WO2021208913A1 - Recombinant plasmid for use in prevention and treatment of sars-cov-2 infection, recombinant lactobacillus expression system, and application - Google Patents

Abstract

A recombinant plasmid for use in prevention and treatment of SARS-CoV-2 infection, a recombinant Lactobacillus expression system, and an application, relating to the technical field of antiviral drugs. A coding sequence of an RBD protein in a SARS-CoV-2 S1 protein is optimized by means of a codon so as to be inserted into a vector, and is then safely and efficiently expressed by using Lactobacillus to obtain a recombinant expressed S1 protein, which can be bound to a surface specific receptor (ACE2) of the human respiratory tract, conjunctiva, digestive tract, and other mucosa as a mucosal infection blocking spray, so that a site where SARS-CoV-2 binds to the surface of the body mucosa is first occupied and closed by the S1 protein, thereby efficiently blocking and interfering with binding of SARS-CoV-2 to a human mucosal specific receptor, preventing the occurrence of COVID-19, reducing the number of people infected with COVID-19, and rapidly stopping the global spread of COVID-19.

Description

Recombinant plasmid and recombinant lactobacillus expression system for preventing and treating new coronavirus infection and application thereof

This application requires that it be submitted to the Chinese Patent Office on April 14, 2020, the application number is 202010288793.7, and the invention title is "a recombinant plasmid for the prevention and treatment of new coronavirus infection, a recombinant lactobacillus expression system and its application". At the same time, this application requires that it be submitted to the Chinese Patent Office on March 12, 2021, the application number is 2021102677115, and the title of the invention is "a recombinant plasmid for the prevention and treatment of new coronavirus infection, a recombinant lactobacillus expression system and its application" The priority of the Chinese patent application, the entire content of which is incorporated in this application by reference.

Technical field

The invention belongs to the technical field of antiviral drugs, and specifically relates to a recombinant plasmid, a recombinant Lactobacillus expression system and applications thereof for preventing and treating neocoronavirus infection.

Background technique

New crown pneumonia (COVID-19) is caused by a new type of coronavirus (named by the World Health Organization as 2019-nCOV; the International Committee for Classification of Viruses named SARS-CoV-2). Coronavirus (CoV) is a positive-stranded single-stranded RNA virus with a diameter of 80 to 120 nm, divided into four types: α, β, δ, and γ. Among them, the 2003 SARS (SARS-CoV), the 2012 Middle East Respiratory Syndrome (MERS-CoV) and the 2019 new crown pneumonia virus are all β-coronaviruses, which have caused severe acute respiratory infections worldwide. The new coronary pneumonia virus (SARS-CoV-2) has been confirmed by Chinese scientists that its genome includes 29891 nucleotides, including untranslated regions (UTR) genes at both ends and a complete open reading frame gene (open reading frame). frame, ORF), can encode at least four structural proteins: spike glycoprotein (spike, S), small envelope glycoprotein (envelope, E), membrane glycoprotein (membrane, M), nucleocapsid protein (nucleocapsid, N), its genome sequence has high homology with MERS-CoV.

SARS-CoV-2 is mainly spread by respiratory droplets, and very few are spread through aerosols and feces. How to quickly curb the global spread and spread of SARS-CoV-2? First, the various biosecurity measures currently adopted, such as home isolation, reduction of personnel movement, and various disinfection measures, are difficult and have many loopholes for the whole society. The price paid is huge. Except for China, the world has not stopped the rapid spread of the virus so far. The second is to speed up the development of vaccines, but the vaccine development cycle is long, the production technology is more complicated, and the cost is high. The injection requires professional and technical personnel. It is difficult to achieve the effect of herd immunity in a short time.

Summary of the invention

In view of this, the purpose of the present invention is to provide a recombinant plasmid, recombinant Lactobacillus expression system for the prevention and treatment of new coronavirus infection and its application in the preparation of drugs for the prevention of new coronavirus infection, by blocking and interfering with the new coronavirus and mucosa Specific receptor binding can prevent and reduce new coronary pneumonia and quickly stop its global spread.

The present invention provides a recombinant vector for preventing and treating new coronavirus infection, including the coding sequence of the RBD region protein in the codon-optimized new coronavirus S1 protein; the nucleotide sequence of the coding sequence is as shown in the sequence table SEQ ID NO:1 Shown.

