CN115851727A

CN115851727A - Small nucleic acid RNA interference of targeted interference of new coronavirus S protein and application

Info

Publication number: CN115851727A
Application number: CN202211418610.4A
Authority: CN
Inventors: 张韦唯; 戴方平
Original assignee: Jiangsu Zhongfang Gene Biomedical Technology Co ltd
Current assignee: Jiangsu Zhongfang Gene Biomedical Technology Co ltd
Priority date: 2022-11-14
Filing date: 2022-11-14
Publication date: 2023-03-28

Abstract

The invention provides small nucleic acid RNA interference of targeted interference new coronavirus S protein and application thereof, wherein 813nt fragments of S protein genes are extracted from SARS-CoV-2Delta and taken as shRNA targets; 813nt contains most of S protein gene RBD and part of downstream region after RBD, based on the 813nt fragment sequence, shRNA688 is designed, prepared and subjected to RNAi experiment. The sense sequence in the sequence of the shRNA provided by the invention is GGTGT TCTTA CTGAG TCTAA C, and as shown in SEQ ID NO.10, the shRNA provided by the invention obviously reduces the concentration of an S protein mRNA Est813 transcript.

Description

Small nucleic acid RNA interference of targeted interference of new coronavirus S protein and application

Technical Field

The invention belongs to the technical field of biological medicines, relates to an RNAi therapy, and particularly relates to small nucleic acid RNA interference for targeted interference of a new coronavirus S protein and application thereof.

Background

The global pandemic of the new coronavirus-19 is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Vaccines can significantly slow the increase in positive cases and deaths, however, vaccination may not completely cover the global population. In addition, the SARS-CoV-2 variant evades immunity from previous infection or vaccination and such variants continue to emerge. The emergence of Omicron variants indicates how rapidly SARS-CoV-2 evolves, with a negligible potential impact on protein-based interventions (i.e. vaccines, antibodies or convalescent plasma) currently directed mainly against highly mutated spinous process (S) proteins. An emerging concept in anti-neocoronaviral drug therapy involves the development of nucleic acid-based therapies that can degrade the viral genome and can be rapidly tuned for viral mutations. Nucleic acid-based therapies include small interfering RNAs (siRNAs). These non-coding RNA duplexes, about 19-21 base pairs long, are capable of knocking down target gene expression in a sequence-specific manner by mediating targeted mRNA degradation. Upon cellular uptake, the siRNA duplex is loaded into the RNA-induced silencing complex (RISC). The double strand is processed into a single strand with a high degree of specific binding to complementary RNA present in the cytoplasm, resulting in its isolation. Ongoing epidemic pandemics have prompted various groups to evaluate new siRNA-based coronavirus treatments. Although most of the studies published to date have reviewed the potential of RNA interference for the treatment of new coronaviruses, they have been described by computational predictive studies and have also provided preliminary proof-of-concept that SARS-CoV-2 can be inhibited by siRNA. A siRNA designed against the Orf1a/b region of the SARS-CoV-2RNA genome, encoding a nonstructural protein (nsp), was tested. An siRNA which can effectively inhibit the replication of SARS-CoV-2 is discovered. Adeno-associated viral vectors co-expressing a mixture of short hairpin RNAs (shRNAs) directed against the SARS-CoV-2RdRp and N genes were tested. The results indicate that RNAi has potential and promise for therapeutic intervention. An in-depth understanding of effective inhibition of viral replication is a prerequisite for the development of effective antiviral strategies.

SARS-CoV-2 is a single stranded large RNA virus with an envelope having a 5' untranslated region (UTR), an ORF1a/b RNA encoding a nonstructural viral protein, a 3' end segment encoding a structural protein, such as the S protein that binds to the human angiotensin converting enzyme 2 (hACE 2) receptor on human host cells, and a nucleocapsid N protein involved in virion assembly, and a 3' UTR. As a global measure of response to the pandemic of new coronaviruses, a large number of genomes of SARS-CoV-2 variants are provided in public databases, including the SARS-CoV-2 variant S protein gene and protein sequence (https:// www.ncbi.nlm.nih.gov/nuccore/. More mutations accumulated in the Omicron S proteins, including the RBD. Mutations in the Receptor Binding Domain (RBD) of the S protein affect its affinity for ACE 2. SARS-CoV-2 has a large RNA genome but does not integrate into the human genome when replicated in the cytoplasm of human lung epithelial cells. Viral replication is a continuous process, while subgenomic mRNA transcription is a discontinuous process. The antiviral effect of adenosine analogues (the main recombinant drugs for SARS-CoV-2 RNA-dependent RNA polymerase inhibition) was investigated. The use of nucleic acid antisense oligonucleotides is described as a potential novel therapeutic strategy against SARS-CoV-2 RNA. The antisense oligonucleotide, which binds to the 5' leader sequence of SARS-CoV-2, disrupts the highly conserved stem loop structure, has nanoscale potency, and prevents viral replication in human cells.

The invention of new vaccines and drugs for preventing SARS-CoV-2 pandemic is imminent. Although some vaccines with preventive effect and therapeutic neutralizing antibodies have been developed to target the SARS-CoV-2. However, as viruses are continually being mutated, previous efforts have been insufficient to deal with new mutant strains of viruses. Scientists in many countries are struggling to develop antiviral therapeutics in seconds.

Genes (DNA) are proteins produced by an agent, which is a single-stranded mRNA (single-stranded nucleotide). Scientists have found that short double-stranded RNA can interfere with single-stranded mRNA, leading to degradation and loss of function of the single-stranded mRNA, and thus failure to express the resulting protein, RNAi means nucleotide interference, i is the initials of English interference. The 2006 Nobel prize for medicine was awarded to 2 scientists who discovered RNAi.

