-spect-TK-CMV-HPPRRSV-GP3-GP5-M-loxP-genta
The fragments pBR 322-spectrum, CMV-loxP-gene and GP3, GP5 and M of the HPPRRRSV are amplified by using the primer group in the table 1 (respectively comprising the primers HGP3-R, HGP5-L, HGP5-R, HM-L, CMV-F, CMV-R, CMV-HGP3-F, CMV-HM-R, CMV-loxP-gene-F, loxP-gene-R, pBR 322-spectrum-F, pBR 322-spectrum-R), the fragments are recombined in an E.coli GB05-dir competence to obtain pBR 322-spectrum-TK-CMV-RRSV-GP 3-GP 5-M-loxP-gene, and both ends of each fragment after amplification have homologous arms.
(4)pBR322-spect-TK-CMV-NADC30-like-GP3-GP5-M-loxP-genta
The fragments pBR322-spect, CMV-loxP-genta, GP3, GP5 and M similar to the NADC30 are amplified by using the primer group in the table 1 (respectively comprising the primers LGP3-R, LGP5-L, LGP5-R, LM-L, CMV-F, CMV-R, CMV-LGP3-F, CMV-LM-R, CMV-loxP-genta-F, loxP-genta-R, pBR322-spect-F, pBR322-spect-R), and pBR322-spect, CMV-loxP-genta and GP3, GP5 and M similar to the NADC30 are recombined in E.coli GB05-dir competence to obtain pBR322-spect-TK-CMV-NADC30-like-GP3-GP5-M-loxP-genta, and both ends of each amplified fragment have homologous arms.
(5)pBR322-spect-TK-CAGGS-HPPRRSV-GP3-GP5-M-loxP-genta
By using the primer group in Table 1 (respectively comprising the primers HGP3-R, HGP5-L, HGP5-R, HM-L, CAGGS-HGP3-F, CAGGS-HM-R), GP3, GP5 and M of the fragment HPPRRSV are amplified to obtain a fusion fragment HPPRRSV-GP3-GP5-M, and the fusion fragment is recombined with the glue recovery fragment pBR 322-spread-CAGGS-amp-ccdB-BGH-loxP-genta obtained by cutting pBR 322-spread-CAGGS-loxP-genta with BamHI in E.coli GB05-dir competence to obtain pBR 322-spread-TK-CAGGS-RRSV-3-GP 5-M-loxP-genta, and both ends of each amplified fragment are provided with homologous arms.
(6)pBR322-spect-TK-CAGGS-NADC30-like-GP3-GP5-M-loxP-genta
By using the primer group in Table 1 (respectively comprising the primers LGP3-R, LGP5-L, LGP5-R, LM-L, CAGGS-LGP3-F, CAGGS-LM-R), GP3, GP5 and M of the fragment type NADC30 are amplified to obtain a fusion fragment PRRSV-NADC30-like-GP3-GP5-M, and the fusion fragment pBR 322-select-CAGGS-amp-ccdB-BGH-loxP-genta is recombined with the glue recovery fragment pBR 322-select-CAGGS-loxP-genta obtained by BamHI enzyme digestion of pBR 322-select-CAGGS-amp-BGH-loxP-genta in E.coli GB05-dir competence to obtain pBR 322-select-TK-CAGGS-NADC 30-like-GP3-GP5-M-loxP-genta, and both ends of each amplified fragment have homologous arms.
(7) The preparation process of the intermediate carrier comprises the following steps:
a. and (3) carrying out ligation treatment on each linear fragment obtained by recovering the gel by using T4 ligase, wherein the PCR program comprises the following steps: 20min at 25 ℃; 20min at 75 ℃; 30min at 50 ℃; storing at 4 ℃. And (3) PCR system: 0.13. mu.L of T4 ligase, 2.12. mu.L of T4 Buffer, 200ng of each linear fragment, ddH2The content of O is filled to 20 mu L. After T4 ligase treatment, enabling the PCR product to pass through a desalting membrane for desalting for 30 min;
b. coli GB05-dir competence was prepared simultaneously. Single colonies were picked from the plate in 1.5mL centrifuge tubes containing 1mL LB medium overnight at 30 ℃ at 950 rpm. Transfer the well-expanded 50. mu.L of the bacterial liquid into a 1.5mL centrifuge tube containing 1.3mL LB medium, and expand at 30 ℃ for 2h at 950 rpm. Adding 35 μ L-Arabinaose to induce expression of recombinase, and shaking at 950rpm at 30 deg.C for 40 min; the cells were collected by centrifugation at 9500rpm for 1min and 1mL of ddH2Centrifuging at O9600 rpm for 1min, and removing the supernatant; 1mL ddH2And centrifuging at O9700 rpm for 1min, and discarding the waste liquid to obtain the required thallus.
c. And adding the desalted PCR product into the thallus, blowing and beating uniformly, adding the thallus into a treated electric rotating cup, and carrying out electric rotation at 1350V. Adding 1mL of LB culture medium into the electric rotating cup, gently blowing and beating uniformly, transferring to a new 1.5mL centrifuge tube, and recovering for 1h at 30 ℃ and 950 rpm. The cells were then centrifuged in a centrifuge at 10000rpm for 1min, the supernatant was discarded, the cells were resuspended, streaked and plated on spec and genta resistant LB plates. And (3) placing the mixture in an incubator at 30 ℃ for 1h with the front side facing upwards, turning the plate, and culturing for 14-16 h overnight. Single colonies from the above plates were picked and cultured overnight at 30 ℃ and 950rpm in 1.7mL of 2mL EP tubes containing the spectrum and genta resistant LB medium. The plasmid was extracted by performing the operations according to the instructions of the small extract plasmid of TIANGEN kit. Performing enzyme digestion at 37 ℃ for 2h, performing gel electrophoresis detection, wherein the enzyme digestion identification result is shown in figure 3, recovering the required linear fragment from the gel, and storing at-20 ℃ for later use.