Preferably, the basic vector of the recombinant vector includes a lactobacillus secretory expression vector.

Preferably, the lactobacillus secretory expression vector includes pVE5523.

Preferably, the multiple cloning sites where the coding sequence is inserted into pVE5523 are SalI and EcoRV.

The invention provides a recombinant lactobacillus expression system containing the recombinant vector.

The present invention provides a recombinant S1 protein secreted and expressed by the recombinant lactobacillus expression system.

The present invention provides a method for preparing the recombinant S1 protein, which includes the following steps:

The recombinant lactobacillus expression system is inoculated into a special medium for lactobacillus in a sterile environment, and fermented at 28-35° C. for 68-75 hours, and the obtained fermentation broth contains the recombinant S1 protein.

The present invention provides the application of the recombinant vector, the recombinant Lactobacillus expression system, the recombinant S1 protein or the fermentation broth prepared by the preparation method in the preparation of drugs for preventing and treating neocoronavirus infection.

The present invention provides a mucosal blocking agent for preventing and treating neocoronavirus infection, which includes the recombinant S1 protein or the fermentation broth obtained by the preparation method.

Preferably, the mucosal blocking agent includes oral, nasal spray or eye drops.

The recombinant vector and recombinant Lactobacillus expression system for preventing and treating the new coronavirus infection provided by the present invention is to insert the coding sequence of the RBD region protein in the new coronavirus S1 protein into the vector through codon optimization, and then use Lactobacillus to express safely and efficiently. Obtain the recombinant expression of S1 protein, which can be used as a mucosal infection blocking spray, which binds to the human respiratory tract, conjunctiva, digestive tract and other mucosal surface specific receptors (ACE2), thus the site where the new coronavirus binds to the mucosal surface of the body It is preferentially occupied by the S1 protein to effectively block and interfere with the binding of the new coronavirus to the human mucosal specific receptor (ACE2), thereby preventing the occurrence of new coronary pneumonia, reducing the number of people infected with new coronary pneumonia, and quickly stopping its global spread.

The invention provides a mucosal blocking agent for preventing and treating neocoronavirus infection. Since SARS-CoV-2 is mainly spread by respiratory droplets, very few are spread through aerosols, feces, etc., cutting off the S1 protein on the surface of the new coronavirus and the respiratory tract, conjunctiva, digestive tract and other mucosal surfaces ACE2 The binding of the receptor can effectively reduce the infection of the new coronavirus by blocking the path of viral infection. The mucosal blocking agent has the following characteristics:

Compared with vaccines, the recombinant new coronavirus S1 protein contains only viral functional proteins, no virus infection genes exist, and it will not cause virus mutation. It is a topical preparation with high safety;

Recombinant S1 protein is secreted into the cell wall of bacteria and is a soluble expression product. At the same time, Lactobacillus is a common probiotic in the human body and is recognized as the safest food-grade microorganism. The S1 protein expressed by lactic acid bacteria does not need to be extracted and purified, so it is omitted. The complicated purification process and renaturation process after the expression of the conventional prokaryotic expression system greatly reduces the production cost of the mucosal blocking agent, which is conducive to rapid industrial production;

The mucosal blocking agent can be used repeatedly, is not only non-toxic and harmless, but also can induce mucosal immunity and further reduce the risk of virus infection. It can be used by professional medical staff before taking up their jobs, or in closed transportation and office places. Or use in communities and families to prevent infection.

Description of the drawings

Figure 1 is a vector map of the recombinant vector pVE5523-SARS-CoV-2-S1;

Figure 2 shows the sequencing result of the recombinant vector and the sequence comparison result of the inserted nucleotide fragment;

Figure 3 shows the fluorescence quantitative PCR amplification curve of the recombinant vector pVE5523-SARS-CoV-2-S1;

Figure 4-1 shows the Western Blot identification of recombinant S1 protein; where M: Marker 26616; 1: Recombinant Lactobacillus supernatant 20μl; 2: Recombinant Lactobacillus precipitation 20μl;

Figure 4-2 shows the results of recombinant S1 protein Coomassie brilliant blue staining analysis; among them, M: Marker 26616;

1: Recombinant Lactobacillus supernatant 20μl; 2: Recombinant Lactobacillus precipitation 20μl; 3: BCA standard 8.8ng/μl; 4: BCA standard 17.59ng/μl; 5: BCA standard 35.19ng/μl; 6: BCA Standard 70.375ng/μl; 7: BCA standard 140.75ng/μl; 8: BCA standard 281.5ng/μl; 9: BCA standard 563ng/μl.