Ongoing epidemic pandemics have prompted various groups to evaluate new siRNA-based coronavirus treatments, including small interfering RNAs (siRNAs). These non-coding RNA duplexes, about 19-21 base pairs long, are capable of knocking down target gene expression in a sequence-specific manner by mediating targeted mRNA degradation. Upon cellular uptake, the siRNA duplexes are loaded into the RNA-induced silencing complex (RISC). The double strand is processed into a single strand with a high degree of specific binding to complementary RNA present in the cytoplasm, resulting in its isolation. Although most of the studies published to date have reviewed the potential of RNA interference for the treatment of new coronaviruses, they have been described by computational predictive studies and have also provided preliminary proof-of-concept that SARS-CoV-2 can be inhibited by siRNA. A siRNA designed against the Orf1a/b region of the SARS-CoV-2RNA genome, encoding a nonstructural protein (nsp), was tested. An siRNA that inhibits the replication of SARS-CoV-2 with high efficiency is discovered. Adeno-associated viral vectors co-expressing a mixture of short hairpin RNAs (shRNAs) against the SARS-CoV-2RdRp and N genes were tested. The results indicate that RNAi has potential and promise for therapeutic intervention. An in-depth understanding of effective inhibition of viral replication is a prerequisite for the development of effective antiviral strategies.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide the small nucleic acid RNA interference for targeted interference of the S protein of the novel coronavirus and application thereof.

In this study, shRNA was designed to target 813bp Est of the S protein gene (Delta) selected after cluster analysis. The conserved and mutated regions of the S protein gene in the genome of SARS-CoV-2 variants were analyzed in public databases. The 813bp fragments of most of the coding S protein RBD and the downstream of the RBD part are cloned to an upstream red fluorescent protein gene (RFP) to form a fusion gene, and the pCMV-S-protein RBD-Est-RFP plasmid expressed as a potential target gene of RNAi is constructed. The double-stranded DNA encoding shRNA688 was constructed downstream of the human H1 promoter of a plasmid that also expressed the green fluorescent protein (EGFP) marker gene. The dual expression of EGFP and shRNA in plasmids can facilitate understanding of gene transfection efficiency. Both constructed plasmids were co-transfected into HEK293T by Lipofectamine 2000. The degradation of SARS-CoV-2S protein gene transcripts expressed in transfected HEK293T cells treated with RNAi was analyzed by analyzing images of the gene transfected cells and performing fluorescent quantitative reverse transcription polymerase chain reaction (RT qPCR) with specific probes targeting the SARS-CoV-2S protein gene.

The purpose of the invention is realized by the following technical scheme:

in a first aspect:

the invention provides shRNA, wherein the sense sequence in the sequence is GGTGT TCTTA CTGAG TCTAA C which is shown as SEQ ID NO. 10.

Further, the shRNA comprises the following sequence:

AGCTTGGTGTTCTTACTGAGTCTAACTTCAAGAGCGTTAGACTCAGTAAGAACACCTTTTTTG as shown in SEQ ID No. 8.

Further, the shRNA comprises the following oligonucleotide combinations:

shRNA F:

AGCTTGGTGTTCTTACTGAGTCTAACTTCAAGAGCGTTAGACTCAGTAAGAACACCTTTTTTG as shown in SEQ ID No. 8;

shRNA R:

AATTCAAAAAAGGTGTTCTTACTGAGTCTAACGCTCTTGAAGTTAGACTCAGTAAGAACACCA as shown in SEQ ID No. 9.

In a second aspect:

the present invention provides a recombinant plasmid comprising the shRNA as described above.

The recombinant plasmid also comprises a human H1 promoter for driving shRNA expression and a pCMV promoter for driving green fluorescent protein EGFP gene expression.

In a third aspect:

the invention also provides a construction method of the recombinant plasmid, which comprises the following steps:

s1, taking a pSIL-EGFP vector containing a gene transfection marker pCMV-EGFP gene as a basic vector;

s2, constructing a human RNA polymerase III type promoter H1 promoter at the upstream of a pCMV-EGFP region through XhoI CTCGAG and HindIII AAGCTT enzyme cutting sites;

s3, the shRNA is integrated at the downstream of the H1 promoter through HindIII AAGCTT and EcoRI GAATTC construction sites.

In a fourth aspect:

the present invention provides novel coronavirus S protein inhibitors comprising shRNA or recombinant plasmids as described above.

In a fifth aspect:

the invention also provides a kit containing the shRNA or the recombinant plasmid.

A sixth aspect:

the application of the shRNA in preparing the medicine for treating the new coronavirus also belongs to the protection scope of the invention.

The application of the shRNA in the targeting interference of SARS-CoV-2 also belongs to the protection scope of the invention.

Further, the invention also provides a screening method of the specific shRNA of the targeted interference new coronavirus S protein, which comprises the following steps:

the 813nt fragment of the S protein gene is extracted from SARS-CoV-2 as shRNA target spot, the nucleotide sequence is shown as SEQ ID NO.1, and the target spot comprises the RBD region part of the S protein gene and the highly conserved downstream region of the RBD part.

Compared with the prior art, the invention has the following beneficial effects:

1. in the invention, the double-stranded DNA for coding the shRNA is constructed at the downstream of the human H1 promoter of the plasmid, the pCMV promoter drives the expression of an Enhanced Green Fluorescent Protein (EGFP) marker gene, and the shRNA688 targeting the conservation region of the S protein gene can effectively reduce the S protein gene.

2. The invention provides a cell model and technical support for the research and development of broad-spectrum small nucleic acid RNAi anti-SARS-CoV-2 drugs or other RNAi drugs harming human disease viruses.

3. The invention adopts the technology of driving shRNA by an H1 promoter and degrades a new coronavirus S protein gene by the principle of RNA interference. If the existing anti-new coronavirus S protein antibody patent is adopted, the defect that the antiviral function is partially or completely lost along with the mutation of the new coronavirus is generated.

4. The constructed shRNA688 targets a highly conserved region of an S protein gene of SARS-CoV-2

In this study, we extracted a 813nt fragment of the S protein gene from SARS-CoV-2Delta as the shRNA target. 813nt contains the major portion of the S protein gene RBD and a portion of the downstream region after RBD. Based on the 813nt fragment sequence, shRNA688 was designed, prepared and subjected to RNAi experiments. Our findings indicate that shRNA688 significantly reduced the concentration of the S protein mRNAEst813 transcript.