FIG. 2 shows PCR amplification of various linear fragments of the pBR322 intermediate transfer vector with PRV TK homology arm, and FIG. 3 shows XhoI cleavage of the pBR322 vector with PRV TK homology arm.
Example 2 construction of recombinant plasmid substituting for TK position
1. Preparation of Escherichia coli GB05-red competence
Escherichia coli GB05-red was inoculated in 1mL of LB medium and cultured overnight at 30 ℃ and 950 rpm. The next day, the cells were transferred to a new 1.5mL EP tube containing 1.3mL LB medium and shaken at 950rpm for 2h at 30 ℃. The cells were collected by centrifugation at 9500rpm for 1min and 1mL of ddH2Centrifuging at O9600 rpm for 1min, and removing the supernatant; 1mL ddH2Centrifuging at O9700 rpm for 1min, and discarding the waste liquid to obtain the prepared competence.
2. plasmid pBeloBAC11-Bartha-K61 was retransformed into E.coli GB05-red competent
a. Construction of plasmid pBeloBAC11-Bartha-K61
When the recombinant virus vector is constructed, firstly extracting the whole genome of PRV Bartha-K61, then taking the sequences at the two ends of the whole virus genome as the left and right homology arms, loading the virus homology arms to the two ends of pBR322-amp-ccdB through PCR amplification, and similarly, selecting the sequences at the two ends of the pBeloBAC11 vector as the homology arms, designing a second pair of primers, and loading the BAC homology arms to a pBR322-amp-ccdB linear fragment by utilizing PCR amplification. The pBR322-amp-ccdB and a pBeloBAC11 linear fragment are firstly subjected to linear homologous recombination in escherichia coli GBdir-gyrA462 competence to obtain a pBeloBAC11-cm-BR322-amp-ccdB recombinant plasmid, the plasmid is subjected to enzyme digestion through a reserved BamHI enzyme digestion site, and a pBeloBAC11 linear fragment with a PRV homologous arm is recovered.
Then, the pBeloBAC11 linear fragment with PRV homology arm and PRV Bartha-K61 complete genome are subjected to homologous recombination in Escherichia coli GBdir-gyrA462 competence to obtain pBeloBAC11-Bartha-K61 recombinant plasmid. The specific procedure is shown in FIG. 4, and the primers used are shown in Table 2 (the primers were synthesized by Beijing Huada Gene Co.).
The PCR program was set up as: 5min at 95 ℃; setting 32 cycles at 95 ℃ for 30s, 55 ℃ for 30 and 72 ℃ for 1 min; 10min at 72 ℃. In this study, an intermediate transfer vector was constructed with the aid of the pBR322-amp-ccdB-rpsLneo plasmid. To obtain PRV-BAC infectious clones, first a pBR322-amp-ccdB linear fragment with the pBeloBAC11 homology arm and the PRV homology arm was constructed. We firstly need to design two pairs of primers with homologous arms, load the homologous arm of BAC and the homologous arm of PRV at two ends of pBR322-amp-ccdB linear fragment, besides, design the restriction enzyme site of BanHI in the primer for amplifying the homologous arm, so as to remove the intermediate transfer vector pBR322-amp-ccdB by subsequent enzyme cutting. PCR amplification was performed using pBR322-amp-ccdB fragment as template. Two pairs of PCR amplification primers shown in the table were designed based on the plasmid sequence pBR322-amp-ccdB-rpsLneo, the vector sequence BAC, the sequence PRV Bartha-K61, and the digestion site of BamHI.
TABLE 2
b. 200ng of pBeloBAC11-Bartha-K61 plasmid was added to the cells, gently blown and beaten, mixed well, transferred to an electric cuvette, and subjected to 1350V electric transfer. Resuscitating at 30 deg.C under 950rpm for 1h, centrifuging at 10000rpm for 1min, discarding supernatant, and resuspending thallus. 50 μ L of resuspended broth was streaked and spread on cm-resistant LB plates. After being placed in an incubator at 30 ℃ for 1 hour with the front side facing upward, the cells were inverted and cultured overnight. Picking single colony, extracting plasmid, and enzyme digestion verification.
3. Gene replacement modification of TK position
The correct single clone was verified by digestion in the previous step of overnight culture, and was shaken at 950rpm for 2h at 30 ℃. After 35. mu. L L-Arabidopsis was added and induced for 40min, the cells were collected by centrifugation and washed. 200ng of the linear fragment gel recovery products of the 6 intermediate transfer vectors prepared in example 1 were added, respectively, and after 1350V electrotransfer, the cells were thawed at 30 ℃ and 950rpm for 1 hour, collected and resuspended, spread on a cm + genta-resistant LB plate, and cultured overnight at 30 ℃. Picking single colony, extracting plasmid, enzyme digestion and PCR.