Detailed ways

The present invention provides a recombinant vector for preventing and treating new coronavirus infection, including the coding sequence of the RBD region protein in the codon-optimized new coronavirus S1 protein; the nucleotide sequence of the coding sequence is as shown in the sequence table SEQ ID NO:1 Shown.

In the present invention, the basic vector of the recombinant vector preferably includes a lactobacillus secretory expression vector. In the present invention, there is no special restriction on the type of the lactobacillus secretory expression vector, and a lactobacillus secretory expression vector well known in the art can be used. In order to illustrate the types of recombinant vectors, in the embodiment of the present invention, the lactobacillus secretory expression vector is pVE5523. The multiple cloning sites where the coding sequence is inserted into pVE5523 are preferably SalI and EcoRV.

In the present invention, the coding sequence is obtained by optimizing the RBD region protein in the S1 protein of the new coronavirus according to the codon preference of Lactobacillus. It is repeated twice at the same time, which is beneficial to increase the protein expression. The nucleotide sequence is shown in the sequence table. The SEQ ID NO:1 shown in () is convenient for subsequent insertion into a lactobacillus secretory expression vector for high-efficiency expression. The RBD region protein of the new coronavirus S1 protein is used as the new coronavirus-specific protein bound to the human mucosal surface ACE2 (Angiotensin Converting Enzyme 2) receptor, which can effectively compete for the binding site of the new coronavirus and is safe to use , To prevent the infection of the new coronavirus.

In the present invention, the method for constructing the recombinant vector preferably includes the following steps:

A. Cut the coding sequence and the basic vector with the same restriction enzymes to obtain the coding sequence with sticky ends and the basic vector respectively;

B. Connect the coding sequence with sticky ends to the basic vector and screen to obtain a recombinant vector.

In the present invention, the restriction endonuclease digestion method is not particularly limited, as long as the restriction endonuclease digestion method is well-known in the art. When the basic vector is pVE5523, the types of the restriction endonucleases are preferably SalI and EcoRV, and the map of the recombinant vector is shown in Figure 1.

In the present invention, the connection method preferably uses T4 ligase connection.

In the present invention, the screening method preferably introduces the recombinant vector into Escherichia coli, extracts the plasmid after culturing, and performs sequencing and comparison of the plasmid. The recombinant vector consistent with the inserted coding sequence is the recombinant vector pVE5523-SARS-CoV- 2-S1 (sequence is SEQ ID NO: 2), used for subsequent operations.

The invention provides a recombinant lactobacillus expression system containing the recombinant vector.

In the present invention, the type of Lactobacillus in the recombinant Lactobacillus expression system is not particularly limited, as long as the Lactobacillus well known in the art can be used. In order to exemplify the composition of the recombinant Lactobacillus expression system, in the embodiment of the present invention, the type of Lactobacillus is tested using ATCC393 Lactobacillus casei.

In the present invention, the method for preparing the recombinant Lactobacillus expression system preferably transforms the recombinant vector into a Lactobacillus competent state and screens to obtain the recombinant Lactobacillus expression system. The transformation method is not particularly limited, and a transformation method well-known in the art can be used. In the embodiment of the present invention, the conversion adopts an electric conversion method.

The screening method preferably spreads E. coli on an MRS solid culture plate containing erythromycin and cultures it in a static state; picks positive clones and inoculates them into an MRS liquid medium containing erythromycin for static culture; extracts recombinant plasmids Plasmids were identified by fluorescence quantitative PCR. The primers used for fluorescent quantitative PCR are SEQ ID NO: 3 and SEQ ID NO: 4. The nucleotide sequence of the amplified product of the fluorescence quantitative PCR reaction is SEQ ID NO: 5. The positive recombinant plasmid has a typical amplification curve. The ATCC393 competent control has no amplification curve, indicating that the pVE5523-SARS-CoV-2-S1 plasmid was successfully transformed into ATCC393 competent cells.

The present invention provides a recombinant S1 protein secreted and expressed by the recombinant lactobacillus expression system.