We analyzed different types of S protein CDS and protein subtypes. The results show that the shRNA688 targeting region is highly conserved in all SARS-CoV-2 variants, including Delta, omicron BA.1, omiclon BA.5.1.3 and Omicron BA.5.2.1, which caused new coronaviruses in the last two years. Thus, in our study, shRNA688 not only degraded S protein mRNA Est of SARS-CoV-2Delta, but theoretically also had RNAi function to all existing SARS-CoV-2 variants discovered to date, since the target region of shRNA688 is shared among all S protein genes of SARS-CoV-2 variants.

5. The co-transfection of shRNA and EGFP expression plasmids, S protein gene fragments and RFP fusion gene plasmids in a human cell line provides a useful cell experimental model for RNAi research.

In view of the biological safety in the laboratory, we constructed a plasmid containing the pCMV-S protein RBD EST-RFP fusion gene and delivered the S protein gene fragment to the experimental cells. We carefully selected the fragment and linked it to the RFP gene as a fusion gene that does not produce any fusion protein, but rather produces the wild-type RFP gene as a gene transfection marker.

If the transfected cells expressed the constructed RBD EST-RFP fusion gene containing the S protein, the cells showed red fluorescence. Considering the efficiency of delivery of RNAi by shRNA, we constructed the pCMV-EGFP-pH1-shRNA plasmid. In one configuration, pCMV-derived EGFP expression, the human H1 promoter drives shRNA expression. We used LipofectAMINE2000 to mediate the pCMV-S protein RBD containing the EST-RFP fusion gene plasmid and the pCMV-EGFP-pH1-shRNA plasmid into cultured cells. The gene transfection efficiency was easily observed under a fluorescence microscope. By image fusion analysis of red and green fluorescence, co-transfection efficiency can be observed. The mean yellow color of the co-transfected cells was about 20-30%, and further RT-qPCR was performed to determine the mRNA concentration of the target S protein Est fusion gene transcript to test the RNAi effect of the shRNA. Here, we report shRNA688 in this study, because we have observed the RNAi result of shRNA68, we did not attempt to classify cells expressing red or green fluorescent genes by flow cytometry (FASC).

6. shRNA688 can be a potential medicine for treating SARS-CoV-2

SARS-CoV-2 is an RNA genomic virus. When SARS-CoV-2 infects human lung epithelial cells, viral gene RNA invades the infected cells. The S protein of the virus is translated from the S protein RNA gene. In this study, we used shRNA688 to successfully degrade transcripts of the S protein RBD containing the EST-RFP fusion gene in a cell model. It is well known that several variants of SARS-CoV-2 already exist. Vaccines and neutralizing antibodies are a focus of research. It takes a lot of effort and time to prepare and renew a vaccine or recognize a new neutralizing antibody in order to prevent the developed neutralizing antibody from escaping to a new mutant antigen of the SARS-CoV-2 new variant S protein. Today, a new variant of SARS-CoV-2 can be completely sequenced and analyzed. If any viral mutant exists in the target RNA sequence, RNAi elements can also be easily and rapidly designed and prepared to test the RNAi function of the potential new mutant of SARS-CoV-2.

Currently, the Food and Drug Administration (FDA) has issued some urgent approval for the use of antiviral drugs. RNAi-based therapies provide a controllable target for antiviral therapy. The use of nanoparticles as carriers to deliver siRNAs to specific cells of the human body may play a key role in the specific treatment of SARS-CoV-2 infection. For practical clinical applications, the aerosol inhaler will consider the best nanomaterial or medium. Inhalation of siRNA is expected to develop antiviral therapies for respiratory diseases. The new coronavirus, caused by SARS-CoV-2 virus, is a rapidly emerging disease, which is then fatal. The pulmonary system, and in particular the lungs, are most vulnerable to SARS-CoV-2 infection, which leaves a destructive footprint in the lung tissue that renders it incapable of respiratory function, resulting in severe acute respiratory illness and loss of life. RNAi can be used to develop treatments against viruses. This approach allows the use of shRNA molecules to specifically bind and silence therapeutic targets. The feasibility of promising therapeutic approaches is provided by the inhalation route, and it is expected that this route will provide one of the effective interventions to prevent viral transmission. short duplexes of shRNA would be considered to replace plasmids. In addition, the RNAi drug function on pseudoviruses, even SARS-CoV-2, should be tested in cooperation with a panel of biosafety laboratories. Once the siRNA design and delivery channels to the respiratory tract are established, RNAi based therapies are fairly straightforward to adapt to new targets. Therefore, it can relatively rapidly develop an antiviral drug in an emergency situation caused by emerging pathogens affecting the respiratory tract, such as SARS-CoV-2. RNAi can thus be developed as one of the effective drugs for the treatment of SARS-CoV-2 to save the patient's life.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a cluster analysis of the RBD region of SARS-CoV-2 variant S protein and a part of the downstream region thereafter;

FIG. 2 is the position of shRNA250, shRNA463, shRNA544, and shRNA688 targeting the S protein gene of SARS-CoV-2 Delta;

FIG. 3 shows the position of shRNA688 targeting the downstream part of SARS-CoV-2s S protein gene RBD;

FIG. 4 is a schematic diagram of the construction of pCMV-EGFP-pH1-shRNA688 plasmid;

FIG. 5 is a schematic diagram of the construction of pCMV-SARS-CoV-2-RBD-EST-RFP plasmid;

FIG. 6 is a schematic diagram showing the ligation of the insert (gene sequence is shown in bold underlining) of the RBD and a portion of the downstream region (813 nt) following the RBD of SARS-CoV-2Delta S protein to the RFP gene;

FIG. 7 is a fluorescent image analysis (10X objective lens, come card) of S protein RBD-RFP fusion gene, shRNA250 and EGFP gene transfected cells, wherein; after co-transfection (in daylight) cell growth; (B) the cell expressing RFP has green fluorescence; the EGFP gene expressed by the cell has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, eventually appearing yellow after the images were merged.