PCR procedure: 4min at 94 ℃; setting 32 cycles at 98 ℃ for 15s, 60 ℃ for 15s and 72 ℃ for 3 min; extending for 10min at 72 ℃, and storing at 4 ℃. And (3) PCR system: PrimeSTAR HS DNA 0.5. mu.L, PrimeSTAR GC Buffer 25. mu.L, dNTP Mix 4. mu.L, upstream and downstream primers (10 pmol/. mu.L) each 0.5. mu.L (Table 3), template 1. mu.L, ddH2The content of O is filled to 50 mu L.
TABLE 3 PCR verification primers for recombinant plasmid replacing TK gene
Primer name
|
Primer sequence (5 '-3')
|
TK-L(SEQ ID NO.32)
|
TTGACTTCAAAGGCCAGGGTCAAG
|
TK-R(SEQ ID NO.33)
|
GAGCTGGAAGACGAACCACGC |
4. The recombinant plasmid is re-transformed into pSC101-BAD-Cre-tet in E.coli GB2005
Cre/loxP site-specific recombination: the correct clones with the target gene and specific sites were amplified overnight, cultured overnight at 30 ℃ 950rpm, and then transferred to a new 1.5mL EP tube for 2h amplification at 30 ℃ 950 rpm. To this, 35. mu.L of L-Arabidopsis was added to induce Cre expression, followed by induction at 30 ℃ for 1 hour. The cells were collected by centrifugation, resuspended in 50. mu.L and plated on cm-resistant plates and cultured overnight at 37 ℃. Selecting single colony small extracted plasmid, enzyme digestion and PCR verification, sequencing to obtain 6 recombinant plasmids, respectively pBeloBAC 11-Bartha-K61-delta TK/ori-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CMV-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/ori-NADC 30-liGP 3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CMV-NADC30-like-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-NADC30-like-GP 3-5-M. The restriction enzyme analysis and PCR amplification map of the recombinant plasmid with the TK gene replaced are shown in FIGS. 5 and 6.
A schematic diagram of the construction of the recombinant plasmid with the TK position replaced is shown in FIG. 7.
Example 3 replacement modification of the gG Gene
Construction of first, intermediate vectors
1. Amplification of Linear fragments
a. pBR 322-spot-CMV-amp-ccdB-loxP-kan template
And performing PCR amplification to obtain linear fragments of pBR 322-spot, CMV promoter, amp-ccdB and loxP action site, wherein the two ends of the linear fragments are provided with homologous arms. Then, after T4 ligase treatment, the strain is electrically transformed into Escherichia coli GB05-dir competence for recombination.
b. The primers given in Table 4 are used, firstly, the plasmid p15A-cm-IL-18 is used as a template to obtain an IL-18 fragment through amplification, the plasmid p 15A-cm-IFN-gamma is used as a template to obtain an IFN-gamma fragment through amplification, and then the IL-18-IFN-gamma linear fragment is obtained through fusion PCR amplification; then pBR 322-spark-CMV-amp-ccdB-loxP-kan is used as a template to amplify to obtain a pBR 322-spark-gG vector fragment and a loxP-kan fragment.
When designing primers, AflII enzyme cutting sites are respectively preset at two ends of a target insertion gene (IL-18-IFN-gamma linear fragment) of a vector pBR 322-select-gG, gG homologous arms are designed among amplification primer sequences, the primers are overlapped by 30-60 bp, and the primers are shown in a table 4 and synthesized by Shanghai Productivity engineering Co., Ltd.
TABLE 4 replacement of gG Gene recombinant plasmid modified primers
PCR amplification procedure: the same as in example 1.
The PCR amplification reaction system is as follows: PrimeSTAR Max DNA Polymearse 25. mu.L, upstream and downstream primers (10 pmol/. mu.L) each 0.5. mu.L, template 1. mu.L, plus ddH2The content of O is filled to 50 mu L.
And (3) recovering an amplification product from the gel: each PCR product was electrophoresed on a 1% agarose gel, and the voltage and time on the electrophoresis apparatus were set to 125V for 30min, respectively. After electrophoresis, carefully cutting off the gel at the band of the target fragment under the irradiation of an ultraviolet lamp of a gel imager, placing the gel in a sterilized 2mL EP tube, and recovering the DNA fragment according to the instructions of a gel recovery kit (TIANGEN, DP 214-03); the results of the PCR amplification are shown in FIG. 8.
2. Preparation of pBR322 intermediate transfer vector capable of replacing gG gene position on PRV genome
pBR 322-spot-gG-IL-18-IFN-. gamma. -loxP-kan: amplifying the fragments pBR 322-select-gG, IL-18-IFN-gamma and loxP-kan by using the primer group in the table 4 to obtain pBR 322-select-gG-IL-18-IFN-gamma-loxP-kan; the cleavage identification map of the intermediate transfer vector is shown in FIG. 9.
The preparation process of the intermediate carrier comprises the following steps: the same as in example 1.
Secondly, constructing a recombinant plasmid which deletes gG gene and inserts IL-18-IFN-gamma target gene
1. Preparation of coli GB05-red competence
The same as in example 2.