The present invention provides a method for preparing the recombinant S1 protein, which includes the following steps:

The recombinant Lactobacillus expression system was inoculated into Lactobacillus liquid culture medium under aseptic environment, fermented at 28～35℃ for 68～75h, the obtained fermentation broth was centrifuged at 5000～6000rpm for 15～30min, and the supernatant was taken Solution to obtain recombinant S1 protein.

In the present invention, there is no particular limitation on the type of the Lactobacillus liquid culture medium, as long as the culture medium for culturing Lactobacillus is well known in the art. In the embodiment of the present invention, the Lactobacillus liquid culture medium is MRS liquid culture. The culture temperature of the recombinant lactobacillus expression system is 34-36°C, and the fermentation time is preferably 72h. The temperature of the centrifugation is preferably 4°C.

In the present invention, after testing, the quality of the recombinant S1 protein accounts for 10% of the total protein quality of Lactobacillus.

The present invention provides the application of the recombinant vector, the recombinant Lactobacillus expression system, the recombinant S1 protein or the fermentation broth prepared by the preparation method in the preparation of drugs for preventing and treating neocoronavirus infection.

The present invention provides a mucosal blocking agent for preventing and treating neocoronavirus infection, including the recombinant S1 protein or the recombinant S1 protein prepared by the preparation method. The mucosal blocking agent preferably includes oral and nasal sprays and eye drops. In the mucosal blocking agent, the S1 protein concentration range is preferably 10ng/ml-50ng/ml, more preferably 20-40ng/ml, most preferably 30ng/ml. The human dosage of the mucosal blocking agent is preferably 0.2ml/person/time, twice a day, wherein the nasal spray dosage is preferably 0.1ml/person/time, and the eye drop dosage is preferably 0.1ml/person/time. The present invention has no special restrictions on the preparation methods of the oral and nasal sprays and/or eye drops, as long as the preparation methods are well known in the art.

The following describes in detail a recombinant plasmid, recombinant Lactobacillus expression system and its application provided by the present invention for the prevention and treatment of neocoronavirus infection in combination with examples, but they cannot be understood as limiting the scope of protection of the present invention.

Example 1

The codon-optimized S1 gene of the new coronavirus SARS-CoV-2 (SARS-CoV-2-S1)

The S1 protein of the new coronavirus SARS-CoV-2 is a key surface protein for the virus to bind to the ACE2 receptor on the host surface and mediate the virus into the host cell. Screen the gene sequence of the SARS-CoV-2 S1 protein that specifically binds to ACE2, and optimize the sequence with Lactobacillus codons. The modified sequence was artificially synthesized by Nanjing GenScript Biotechnology Co., Ltd., SARS-CoV- The nucleotide sequence of 2-S is shown in SEQ ID NO:1.

Example 2

Construction method of recombinant expression vector pVE5523-SARS-CoV-2-S1

1Materials and methods

1.1 Materials and sources

Restriction endonucleases SalI and EcoRV were purchased from NEB; Taq enzyme, dNTP, DNA Marker DL2000, DL15000, Agarose Gel DNA Purification Kit, Mini BEST Plasmid Purification Kit were purchased from Dalian Bao Biological Company. The cloning vector pVE5523 was provided by Nanjing GenScript Biotechnology Co., Ltd.

1.2 Test method

The small fragments of the cloning vector pVE5523 cut with SalI/EcoRV double enzymes were ligated with the SARS-CoV-2-S1 gene fragments cut with the same double enzymes, and the ligation products were transformed into E. coli. After culture, the plasmid was extracted with the kit , And send the extracted plasmid to Nanjing GenScript Biotechnology Co., Ltd. for sequencing verification.

2 test results

Recombinant plasmid sequencing results: After gene sequencing, the recombinant plasmid is compared with the inserted S1 gene fragment (single repeat sequence) (see Figure 2). The sequencing result is consistent with expectations, indicating the synthesized SARS-CoV-2-S1 gene fragment It was successfully inserted into the Lactobacillus secretory vector pVE5523, the recombinant plasmid was successfully constructed, and the positive plasmid was named pVE5523-SARS-CoV-2-S1.

Example 3

Preparation and detection method of recombinant lactobacillus expression system

1Materials and methods

1.1 Materials and sources

Erythromycin (Emr) was purchased from Baierdi Biotechnology Co., Ltd.