FIG. 8 shows fluorescent image analysis (10X objective lens, come card) of S protein RBD-RFP fusion gene, shRNA544 and EGFP gene transfected cells; wherein; after co-transfection (in daylight) cell growth; (B) the cell expressing RFP has green fluorescence; (C) red fluorescence exists when the EGFP gene is expressed by the cell; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, eventually appearing yellow after the images were merged.

FIG. 9 is a fluorescent image analysis (10X objective lens, come card) of S protein RBD-RFP fusion gene, shRNA463 and EGFP gene transfected cells; wherein; after co-transfection (in daylight) cell growth; (B) the cell expressing RFP has green fluorescence; (C) red fluorescence exists when the EGFP gene is expressed by the cell; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, eventually appearing yellow after the images were merged.

FIG. 10 is a fluorescent image analysis (10X objective lens, come card) of S protein RBD-RFP fusion gene, shRNA688 and EGFP gene transfected cells; wherein; after co-transfection (in daylight) cell growth; (B) the cells express RFP and have green fluorescence; (C) red fluorescence exists when the EGFP gene is expressed by the cell; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, eventually appearing yellow after the images were merged.

FIG. 11 shows fluorescent image analysis (10X objective lens, come card) of S protein RBD-RFP fusion gene, shRNA blank control and EGFP gene transfected cells; wherein; after co-transfection (in daylight) cell growth; (B) the cell expressing RFP has green fluorescence; the EGFP gene expressed by the cell has red fluorescence; (D) When cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, eventually appearing yellow after the images were merged.

FIG. 12 shows the efficiency of shRNA688 degradation of the new coronavirus S protein EST.

FIG. 13 is shRNA688 of S protein gene targeting SARS-CoV-2. Delta.

Detailed Description

The invention is described in detail below with reference to the figures and specific embodiments. The following examples, which are set forth to provide a detailed description of the invention and a detailed description of the operation, will help those skilled in the art to further understand the present invention. It should be noted that the scope of the present invention is not limited to the following embodiments, and that several modifications and improvements made on the premise of the idea of the present invention belong to the scope of the present invention.

EXAMPLE 1 identification of Gene of interest

The multigenomic and S protein sequences of the SARS-CoV-2 variants, α, β, γ, δ and Onckrjon were obtained from genbank (https:// www.ncbi.nlm.nih.gov/nuccore/. The SRAS-CoV-2 was cluster-compared by the online tool of the UCSC genome browser (http:// genome. UCSC. Edu/cgi-bin/hgBlat) and the analytical system (Clustal Omega) (https:// www.ebi.ac.uk/Tools/msa/clustalo /). The conserved region was selected based on the sequence of the S protein gene of SRAS-CoV-2.

The invention selects RNAi target by analyzing the conserved and mutant sequence of SARS-CoV-2 mutant. The whole RNA genome of the SARS-CoV-2 mutant and its S protein gene were subjected to cluster analysis. The S protein genes can be identified by their localization in the RNA genome. In the SARS-CoV-2. Delta. Mutant genome, the S protein gene (3816 nt) starts at 21517nt and ends at 25332nt. The RBD (317-539 aa) sequence of the S protein (1271 aa) coding region of the genome (OL 903477.1) starts at 22465nt and ends at 23133nt.

Sequence described as sp | P0DTC2| SPIKE _ SARS 2) starts at 22465nt and ends at 23133nt (see FIG. 1). FIG. 1 is a cluster analysis of the RBD region of the S protein of SARS-CoV-2 variant: each RBD region had at least one peptide level mutation as shown by the two blocks (bold solid box). In these blocks, the mutations in the peptide sequence (blank background) are from different S protein RBD subtypes of the SARS-CoV-2 variant, including the Omicron variant within the dashed box. In the last line, the sequence containing the RBD and the part downstream after the RBD comes from Delta, and its 813nt cDNA was selected as the target for the shRNA of the present invention integrated into the RFP gene overexpression plasmid. The peptide region downstream (grey box) after RBD is highly conserved in all variants without any mutations.

Despite the different types of mutations in the RBD of the SARS-CoV-2S protein, the 813nt cDNA sequence (SEQ ID No. 1) encoding the RBD region part of the SARS-CoV-2Delta S protein gene and the highly conserved downstream region of the part after the RBD was selected as a potential shRNA target

Mutation and conserved region confirmation of SARS-CoV-2 variant S protein RBD: a published SARS-CoV-2Spike protein (S protein, surface glycoprotein subtype, YP _ 009724390) consists of 1273 amino acids. Among them, 223 amino acids (319-541) are used for a Receptor Binding Domain (RBD). RBDs are used to bind human ACE2 (https:// www.uniprot.org/unipretkb/P0 DTC 2). The S protein and the cDNA and protein sequence of RBD are used as reference to perform cluster analysis on the S protein gene of SARS-CoV-2 variant and the sequence of translation protein subtype thereof. The results indicate that each RBD of the S protein subtype has at least one amino acid mutation. There were several mutations in Omicrons BA.1, BA5.1.3, BA.5.2.1. However, there are conserved regions downstream of the RBD that are free of mutations. In this study, we selected a 813nt cDNA sequence encoding the major RBD region and the part downstream after RBD of SARS-CoV-2Delta S protein (FIG. 1). The cDNA sequence and its reverse complement were synthesized and annealed into fragments, and integrated with the RFP cDNA into a fusion gene in the pCMV RFP expression plasmid.

Example 2 design of shRNA

Based on RNAi principle, 4 shRNA sequences were designed. In this study, shRNA was designed based on the 813nt (SEQ ID No. 1) insertion sequence of Delta (see FIG. 2, table 1).