2. Recombinant plasmid was retransformed into E.coli GB05-red competent
200ng of each of the 6 recombinant plasmids prepared in example 2 (pBeloBAC 11-Bartha-K61-delta TK/ori-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CMV-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-HPPRRSV-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/ori-NADC30-like-GP3-GP5-M, pBeloBAC 11-Bartha-K61-delta TK/CMV-NADC30-like-GP 3-NAGP 5-M, pBeloBAC 11-Bartha-K61-TK/CAS-DC 30-like-GP3-GP5-M) was added to the cells, and the cells were gently mixed and then transferred to a cuvette, and 1350V electric turns. Resuscitating at 30 deg.C under 950rpm for 1h, centrifuging at 10000rpm for 1min, discarding supernatant, and resuspending thallus. 50 μ L of resuspended broth was streaked and spread on cm-resistant LB plates. After being placed in an incubator at 30 ℃ for 1 hour with the front side facing upward, the cells were inverted and cultured overnight. Picking single colony, extracting plasmid, and enzyme digestion verification.
3. Gene replacement modification at the gG position
The correct single clone was verified by digestion in the previous step of overnight culture, and was shaken at 950rpm for 2h at 30 ℃. After 35. mu. L L-Arabidopsis was added and induced for 40min, the cells were collected by centrifugation and washed. Respectively adding 200ng of the linear fragment gel recovery product of the intermediate transfer vector prepared in the first step, after 1350V electrotransfer, resuscitating at 30 ℃ and 950rpm for 1h, collecting and resuspending the thallus, coating the thallus on a cm + genta resistant LB plate, and culturing overnight at 30 ℃. Picking single colony, extracting plasmid, enzyme digestion and PCR.
PCR procedure: 4min at 94 ℃; setting 32 cycles at 98 ℃ for 15s, 60 ℃ for 15s and 72 ℃ for 3 min; extending for 10min at 72 ℃, and storing at 4 ℃. And (3) PCR system: PrimeSTAR HS DNA 0.5. mu.L, PrimeSTAR GC Buffer 25. mu.L, dNTP Mix 4. mu.L, upstream and downstream primers gG-check-F, gG-check-R (10 pmol/. mu.L) each 0.5. mu.L (Table 4), template 1. mu.L, ddH2The content of O is filled to 50 mu L.
4. The recombinant plasmid is re-transformed into pSC101-BAD-Cre-tet in E.coli GB2005
Cre/loxP site-specific recombination: the correct clones with the target gene and specific sites were amplified overnight, cultured overnight at 30 ℃ 950rpm, and then transferred to a new 1.5mL EP tube for 2h amplification at 30 ℃ 950 rpm. To this, 35. mu.L of L-Arabidopsis was added to induce Cre expression, followed by induction at 30 ℃ for 1 hour. The cells were collected by centrifugation, resuspended in 50. mu.L and plated on cm-resistant plates and cultured overnight at 37 ℃. Picking single colony small-extracted plasmid, enzyme digestion verification and PCR verification, sequencing to obtain 6 recombinant plasmids with gG gene replaced, pBeloBAC 11-Bartha-K61-delta TK/ori-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-delta TK/CMV-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, pBeloBAC 11-Bartha-K61-delta TK/CAGGS-RRSV-GP 3-GP 5-M-gG/IL-18-gamma, NAeloBAC 11-Bartha-K61-TK/ori-DC 30-lipe-GP-5-M-gG-18-gamma, pBeloCMV-NAeloBAC 11-Bartha 61-BP-61-M-gamma, and pBeloCMV-HPPRSV-GP 585738-GP-8-M-delta-K-8-gamma, and pBeloBAC-18-gamma -M- Δ gG/IL-18- γ, pBeloBAC11-Bartha-K61- Δ TK/CAGGS-NADC30-like-GP3-GP5-M- Δ gG/IL-18- γ. The restriction analysis and PCR amplification map of the recombinant plasmid with the gG gene replaced are shown in FIGS. 10 and 11.
A schematic diagram of the construction of the recombinant plasmid with the gG position replaced is shown in FIG. 12.
EXAMPLE 4 viral rescue of recombinant plasmids
1. Plasmid concentration by precipitation: inoculating the constructed recombinant plasmid into 100mL of culture medium, culturing overnight, performing large-scale plasmid extraction, and concentrating the plasmid by phenol-chloroform extraction method.
2. Transfection of recombinant plasmids into Vero cells: after the concentration of the recombinant plasmid was detected,
Lipofectamin 3000 kit (see section)
Reagent from invitogen) were used for transfection assays.