1.2 Test method

The pVE5523-SARS-CoV-2-S1 recombinant vector was electrotransformed into Lactobacillus ATCC393 competent, and the electro-transformed Lactobacillus ATCC393 was spread on the MRS solid culture plate containing 5μg/ml erythromycin at 30℃. Cultivate in an incubator for 72 hours, pick the colonies on the plate and inoculate them into MRS liquid medium containing 5μg/ml erythromycin, and incubate at 30°C for 72 hours; extract the plasmids from the bacteria and use ATCC393 competence as a control. Fluorescence quantitative PCR was used for identification, and the identification primers and amplification sequences were as follows:

Upstream primer: ccaaccatacagagtagtagta (SEQ ID NO: 3)

Downstream primer: gttagactcagtaagaacacct (SEQ ID NO: 4);

The reaction system of fluorescence quantitative PCR totals 25μl:

Fluorescence quantitative PCR reaction program: pre-denaturation 95℃5min; cyclic reaction 95℃10s, 60℃30s, 40 cycles; melting curve 95℃15s, 60℃60s, 95℃15s; test according to the above parameters on the fluorescence quantitative PCR instrument .

The amplified sequence is as follows:

2 test results

Fluorescence quantitative PCR was used to detect the amplified recombinant plasmid, and the results are shown in Figure 3. It can be seen from the amplification curve that the positive recombinant plasmid has a typical amplification curve, and the CT value varies within the range of 19-22, while the ATCC393 competent control does not have an amplification curve. The results showed that pVE5523-SARS-CoV-2-S1 plasmid was successfully transformed into ATCC393 competent cells.

Example 4

Culture method of recombinant Lactobacillus expression system and isolation of recombinant S1 protein

The recombinant Lactobacillus expression system was inoculated with Lactobacillus MRS liquid medium at a ratio of 1%, and the fermentation broth was harvested after 72 hours at 35°C.

Separation and detection of recombinant S1 protein: The fermentation broth harvested above was centrifuged at 4°C and 8000 rpm for 15 minutes, and the supernatant was harvested. The supernatant was dialyzed and freeze-dried at 4°C to concentrate the protein 50 times. After concentration, add 1×SDS gel loading buffer (including DTT), mix well, boil for 10 min, centrifuge at 1000 g for 10 min, and take 10 μl of the supernatant Load the sample for SDS-PAGE electrophoresis analysis.

Recombinant S1 protein content detection: Lactobacillus plate surface spread method live bacteria technology, and then calculate that the S1 protein content accounts for 10% of the total protein content of Lactobacillus.

Qualitative analysis of recombinant S1 protein: Western blot analysis of polyacrylamide gel using S1 protein specific antibody (Beijing Yiqiao Shenzhou SARS-Cov-2 Spike Neutralizing antibody, Cat: 40592-R001).

The results are shown in Figure 4-1. The recombinant S1 protein cannot produce obvious bands, indicating that the recombinant S1 protein is not expressed in the supernatant or the expression level is low.

Further quantitative analysis of recombinant S1 protein: the polyacrylamide gel was decolorized by Coomassie brilliant blue staining, and the decolorized gel was photographed with a protein gel imager.

The results are shown in Figure 4-2. By combining the bands of the target protein in the Western blot, no corresponding bands were found in the supernatant sample of the polyacrylamide gel after decolorization. It was further confirmed that the recombinant S1 protein was not expressed or expressed at a low level in the supernatant.

Example 5

The recombinant S1 protein prepared in Example 4 was diluted to a solution of 10ng/ml. The diluted S1 protein solution was administered to SPF New Zealand rabbits and SD rats in the form of sprays. At the same time, the negative control group A was sprayed with the same volume of normal saline and the control group B was sprayed with the same volume of MRS culture medium. Each group of New Zealand rabbits and Four SD rats were observed for 2 weeks. No abnormalities such as abnormal body temperature, allergies, and respiratory tract infections occurred in 24 animals. This indicates that the recombinant S1 protein prepared by the present invention is safe and has no side effects.