FIG. 2 shows shRNA250, shRNA463, shRNA544, and shRNA688 targeting the S protein gene of SARS-CoV-2 Delta. The S protein gene of SARS-CoV-2Delta and the position of the protein encoded by it are indicated.

TABLE 1 oligonucleotide sequences for construction of shRNA expression plasmids

Considering that shRNA not only for Delta but also for Omicrons and other variants, we finally selected shRNA688 near the downstream part after the S protein gene RBD, but a highly conserved region (fig. 3).

FIG. 3 shows shRNA688 targeting the downstream part of SARS-CoV-2s S protein gene RBD. The sense sequence of shRNA688 is "GGT GTT CTT ACT GAG TCT AAC" as shown in SEQ ID NO.10, which is within complete identity (in bold frame, upper region) after all RBDs of the SARS-CoV-2 variant S protein gene. If the sense sequence of shRNA688 is translated into a peptide sequence as a reference, it is "GVTTESN" (light box, lower panel), which is identical to all comparison peptide sequences of the S protein subtype, despite mutations in the RBD peptide sequence of the SARS-CoV-2 variant S protein.

shRNA688, whose sense sequence was "GGTGT TCTTA CTGAG TCTAA C", was downstream of the RBD gene of all SARS-CoV-2 variant S proteins and was identical (FIGS. 3 and 4).

The sense sequence (21 bp) of shRNA688 was chosen, and the target sequences of the S protein genes of SRAS-CoV-2 were identical. After the forward sequence (21 bp), there is a loop sequence with "TTCAAGAC". Thereafter, there was a reverse complement (21 bp) fragment and a poly (T) 6 fragment.

shRNA of shRNA688 matched not only to Delta but also to conserved regions of S protein mRNA in Omicrons and other mutants.

EXAMPLE 3 construction of plasmid

1. Construction of pCMV-EGFP-pH1-shRNA688 expression vector

This example provides the construction of a pCMV-EGFP-pH1-shRNA688 expression plasmid, comprising the following steps:

step 1, basic vector selection: for constructing the shRNA expression plasmid, pSIL-EGFP vector containing the marker gene pCMV-EGFP gene for gene transfection was used as a basic vector (https:// www.addgene.org/52675/sequences /). The constructed expression plasmid pCMV-EGFP-pH1-shRNA688 is prepared on the basis of a pSIL-EGFP vector containing an Enhanced Green Fluorescent Protein (EGFP) gene driven by a pCMV promoter and used for gene transfection of a marker gene.

2、pCMV-EGFP-pH1-shRNA688

2.1, the H1 promoter (108 bp) is one of the human RNA polymerase type III promoters; the H1 promoter (108 bp) was inserted into XhoI (1704) and HindIII (1725) restriction sites, and constructed upstream of the pCMV-EGFP region by XhoI and HindIII cleavage sites.

The annealed duplex of the shRNA688 forward strand (showing 4 elements) and its reverse complement were integrated downstream of the H1 promoter with HindIII (1725) and EcoRI (1737) restriction sticky ends and confirmed by Sanger sequencing.

The shRNA688 cDNA contains 4 elements. The sense sequence is "GGT GTT CTT ACT GAG TCT AAC", loop "TTC AAG AGC", antisense "GTT AGA CTC AGT AAG AAC ACC", and terminates "TTT". Sanger sequencing confirmed the H1 promoter and shRNA688. The constructed plasmid carries the pCMV promoter for driving the expression of the EGFP marker gene and the human H1 promoter for driving the expression of the shRNA688, wherein the shRNA688 is designed for targeting the S protein transcript of SARS-CoV-2. (FIG. 4)

The double-stranded DNA of shRNA688 is constructed at the downstream of a human H1 promoter of the plasmid, and the plasmid can also express an Enhanced Green Fluorescent Protein (EGFP) marker gene at the same time. RNAi treatment degrades mRNA of SARS-CoV-2S protein gene transcripts expressed in co-transfected HEK293T cells as analyzed by fluorescent quantitative reverse transcription polymerase chain reaction (qRT-PCR) plus specific probes. The result shows that the shRNA688 can effectively reduce the mRNA of a SARS-CoV-2S protein gene transcript. The designed shRNA688 structures and their sequences are in the list (table 1).

As shown in FIG. 4, the constructed EGFP marker gene and shRNA688 of the SARS-CoV-2S protein gene transcript were co-expressed in plasmid named pCMV-EGFP-pH1-shRNA688. The pSIL EGFP expression plasmid was used as the basic vector. The human H1 promoter (108 bp) was inserted into the XhoI and HindIII restriction sites. The shRNA688 forward strand (showing 4 elements) and its reverse complement were annealed double-stranded, integrated in the downstream H1 promoter by HindIII and EcoRI restriction cohesive ends, and confirmed by Sanger sequencing.

2. Construction of plasmids corresponding to shRNA250, shRNA463 and shRNA544

The method for constructing plasmids shRNA250, shRNA463 and shRNA544 is the same as the method for constructing shRNA688.

EXAMPLE 4 construction of plasmid expressing fusion gene of SARS-CoV-2S protein containing RBD fragment and RFP

1. Construction of fusion gene expression plasmid (pCMV-SARS-CoV-2-RBD-EST-RFP) containing RBD fragment and RFP of SARS-CoV-2S protein

Constructing RBD EST of SARS-CoV-2Delta S protein and mCherry-Red Fluorescent Protein (RFP) fusion gene on the basis of pLVX-IRES mCherry RFP plasmid. Used for expressing potential targets to evaluate the effectiveness of shRNA interference.

1.1 selection and preparation of SARS-CoV-2Delta S protein gene RBD-containing fragment

One published surface glycoprotein subtype of SARS-CoV-2 (YP _ 009724390) consists of 1273 amino acids. Among them, 223 amino acids (319-541) belong to the Receptor Binding Domain (RBD). RBDs are used for binding to human ACE2 (https:// www.uniprot.org/uniprotkb/P0DTC 2/entry). The S protein gene sequence, especially RBD gene component and protein sequence, is used as reference for cluster analysis of SARS-CoV-2 variants and its protein subtype. The results indicate that there is at least one amino acid mutation in each RBD of the S protein subtype. There were multiple mutations in the Ormckh mutants BA.1, BA5.1.3, BA.5.2.1. However, there were no mutations in the conserved regions downstream of the RBD.