3. Rescued virus subculture: the virus fluid obtained after transfection was subcultured on PK-15 cells. After PK-15 cells are full, removing supernatant, cleaning with DMEM twice, adding virus solution and DMEM culture solution containing 2% serum, shaking uniformly at 37 deg.C and 5% CO2And (3) incubating the culture box for 1h, then removing the supernatant, adding a proper amount of DMEM culture solution containing 2% serum again, receiving the virus 48h after virus inoculation, placing the culture box in a refrigerator at the temperature of minus 80 ℃ for freezing and thawing for three times, collecting the virus liquid, carrying out virus subculture according to the method, and observing the pathological changes of the virus, wherein the generations are sequentially marked as F1, F2, F3 and the like. The recombinant viruses are respectively named as rBartha-K61-delta TK/ori-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, rBartha-K61-delta 0TK/CMV-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, rBartha-K61-delta TK/CAGGS-HPPRRSV-GP3-GP 5-M-delta gG/IL-18-gamma, rBartha-K61-delta TK/ori-NADC30-like-GP3-GP 5-M-delta gG/IL-18-gamma, rBartha-K61-delta TK/CMV-NADC30-like-GP3-GP 5-M-delta G/IL-18-gamma, rBartha-K61-delta TK/CAGGS-NADC30-like-GP3-GP5-M-△gG/IL-18-γ。
4. PCR detection of rescued viruses: after serial passages, stable lesions appeared, cells were rounded, shrunken, and permeable (FIG. 13). And (2) collecting supernatant after repeated freeze thawing, extracting DNA of the recombinant virus by using an AxyPrep body fluid virus DNA/RNA small-amount kit (product of Axygen company), designing a primer for PCR detection, detecting gB, TK and gG genes of PRV, wherein the result is shown in figure 14, A represents the detection result of the gB gene of PRV, the sizes of recombinant virus strips are consistent, and are consistent with the size of unmodified rescue virus, which indicates that the recombinant virus is PRV in the detection of the gB gene. B shows the detection result of TK gene of PRV, wherein different sizes of the bands represent that the promoter inserted at the TK position is different and different from unmodified rescued virus rBartha-K61, which indicates that deletion replacement operation is successfully carried out at the TK position after replacement modification operation is carried out on the TK position gene. The C diagram shows the detection result of the gG gene of the PRV, which indicates that the sizes of the bands of the recombinant viruses are consistent after the gG position gene is replaced and modified, and the gG position gene is successfully replaced and modified unlike unmodified rescued virus rBartha-K61. And meanwhile, detecting gB, gG and TK gene positions of PRV, and indicating that all recombinant viruses are recombinant pseudorabies viruses modified by gG and TK gene replacement. The PCR primer sequences are shown in Table 5, and the PCR products were detected by electrophoresis on a 1% agarose gel.
TABLE 5 primers for PCR detection of rescued viruses
Primer name
|
Primer sequence (5 '-3')
|
TK-1(SEQ ID NO.44)
|
TTGACTTCAAAGGCCAGGGTCAAG
|
TK-2(SEQ ID NO.45)
|
GAGCTGGAAGACGAACCACGC
|
gG-F(SEQ ID NO.46)
|
GTTGACGTTTGATCCCGTCC
|
gG-R(SEQ ID NO.47)
|
GGTGAGTGTATGGGAACC
|
gB-F(SEQ ID NO.48)
|
TCGACGATGCAGTTGACGGAG
|
gB-R(SEQ ID NO.49)
|
GTGCTCTTCAAGGAGAACATCG |
5. Evaluation of rescued virus stability: continuously passaging the rescued virus, continuously passaging the rescued virus on PK-15 cells for 15 generations, observing the pathological change condition of the rescued virus, and identifying whether the target gene stably exists or not by PCR. The results of PCR amplification are shown in FIG. 15, and it can be seen from FIG. 15 that: lanes 1-8 represent the detection of the gG position of PRV, and it can be seen that the recombinant viruses all have the same band and are different from rBartha-K61, indicating that the inserted exogenous gene IL-18-gamma can stably exist at the gG position. Lanes 9-16 represent the detection of TK position of PRV, which shows that the sizes of the recombinant virus bands are different from those of rBartha-K61, indicating that GP3-GP5-M genes of different promoters can stably exist at the TK position. And simultaneously detecting the TK and gG gene positions, and indicating that each inserted exogenous gene can stably exist in the recombinant pseudorabies virus.
Example 5 rescued Virus titer assay and growth Curve plotting
Pre-plating PK-15 cells, and after a 96-well plate is full of PK-15 monolayer cells, respectively carrying out 10 times of recombinant viruses-1~10-10Ten times the gradient dilution, respectively inoculating to 9In 6-well cell culture plates, 8 wells were inoculated per dilution, the last two columns were not inoculated as a blank, placed at 37 ℃ with 5% CO2Culturing in cell culture box, observing cytopathic condition for 7 days, and calculating TCID of virus according to Reed-Muench method50。
A twelve-well plate full of PK-15 cells is inoculated with a dose of 0.1MOI, after 1h of incubation, the culture solution is changed into 2% DMEM culture solution, 200 mu L of cell supernatant is collected at different time points (0, 3, 6, 9, 12, 24, 36, 48 and 60h) after inoculation, virus DNA is extracted, and the virus copy number of each time period is respectively measured by a fluorescence quantitative method and is drawn into a curve.
The detection gene is gB, the primer sequence is gB-F-qpcr (SEQ ID NO.50): 5'-TCGAAGGCGGTCACCTTGT-3'; gB-R-qpcr (SEQ ID NO.51): 5'-GGCCATCACGAACCGCTT-3'. The fluorescent quantitative system is as follows: 2 XChamQ Universal SYBR qPCR Master Mix 10. mu.L, upstream and downstream primers (10. mu.M) each 0.4. mu.L, template 1. mu.L, RNase A-Free ddH2The content of O is filled to 20 mu L. As shown in FIG. 16, the recombinant viruses have growth kinetic curves similar to those of vaccine strains Bartha and rescued viruses rBartha-K61, reach peak values at 36h or 48h, and then tend to be stable, the overall growth trend is consistent, and no significant difference exists, which indicates that the recombinant viruses rescued by the invention have virus virulence and infection sustaining capability similar to those of the commonly used vaccine strains Bartha and rescued viruses rBartha-K61.