Example 6

The recombinant lactobacillus expression system was fermented using the method of Example 4, and the harvested fermentation broth was centrifuged at 4° C. and 8000 rpm for 15 minutes to harvest the bacteria. Add 500μl of cell lysate to the bacteria to resuspend the bacteria and use an ultrasonic disruptor to lyse the bacteria; add 1ⅹSDS gel loading buffer (including DTT) to the bacterial lysate, and at the same time, the standard protein (known concentration) Perform multiple dilution, add 1ⅹSDS gel loading buffer (including DTT); mix all the above protein samples thoroughly, boil for 10min, centrifuge at 1000g for 10min, take 20μl of the supernatant and load the sample for SDS-PAGE electrophoresis, respectively do Coomassie light Blue staining and Western blot analysis.

Qualitative analysis of recombinant S1 protein: Western blot analysis of polyacrylamide gel using S1 protein specific antibody (Beijing Yiqiao Shenzhou SARS-Cov-2 Spike Neutralizing antibody, Cat: 40592-R001).

The results are shown in Figure 4-1. The recombinant S1 protein was successfully expressed in recombinant Lactobacillus, and the protein mainly exists in recombinant Lactobacillus cell protein.

In this example, the recombinant S1 protein was quantitatively analyzed: the polyacrylamide gel was decolorized by Coomassie brilliant blue staining, and the decolorized gel was photographed with a protein gel imager.

The result is shown in Figure 4-2. By combining the target protein band in the Western blot, the target band is found in the corresponding position in the polyacrylamide gel after decolorization.

Use ImageJ software to perform grayscale analysis on the protein bands in polyacrylamide gel, and use the standard protein concentration as a reference to quantitatively analyze the recombinant S1 protein. The results are shown in Table 1 below. According to formula A, calculate the recombinant S1 protein The expression level of recombinant Lactobacillus.

Table 1 Protein grayscale analysis

sample		Standard 1	Standard 2	Standard 3	Standard 4	Standard 5	Standard 6	Destination band
grayscale value	1.464	3.916	7.028	15.16	25.346	50.192	15.19
Concentration (ng/μl)	17.6	35.2	70.4	140.75	281.5	563	141.03

Recombinant S1 protein concentration (μg/ml) = target band concentration×500μl÷20ml Formula A

The calculated concentration of the recombinant S1 protein is 3.53 μg/ml, indicating that the recombinant S1 protein can be efficiently expressed in the Lactobacillus expression system.

The description of the above embodiments is only used to help understand the method and the core idea of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications also fall within the protection scope of the claims of the present invention. Various modifications to these embodiments are obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown in this document, but should conform to the widest scope consistent with the principles and novel features disclosed in this document.

Claims (10)

1. A recombinant vector for preventing and treating new coronavirus infection, which is characterized in that it includes the coding sequence of the RBD region protein in the codon-optimized new coronavirus S1 protein; the nucleotide sequence of the coding sequence is as shown in the sequence list SEQ ID NO:1 Shown.
2. The recombinant vector according to claim 1, wherein the basic vector of the recombinant vector comprises a secretory expression vector of lactobacillus.
3. The recombinant vector according to claim 2, wherein the secretory expression vector of lactobacillus comprises pVE5523.
4. The recombinant vector according to claim 3, wherein the multiple cloning sites where the coding sequence is inserted into pVE5523 are SalI and EcoRV.
5. A recombinant Lactobacillus expression system comprising the recombinant vector of any one of claims 1 to 4.
6. The recombinant S1 protein secreted and expressed in the recombinant lactobacillus expression system of claim 5.
7. The method for preparing recombinant S1 protein according to claim 6, characterized in that it comprises the following steps:

   The recombinant Lactobacillus expression system of claim 5 is inoculated into a Lactobacillus liquid culture medium in a sterile environment, and fermented at 28-35° C. for 68-75 hours, and the obtained fermentation broth contains recombinant S1 protein.
8. The recombinant vector of any one of claims 1 to 4, the recombinant Lactobacillus expression system of claim 5, the recombinant S1 protein of claim 6 or the fermentation broth prepared by the preparation method of claim 7 are used for preparing and preventing new coronavirus infections. Application of the drug.
9. A mucosal blocking agent for preventing and treating neocoronavirus infection, which is characterized by comprising the recombinant S1 protein of claim 6 or the fermentation broth obtained by the preparation method of claim 7.
10. The mucosal blocking agent according to claim 9, wherein the mucosal blocking agent comprises oral, nasal spray or eye drops.

Images