A fragment (813 bp) comprising the RBD sequence (EST) was selected from the S protein of the SARS-CoV-2Delta variant based on a cluster analysis of the SARS-CoV-2 variant S protein sequence. This is a region that contains not only the specific mutations possessed by the SARS-CoV-2Delta S protein gene but also conserved regions shared with those contained by Omicron B.1, B.5 and other SARS-CoV-2S protein genes.

To construct this EST expression plasmid containing the S protein RBD, the sequence of this fragment (813 bp) was synthesized as a sense strand, which was reverse-complementary as an antisense strand, with a small number of nucleotides added at both ends. After annealing the plus and minus strands to a double-stranded DNA fragment with a reconstructed sticky end, a5 '-end XhoI sticky end (C' TCGAG) and a 3 '-end KpnI (GGTAC' C) sticky end were formed.

The 813nt cDNA sequence encoding the most RBD region and part downstream after RBD of SARS-CoV-2. Delta.S protein was selected. The cDNA sequence and its reverse complement were synthesized and annealed into a fragment that was integrated with mCherry Red Fluorescent Protein (RFP) cDNA as a fusion gene in pCMV RFP expression plasmid as a potential target for shRNA688.

1.2 construction of expression plasmid containing RBD fragment of SARS-CoV-2S protein and fusion gene of RFP

The pLVX IRES mCherry RFP vector (Takara Bio USA) comprising CMV promoter, multiple Cloning Site (MCS), mCherry-Red Fluorescent Protein (RFP) gene and 3' LTR and the like was used as a basic vector for RBD-containing EST expressing SARS-CoV-2S protein gene.

In this vector MCS, there are restriction sites for XhoI (2809) and SacII (2834). The vector has two SacII (CCGCGG) and two KpnI (GGTACC) cutting sites. Their cleavage sites were SacII (2834), kpnI (3289), sacII (4644) and KpnI (4869).

We chose to use the pLVX IRES mCherry RFP plasmid as the basic vector. In the pLVX IRES mCherry RFP plasmid, pCMV drives mCherry RFP gene expression. We removed most of the IRES of this plasmid between XhoI (CTCGAG) and KpnI (GGTACC). The synthesized DNA fragment containing the sense strand (813 nt) encoding most of the S protein and the reverse complementary strand thereof was annealed to double strands. And this DNA fragment was successfully integrated into the plasmid. Constructs the pCMV-SARS-CoV-2-RBD-EST-RFP plasmid expressed by the gene component of the SARS-CoV-2S protein and the mCherry Red Fluorescent Protein (RFP) fusion gene. The transcripts expressed from the fusion gene can be used as targets to test for interference by shRNA (figure 5).

As shown in FIG. 5, the plasmid pCMV-RBD-EST, which is a fusion gene of SARS-CoV-2S protein and RFP, was constructed and named (pCMV-SARS-CoV-2-RBD-EST-RFP). The DNA fragment synthesized and annealed double-stranded had XhoI cohesive end (C 'TCGAG) at the 5' end and KpnI (GGTAC 'C) cohesive end at the 3' end. The sense strand of the DNA fragment (813 nt) encodes the majority of the RBD of the SARS-CoV-2Delta S protein. 3' LTR terminates transcription as polyadenylation signal.

For construction, the empty vector (Takara Bio USA) was double digested with the enzymes XhoI and SacII.

The method comprises the following specific steps:

the circular plasmid pLVX IRES mCherry RFP was first opened with XhoI (C' TCGAG). Obtaining digested vector DNA from a 0.8% agarose gel; the recovered DNA was further digested with Sac II (CCGC' GG). Two fragments from the double digestion vector, fragment 1 (as shown in SEQ ID No. 20) and fragment 2 (as shown in SEQ ID No. 21), were separated on a 1% agarose gel (Shanghai-source Biotech, inc.). Fragment 1 (6337 bp) has a SacII (CCGC ' GG) sticky end at the 5' end and an XhoI (C ' TCGAG) sticky end at the '3' end; fragment 2 (1810 bp) had SacII (CCGC' GG) sticky ends at both ends. Further digestion of fragment 2 with KpnI (GGTAC' C) gave fragment 2.1 (454 bp, as SEQ ID No. 22) and fragment 2.2 (1356 bp, as SEQ ID No. 23); wherein fragment 2.2 (1356 bp) has a KpnI (GGTAC 'C) sticky end at the 5' end and a SacII (CCGC 'GG) sticky end at the 3' end; fragment 2.2 (1356 bp) and fragment 2.1 (454 bp) were further separated on a 1.5% agarose gel. Obtaining a fragment 2.2 (1356 bp) with a KpnI sticky end (5 ') and a SacII sticky end (3') from the gel; then, three fragments, two of fragment 1 (6337 bp) and fragment 2.2 (1356 bp) from pLVX-IRES-mCherry vector, and the other fragment, a double-stranded DNA fragment (825 bp) encoding most of the SARS-CoV-2S protein RBD and part of the downstream region after RBD (813bp, SEQ ID NO. 1) and carrying XhoI (C 'TCGAG) and KpnI (GGTAC' C) cohesive ends, were ligated and closed into an expression plasmid using T4 DNA ligase (5 u/. Mu.L) (Thermo Fisher Scientific). The constructed plasmid was called pCMV-S protein RBD-EST-RFP (pCMV-SARS-CoV-2-RBD-EST-RFP). The insert region of the plasmid was confirmed by Sanger sequencing (fig. 1).