Example 6 fluorescent quantitation method for detecting transcript level of Gene of interest
Pre-plating PK-15 cells, after a twelve-well plate is full of PK-15 monolayer cells, respectively inoculating six recombinant viruses, rBartha-K61 and Bartha-K61 into the twelve-well plate at a dose of 0.1MOI, and simultaneously setting a blank group. Adsorbing for 1h, changing into 2mL of 2% DMEM culture solution, collecting twelve-well plates in 0, 3, 6, 9, 12, 18, 24, 36 and 42h respectively, discarding cell sap supernatant, adding 1mL of TRIzol to adherent cells to lyse the cells, extracting RNA of cells of the treated group and the control group according to instructions after collection, and storing in a refrigerator at-80 ℃ for later use. According to PrimeScriptTMThe RT reagent Kit with gDNA Eraser (Takara) instructions reverse transcribe the extracted RNA for fluorescent quantitationThe fluorescence quantification procedure was: 30s at 95 ℃, 5s at 95 ℃, 30s at 55 ℃ and 40 cycles; after the qPCR reaction program, heating to 95 ℃ for reaction for 10s, then cooling to 65 ℃, and starting to increase to 95 ℃ at 0.5 ℃/s to detect a fluorescence signal so as to obtain a melting curve of an amplification product. By use of 2-△△CTThe relative expression quantity of IL-18 at the gG position is calculated by a formula, and the transcription levels of the gamma gene at the gG position and the GP3-GP5-M gene at the TK position are quantitatively detected by absolute fluorescence. The fluorescence quantitative primers are shown in Table 6.
TABLE 6 fluorescent quantitative detection primers
Primer name
|
Primer sequence (5 '-3')
|
IL-18-F-qpcr(SEQ ID NO.52)
|
ATAGCCTCACTAGAGGTCTG
|
IL-18-R-qpcr(SEQ ID NO.53)
|
CCAGGAACACTTCTCTGAAAG
|
gamma-F-qpcr(SEQ ID NO.54)
|
TCAAAGATAACCAGGCCATTCA
|
gamma-R-qpcr(SEQ ID NO.55)
|
CGCTGGATCTGCAGATTATCT
|
TK-qpcr(SEQ ID NO.56)
|
TCAACGCCAGCAACAACACCA
|
TK-qpcr(SEQ ID NO.57)
|
ATAACGAAAGTCTCCACTGCC |
The results are shown in FIG. 17, relative to Mock, vaccine strain Bartha-K61 and rescue virus rBartha-K61, the relative expression level of IL-18 in the six recombinant viruses is significantly higher than that in the three groups, and is continuously improved along with the increase of infection time; as shown in fig. 18, the transcription level of the objective gene γ was continuously increased with the increase of the infection time; as shown in FIG. 19, when the transcription level of the target gene GP3-GP5-M of the recombinant virus replacing the TK gene is detected, the transcription level is continuously increased along with the increase of the infection time and becomes gentle after reaching the peak value, which indicates that: the recombinant virus carrying the target gene GP3-GP5-M has the capability of continuously and stably expressing the target protein, so that the recombinant virus has continuous immunogenicity, and the copy number of the GP3-GP5-M gene inserted into an HPPRRSV strain is lower than that of an NADC30-like strain.
Example 7 WB assay for the Virus rescue protein of interest
Inoculating the rescued virus, Bartha-K61 virus and rBartha-K61 virus into a six-hole plate full of a monolayer PK-15 cell at 0.1MOI, adsorbing the six-hole plate for 1h, changing the adsorbed virus into a culture solution of 2% DMEM, collecting the six-hole plate after 24h, discarding the supernatant, washing the six-hole plate for 2 times by PBS, adding RIPA lysine Buffer (CWBIO) of 1% PMSF, cracking for 10min, centrifuging for 20min at 4 ℃, adding 5x SDS Buffer, and boiling for 10min to obtain the total cell protein.
Gel separation and gel concentration were performed by SDS-PAGE according to the instructions of the protein gel kit. Adding equal amount of each sample protein solution into the protein gel, and finishing electrophoresis after 80V 30min and 120V 1 h. Adding the pre-cooled transfer liquid into an electrophoresis tank, cutting a PVDF membrane according to the size of target protein, activating the PVDF membrane by using methanol, setting a constant current of 220mA, transferring for 1h, and placing in a rapid closed liquid chamber for temperature sealing for 30min after the transfer is finished. Diluting the primary antibody at a ratio of 1:1000, and incubating for 1h at room temperature; then washed 3 times with TBST and shaken well on a shaker for 10min each time. The secondary antibody was diluted with a ratio of 1:10000, incubated at room temperature for 1h, and washed 3 times with TBST, 10min each time. And (3) putting the film into an exposure instrument, dripping chemiluminescence liquid on the film, and adjusting instrument parameters for exposure.
The results are shown in fig. 20, and it can be seen from fig. 20 that: compared with a blank group Mock, a vaccine strain Bartha-K61 and a rescue virus rBartha-K61, the six recombinant viruses can express the foreign protein IL-18 on the protein level, which shows that the recombinant viruses carrying the target gene GP3-GP5-M have the capability of expressing the foreign protein and have immunogenicity.