The 813nt insert integrated with the RFP gene was confirmed by Sanger sequencing as a fusion gene. The insert theoretically encodes most of the SARS-CoV-2Delta S protein RBD and part of the downstream region 813nt (SEQ ID No. 1) after RBD, but the insert of 813nt starts at a position downstream of the S protein "M" coding start "ATG". Therefore, 813nt insertion of the RFP fusion gene only expressed mRNA, and did not produce any fusion protein (fig. 6).

FIG. 6 shows the ligation of RFP gene to the insert (gene sequence shown by bold underlining) of RBD and a portion of the downstream region (813 nt) following RBD of SARS-CoV-2Delta S protein. The insert is located between the 5 'restriction site, xhoI (CTCGAG, in the box before the 813nt sequence) and the 3' restriction site KpnI (GGTACC, in the box after the 813nt sequence). The RBD (water-wave underlined) and downstream (following the RBD region and preceding the KpnI restriction site (GGTACC, in box)) regions of the S protein Delta are theoretically encoded it is clear that 813nt taken in this study does not have an "ATG" to form a potential fusion protein.

2. Testing of interference Effect of different shRNAs

2.1 test methods

Human cell line HEK293T cells (ATCC) were cultured in a humidified incubator containing 5% CO2 (all reagents from Saimer Feishell scientific Co.) at 37 ℃ in the presence of 10% Fetal Bovine Serum (FBS), 1% antibiotics (100. Mu.g/mL penicillin, 100. Mu.g/mL streptomycin), 2mM glutamine, and 1.5mg/mL sodium bicarbonate. Subcultured HEK293T cells were used for transient transfection experiments. Cell suspension diluted to 1X 10 ⁵ Individual cells/mL, seeded in 6-well plates. When the cells grew to 70%, they were washed with Phosphate Buffered Saline (PBS).

The use of liposome to DNA ratio (1:3) mediated liposome 2000 as suggested by the transfection reagent manufacturer will co-transfect HEK293T cells according to the experimental groups described in the table below.

2.2 test results

(1) Fluorescent image analysis of S protein RBD-RFP fusion gene, shRNA and EGFP gene transfected cells

Transgene expression was detected and verified under a fluorescent microscope 24 hours after transfection. Red or green fluorescent cells were observed with a fluorescence microscope system (10-fold magnification, lycra DMIL LED, germany). Fluorescent cells (red or/and green fluorescence) in the cultured cells (under normal light) were observed. An image is captured. The captured images were overlaid using software matched to microscope images and cells co-expressing the RFP and EGFP genes were analyzed to understand the efficiency of the double transfection.

There are 3 total classes of transfected cells:

first, plasmid transfected with pCMV-S protein RBD-EST-RFP fusion gene

(pCMV-SARS-CoV-2-RBD-EST-RFP) that fluoresces in red;

second, cells transfected with any one of plasmids pCMV-EGFP-pH1-shRNA250, pCMV-EGFP-pH1-shRNA463, pCMV-EGFP-pH1-shRNA544, pCMV-EGFP-pH1-shRNA688 and pCMV-EGFP-pH1-shRNA blank Control (Control group) fluoresce green;

in the third category, transfected cells receive both plasmids; the transfected cells expressed both red and green fluorescence, and after computer image overlay, the co-transfected cells appeared to be yellow in fluorescence (D in FIGS. 7-11).

As shown in FIGS. 7-11, 1 day after transfection, the transfected cells were observed under a fluorescence microscope with red or green fluorescence filters, respectively (10X objective, leica). In the test: fig. 7 (a), fig. 8 (a), fig. 9 (a), fig. 10 (a), fig. 11 (a) cells grew after co-transfection (in sunlight). Fig. 7 (B), fig. 8 (B), fig. 9 (B), fig. 10 (B), and fig. 11 (B) show green fluorescence in cells expressing RFP. The cells of FIGS. 7 (C), 8 (C), 9 (C), 10 (C) and 11 (C) express EGFP gene and have red fluorescence. Fig. 7 (D), fig. 8 (D), fig. 9 (D), fig. 10 (D), fig. 11 (D) when cells in culture were transfected with both plasmids, some cells had both red and green fluorescence, and finally appeared yellow after the images were merged.

(2) Targeted degradation assay

Used for detecting the expression level of the RBD EST of the SARS-CoV-2S protein inhibited by shRNA.

a. Nucleic acid extraction and strand-specific cDNA Synthesis

HEK293T cells co-transfected with the pCMV-EGFP-pH1-shRNA plasmid and the pCMV-S protein RBD-EST-RFP fusion gene (pCMV-SARS-CoV-2-RBD-EST-RFP) plasmid exhibit green and red fluorescence.

qRT-PCR was performed and statistical analysis was performed on the data. The experiment was repeated three more times. For quantitative RT-PCR, total RNA from transfected cells was extracted 24 hours after transfection using the FastPure cell/tissue Total RNA isolation kit V2 (Vazyme RC112, china). The cells in each well were lysed with the buffer in the kit. After that, the subsequent steps are performed according to the manufacturer's instructions. The mass and concentration of total RNA eluted in each sample was measured with a Nanodrop2000 spectrophotometer (Thermo Scientific, waltham, MA, USA); samples with a A260/280 ratio between 1.8 and 2.2 were considered for the next step. Using HiScript III 1 st strand cDNA Synthesis kit (+ gDNA wiper) (Vazyme R312-01/02, china) and oligonucleotide (dT) as primers, cDNA was prepared from 1. Mu.g of total RNA at 45 ℃.

b quantitative targeting of SARS-CoV-2 transcript by RT-qPCR

The SARS-CoV-2S protein RBD-EST and housekeeping gene transcripts in cultured cells were quantitatively transfected by RT-qPCR. Total RNA and cDNA were prepared as described above. RT-qPCR was performed using AceQ Universal U + probe Master Mix V2 (Vazyme Q513, china). For each reaction, 10. Mu.L of "2X AceQ Universal U + Probe Master Mix V2", 0.4. Mu.L of sense primer (10. Mu.M), 0.4. Mu.L of antisense primer (10. Mu.M), the targeting S protein RBD specific probe (10. Mu.M) and sample cDNA containing ddH2O, in a total volume of 20. Mu.L.