Sequence listing
<110> southern China university of agriculture
SHANDONG University
<120> recombinant pseudorabies virus for expressing GP3/GP5/M gene of porcine reproductive and respiratory syndrome virus, construction method and application
<130> ZM201225I
<141> 2020-07-07
<160> 57
<170> SIPOSequenceListing 1.0
<210> 1
<211> 88
<212> DNA
<213> virus
<400> 1
aggtccaggg ttctcctcca cgtctccagc ctgcttcagc aggctgaagt tagtagctcc 60
gcttccccgc cgtgcgacat tgaggaac 88
<210> 2
<211> 59
<212> DNA
<213> virus
<400> 2
ctgaagcagg ctggagacgt ggaggagaac cctggaccta tgttggggag atgcttgac 59
<210> 3
<211> 79
<212> DNA
<213> virus
<400> 3
gggcccggga ttttcctcca cgtccccgca tgttagaaga cttcccctgc cctcggctct 60
tggacaaccc cattgttcc 79
<210> 4
<211> 60
<212> DNA
<213> virus
<400> 4
cttctaacat gcggggacgt ggaggaaaat cccgggccca tggggttgtc catagacgac 60
<210> 5
<211> 84
<212> DNA
<213> virus
<400> 5
aggtccaggg ttctcctcca cgtctccagc ctgcttcagc aggctgaagt tagtagctcc 60
gcttcctcgc cgtgcggcac tgag 84
<210> 6
<211> 60
<212> DNA
<213> virus
<400> 6
gctgaagcag gctggagacg tggaggagaa ccctggacct atgttgggga agtgcttgac 60
<210> 7
<211> 86
<212> DNA
<213> virus
<400> 7
ggtccagggt tctcctccac gtctccagcc tgcttcagca ggctgaagtt agtagctccg 60
cttccgagac gaccccatag ttccgc 86
<210> 8
<211> 45
<212> DNA
<213> Bacillus coli
<400> 8
ggagacgtgg aggagaaccc tggacctatg gggtcgtctc tagac 45
<210> 9
<211> 81
<212> DNA
<213> Bacillus coli
<400> 9
gcgccgcggc cggatggaga ccgcgacgga ggcaacgacg acggcgtggg agctcgagga 60
tatcttataa tttttttaat c 81
<210> 10
<211> 99
<212> DNA
<213> Bacillus coli
<400> 10
ctgcttccgg gtctgcgcat cgtaaatacc ggccaccgtg tccgtgtcga acagagtgcg 60
ccagtacgcc actcgaggat atcacaaatg gcaagggct 99
<210> 11
<211> 53
<212> DNA
<213> virus
<400> 11
ggtatttacg atgcgcagac ccggaagcag tcaatattgg ccattagcca tat 53
<210> 12
<211> 23
<212> DNA
<213> virus
<400> 12
cctatagtga gtcgtattaa gta 23
<210> 13
<211> 126
<212> DNA
<213> virus
<400> 13
gccggtattt acgatgcgca gacccggaag caggccaccg gaagcggagc cacgaacttc 60
tctctgttaa agcaagcagg agatgtggag gagaaccctg gacctatggc taatagctgt 120
acattc 126
<210> 14
<211> 123
<212> DNA
<213> virus
<400> 14
ccggtattta cgatgcgcag acccggaagc aggccaccgg aagcggagcc acgaacttct 60
ctctgttaaa gcaagcagga gatgtggagg agaaccctgg acctatggtt aatagctgtg 120
cac 123
<210> 15
<211> 54
<212> DNA
<213> virus
<400> 15
tatacgaacg gtagcccgcc agttgttgtg ccattatttg gcatatttaa caag 54
<210> 16
<211> 58
<212> DNA
<213> virus
<400> 16
tatacgaacg gtagcccgcc agttgttgtg ccattatttg gcatacttaa caaggttc 58
<210> 17
<211> 68
<212> DNA
<213> virus
<400> 17
cagctcttaa ggctagagta cttaatacga ctcactatag ggccaccatg gctaatagct 60
gtacattc 68
<210> 18
<211> 63
<212> DNA
<213> virus
<400> 18
cttaaggcta gagtacttaa tacgactcac tatagggcca ccatggttaa tagctgtgca 60
ctc 63
<210> 19
<211> 58
<212> DNA
<213> virus
<400> 19
catgtctgct cgaagcatta accctcacta aagggaatta tttggcatat ttaacaag 58
<210> 20
<211> 58
<212> DNA
<213> virus
<400> 20
catgtctgct cgaagcatta accctcacta aagggaatta tttggcatac ttaacaag 58
<210> 21
<211> 64
<212> DNA
<213> virus
<400> 21
gggcggggtt cggcttctgg cgtgtgaccg gcggctctag gccaccatgg ctaatagctg 60
taca 64
<210> 22
<211> 65
<212> DNA
<213> virus
<400> 22
gggcggggtt cggcttctgg cgtgtgaccg gcggctctag gccaccatgg ttaatagctg 60
tgcac 65
<210> 23
<211> 57
<212> DNA
<213> virus
<400> 23
aacaacagat ggctggcaac tagaaggcac agtcgaggct ttatttggca tatttaa 57
<210> 24
<211> 63
<212> DNA
<213> virus
<400> 24
caaacaacag atggctggca actagaaggc acagtcgagg ctttatttgg catacttaac 60
aag 63
<210> 25
<211> 20
<212> DNA
<213> virus
<400> 25
tggcacaaca actggcgggc 20
<210> 26
<211> 30
<212> DNA
<213> virus
<400> 26
ttccctttag tgagggttaa tgcttcgagc 30
<210> 27
<211> 73
<212> DNA
<213> virus
<400> 27
cctccgtcgc ggtctccatc cggccgcggc gcgggtggga ggggcgaggg caacttaaat 60
gtgaaagtgg gtc 73
<210> 28
<211> 93
<212> DNA
<213> virus
<400> 28
cccgagcgcg gatctctgaa aaaaaaattt cccgcccccg cgttttccat tggggtgaat 60
ggggagggga tccggtgtgg tagctcgcgt att 93
<210> 29
<211> 98
<212> DNA
<213> virus
<400> 29
ttaattaagt ttaaacccca cccccccgct ccccgggggc cgcgaaaaaa gggggcgggg 60
cttaaagggg ggggatccac aaatggcaag ggctaatg 98
<210> 30
<211> 97
<212> DNA
<213> Bacterial artificial chromosome
<400> 30
agtgaattgt aatacgactc actatagggc gaattcgagc tcggtacccg ttaattaagt 60
ttaaacggcc cagctctccc ccgagcgcgg atctctg 97
<210> 31
<211> 71
<212> DNA
<213> Bacterial artificial chromosome
<400> 31
gtgacactat agaatactca agcttgcatg cctgcaggtc gactctagag ttaattaagt 60
ttaaacccca c 71
<210> 32
<211> 24
<212> DNA
<213> virus
<400> 32
ttgacttcaa aggccagggt caag 24
<210> 33
<211> 21
<212> DNA
<213> virus
<400> 33
gagctggaag acgaaccacg c 21
<210> 34
<211> 99
<212> DNA
<213> virus
<400> 34
ctcccccgcg atcccccccc tctcaccggg tgtccatctt caataaagta tgtctcaaac 60
acctaatctt aaggatatct tataattttt ttaatctgt 99
<210> 35
<211> 59
<212> DNA
<213> virus
<400> 35
gcgcaaaggt gtgtgtgtcc taccgctcgg agccttaagg atatcacaaa tggcaaggg 59
<210> 36
<211> 161
<212> DNA
<213> virus
<400> 36
atataatgag gaaataaaat gaataatggt ctcaaaagat accactaaga aatgaatagt 60
aagctttcac aaaattgatt tccccttgtc caggtgaata aaatatttgt taccgttcgt 120
ataatgtatg ctatacgaag ttatccggaa ttgccagctg g 161
<210> 37
<211> 110
<212> DNA
<213> virus
<400> 37
ggacacccgg tgagaggggg gggatcgcgg gggagtcggg cggggccggg taccgttcgt 60
atagcataca ttatacgaag ttatgtgcac ggccttgaat tgatcatatg 110
<210> 38
<211> 71
<212> DNA
<213> swine
<400> 38
gctccgagcg gtaggacaca cacacctttg cgcatctcca cagctcaaca atggctgctg 60
aaccggaaga c 71
<210> 39
<211> 74
<212> DNA
<213> swine
<400> 39
ttcttcaaca tctcctgctt gctttaacag agagaagttc gtggctccgc ttccgttctt 60
gttttgaaca gtga 74
<210> 40
<211> 69
<212> DNA
<213> swine
<400> 40
gaacttctct ctgttaaagc aagcaggaga tgttgaagaa aaccccgggc ccatgagtta 60
tacaactta 69
<210> 41
<211> 122
<212> DNA
<213> swine
<400> 41
ccattattca ttttatttcc tcattatatc tatagattca aactcatata acctttctga 60
aaggaaaaaa acccagaaag ttcaaaccat gcagttttaa tatttatttt gatgctctct 120
gg 122
<210> 42
<211> 20
<212> DNA
<213> virus
<400> 42
gttgacgttt gatcccgtcc 20
<210> 43
<211> 23
<212> DNA
<213> virus
<400> 43
ctggcaggtg agtgtatggg aac 23
<210> 44
<211> 24
<212> DNA
<213> virus
<400> 44
ttgacttcaa aggccagggt caag 24
<210> 45
<211> 21
<212> DNA
<213> virus
<400> 45
gagctggaag acgaaccacg c 21
<210> 46
<211> 20
<212> DNA
<213> virus
<400> 46
gttgacgttt gatcccgtcc 20
<210> 47
<211> 18
<212> DNA
<213> virus
<400> 47
ggtgagtgta tgggaacc 18
<210> 48
<211> 21
<212> DNA
<213> virus
<400> 48
tcgacgatgc agttgacgga g 21
<210> 49
<211> 22
<212> DNA
<213> virus
<400> 49
gtgctcttca aggagaacat cg 22
<210> 50
<211> 19
<212> DNA
<213> virus
<400> 50
tcgaaggcgg tcaccttgt 19
<210> 51
<211> 18
<212> DNA
<213> virus
<400> 51
ggccatcacg aaccgctt 18
<210> 52
<211> 20
<212> DNA
<213> swine
<400> 52
atagcctcac tagaggtctg 20
<210> 53
<211> 21
<212> DNA
<213> swine
<400> 53
ccaggaacac ttctctgaaa g 21
<210> 54
<211> 22
<212> DNA
<213> swine
<400> 54
tcaaagataa ccaggccatt ca 22
<210> 55
<211> 21
<212> DNA
<213> swine
<400> 55
cgctggatct gcagattatc t 21
<210> 56
<211> 21
<212> DNA
<213> virus
<400> 56
tcaacgccag caacaacacc a 21
<210> 57
<211> 21
<212> DNA
<213> virus
<400> 57
ataacgaaag tctccactgc c 21