Primers and targeted S protein RBD specific probes that we designed and used are listed in table 2. Cycling conditions for RT-qPCR were incubation at 37 ℃ for 2 minutes, initial denaturation at 95 ℃ for 5 minutes, followed by 45 amplification cycles using Light Cycler480 (Basel Roche, switzerland) at 95 ℃ and 60 ℃ for 10 seconds and 30 seconds, respectively. The number of transcripts was normalized by the amount of GAPDH transcript. Using criteria 2 ^-ΔCt And (3) calculating the target degradation effect of the shRNA on the expression of the RBD EST by a quantitative method.

TABLE 2 primers and probes for RT-qPCR for detection of SARS-CoV-2S protein RBD-EST degradation by shRNA

(3) RT-qPCR detection of S protein Est efficiency of shRNA250, shRNA463, shRNA544 and shRNA688 degrading and transfecting HEK293T gene

The HEK293T cell is co-transfected by 4 plasmids of pCMV-EGFP-pH1-shRNA250, pCMV-EGFP-pH1-shRNA463, pCMV-EGFP-pH1-shRNA544 and pCMV-EGFP-pH1-shRNA688 and pCMV-S protein RBD (pCMV-SARS-CoV-2-RBD-EST-RFP) containing EST-RFP fusion gene plasmid, and then the cell has green and red fluorescence. Total RNA from each transfection was isolated and cDNA was prepared. RT-qPCR was performed and statistical analysis was performed on the data.

The results show that the EST content of S protein was significantly lower in the pH1-shRNA688 treated cells than in the other groups, while the remaining 3 shrnas (shRNA 250, shRNA463 and shRNA 544) did not significantly degrade S protein (table 3).

TABLE 3 RT-qPCR detection of degradation efficiency of different shRNAs on New coronavirus S protein ESTs

We repeated three experiments with pH1-shRNA688, and the obtained results all showed that the transcription concentration of S protein mRNA Est (813 bp) in transfected cells after shRNA688 treatment was significantly reduced compared with the control group. Although the concentration of the S protein mRNA Est813 varied in each experiment, their degradation rates were at similar levels. The S protein mRNA Est813 degradation for three experiments is shown as A:0.465, B:0.531 and C:0.462. Mean and standard error was 0.486 ± 0.039 (table 4, figure 12), and shRNA688 was selected to target a conserved region near downstream after the RBD coding region of the SARS-CoV-2delta variant S protein (figure 13).

TABLE 4 degradation efficiency of RT-qPCR repeated detection shRNA688 on new coronavirus S protein EST

As shown in FIG. 12, the degradation rate (D.R) was at a similar level, although the starting amount of the S protein mRNA Est813 varied in each experiment. The transcript concentration of S protein mRNA Est (813 bp) in shRNA688 treated (dark bars) transfected cells was significantly reduced compared to the control (light bars). This region is a conserved region located after the new coronavirus S protein RBD (FIG. 12).

As shown in FIG. 13, shRNA688 of the S protein gene of SARS-CoV-2. Delta. Was targeted.

The S protein gene of SARS-CoV-2delta and the position of the protein encoded by it are indicated. The selected shRNA688 targets a conserved region immediately downstream after the RBD coding region of the SARS-CoV-2delta variant S protein.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention.

Claims

shRNA is characterized in that the sequence of the shRNA has a sense sequence of GGTGT TCTTA CTGAG TCTAA C as shown in SEQ ID NO. 10.
2. An shRNA according to claim 1, characterised in that it comprises the following sequence:

AGCTTGGTGTTCTTACTGAGTCTAACTTCAAGAGCGTTAGACTCAGTAAGAACACCTTTTTTG as shown in SEQ ID No. 8.
3. An shRNA according to claim 1, characterised in that it comprises the following oligonucleotide combinations:

shRNAF:

AGCTTGGTGTTCTTACTGAGTCTAACTTCAAGAGCGTTAGACTCAGTAAGAACACCTTTTTTG as shown in SEQ ID No. 8;

shRNA R:

AATTCAAAAAAGGTGTTCTTACTGAGTCTAACGCTCTTGAAGTTAGACTCAGTAAGAACACCA as shown in SEQ ID No. 9.
4. A recombinant plasmid comprising the shRNA according to any one of claims 1 to 3.
5. The recombinant plasmid of claim 4, further comprising a human H1 promoter for driving shRNA expression, and a pCMV promoter for driving green fluorescent protein EGFP gene expression.
6. A method for constructing the recombinant plasmid according to claim 4, comprising the steps of:

s1, taking a pSIL-EGFP vector containing a gene transfection marker pCMV-EGFP gene as a basic vector;

s2, constructing a human RNA polymerase III type promoter H1 promoter at the upstream of a pCMV-EGFP region through XhoI and HindIII enzyme cutting sites;

s3 and shRNA are integrated at the downstream of the H1 promoter through HindIII and EcoRI construction sites.
7. A novel coronavirus S protein inhibitor, comprising at least one of:

a. the shRNA according to claim 1 or 2;

b. the recombinant plasmid of claim 3.
8. A kit, comprising at least one of:

A. the shRNA according to claim 1 or 2;

B. the recombinant plasmid of claim 3;

C. the novel coronavirus S protein gene inhibitor of claim 7.
9. Use of an shRNA according to claim 1 or 2 for the preparation of a medicament for the treatment of a neocoronavirus.
10. The use of claim 9, wherein the shRNA is used in targeted interference with SARS-CoV-2.
11. A method for screening specific shRNA of targeted interference new coronavirus S protein is characterized by comprising the following steps:

the 813nt fragment of the S protein gene extracted from SARS-CoV-2 is used as shRNA target, the nucleotide sequence is shown in SEQ ID NO.1, and the target comprises the RBD region part of the S protein gene and the highly conserved downstream region part after the RBD.