CN112933112B - Application of graphene oxide or regulating and controlling molecule thereof in preparation of medicine for promoting diabetic wound repair - Google Patents

Abstract

The invention discloses application of graphene oxide or a regulatory molecule thereof in preparation of a medicine for promoting diabetic wound repair. The research of the invention finds that the graphene oxide plays a role in inhibiting Ad-MSC apoptosis by regulating Linc00324 so as to promote the wound repair of diabetes. According to the research results of the invention, the apoptosis inhibitor for culturing Ad-MSC in vitro and the medicine for promoting the diabetic wound repair can be developed.

Description

Application of graphene oxide or regulating and controlling molecule thereof in preparation of medicine for promoting diabetic wound repair

Technical Field

The invention relates to the field of biomedicine, in particular to application of graphene oxide or a regulatory molecule thereof in preparing a medicament for promoting diabetic wound repair.

Background

The formation of chronic diabetic wounds is associated with a number of factors. In humans, stem cells play an important role in wound repair. Currently, a variety of Stem cells including Ad-MSC (Adipose-depleted Mesenchymal Stem Cell) have been used to treat diabetic wounds. After the body is damaged, the Ad-MSC in the body can mobilize and tend to the damaged part, and the wound repairing effect is achieved. However, in high glucose environments, apoptosis of Ad-MSCs increases, impairing wound repair capacity. GO (graphene oxide ) is an important derivative of graphene, and has been widely used in biomedical fields such as disease detection and regenerative medicine. Studies show that GO related materials have an antibacterial effect, which makes them promising for use in the field of wound healing. Research shows that GO promotes stem cell differentiation and influences adhesion and proliferation of human adipose-derived stem cells, but the effect of GO on apoptosis is not researched. Thus, the present application designed relevant experiments to study the role of GO in apoptosis and diabetic wound healing.

RNAs between genes that are greater than 200bp in length and do not encode proteins are called long noncoding RNAs (LncRNAs). A variety of lncrnas have been identified and their roles in cell proliferation, apoptosis, invasion have been clearly demonstrated. Among them, Linc00324 has been shown to be involved in cell proliferation, invasion and migration in many studies, but its role in apoptosis is not clear. miRNA is a non-coding RNA with the length of 19-24nt, which exists in eukaryotes. In recent studies, LncRNA has been shown to bind to mirnas with competing endogenous rnas (cerana). For example, Linc00324, as a ceRNA, promotes the proliferation, migration, and invasion of colorectal cancer cells by targeting miR-214-3 p. MEG3 acts as a ceRNA that regulates ischemic neuronal death by targeting the miR-21/PDCD4 signaling pathway. However, no research report on the role and mechanism of Linc00324 in Ad-MSC exists at present.

Disclosure of Invention

The application experiment proves that the apoptosis of the Ad-MSCs is increased in a high-glucose environment. GO reduces apoptosis in high glucose environments through Linc 00324. The research result of the invention shows that GO and Linc00324 can both regulate the apoptosis of Ad-MSC. Therefore, GO or Linc00324 can be used as a new target for treating diabetic wounds.

Specifically, the invention provides the following technical scheme:

according to one aspect of the invention, the invention provides application of graphene oxide or a regulatory molecule thereof in preparation of a medicament for inhibiting high-sugar-induced apoptosis of Ad-MSCs.

Further, the regulatory molecule of the graphene oxide is Linc 00324.

Further, the high sugar means that the concentration of glucose in a culture medium or the concentration of blood sugar of an experimental animal is more than or equal to 16.7 mmol/L.

According to another aspect of the invention, the invention provides an application of graphene oxide or a regulatory molecule thereof in preparing a medicament for promoting diabetic wound repair.

Further, the regulatory molecule of the graphene oxide is Linc 00324.

According to yet another aspect of the present invention, there is provided a medicament for inhibiting high sugar-induced apoptosis of Ad-MSCs, the medicament comprising an inhibitor of graphene oxide or a regulatory molecule thereof.

Further, the regulatory molecule of the graphene oxide is Linc 0032.

Further, inhibitors of Linc00324 include agents that inhibit the expression of Linc 00324.

According to a further aspect of the present invention, there is provided a medicament for promoting diabetic wound repair, the medicament comprising an inhibitor of graphene oxide or a regulatory molecule thereof.

Further, the regulatory molecule of the graphene oxide is Linc 00324.

Further, inhibitors of Linc00324 include agents that inhibit the expression of Linc 00324.

According to still another aspect of the present invention, the present invention provides a pharmaceutical composition for inhibiting high sugar-induced apoptosis of Ad-MSCs or promoting diabetic wound repair, the pharmaceutical composition comprising any one of:

1) graphene oxide, at least one other pharmaceutically active ingredient and/or at least one other non-pharmaceutically active ingredient;

2) an inhibitor of a regulatory molecule of graphene oxide, at least one other pharmaceutically active ingredient and/or at least one other non-pharmaceutically active ingredient;

3) graphene oxide, an inhibitor of a regulatory molecule of graphene oxide, at least one further pharmaceutically active ingredient and/or at least one further non-pharmaceutically active ingredient;

preferably, the regulatory molecule of graphene oxide is Linc 00324; preferably, the inhibitor of Linc00324 comprises an agent that inhibits expression of Linc 00324.

According to yet another aspect of the present invention, there is provided a method of inhibiting high sugar-induced apoptosis of Ad-MSCs in vitro, the method comprising administering an inhibitor of graphene oxide or a regulatory molecule thereof.

Further, the regulatory molecule of the graphene oxide is Linc 00324.

According to yet another aspect of the present invention, there is provided a method of screening for a drug that inhibits high sugar-induced apoptosis of Ad-MSCs, the method comprising contacting a system expressing a regulatory molecule of graphene oxide with a candidate compound; determining whether the candidate compound alters expression of a regulatory molecule of graphene oxide.

Further, the regulatory molecule of the graphene oxide is Linc 00324. If Linc00324 expression is down-regulated, the candidate compound is a drug capable of inhibiting the high-sugar-induced apoptosis of Ad-MSCs.

According to a further aspect of the present invention there is provided a method of screening for a medicament for promoting diabetic wound repair, the method comprising contacting a system expressing a regulatory molecule for graphene oxide with a candidate compound; determining whether the candidate compound alters expression of a regulatory molecule of graphene oxide.

Further, the regulatory molecule of the graphene oxide is Linc 00324. If Linc00324 expression is down-regulated, the candidate compound is a drug capable of promoting diabetic wound repair.

The system of the invention is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

Methods for detecting expression of Linc00324 include, but are not limited to: reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, Ribonuclease Protection Assay (RPA), northern blotting, and DNA chips.

Reagents for detecting expression of Linc00324 include, but are not limited to, primers, probes, or antisense nucleotides. One skilled in the art can design primers, probes, or antisense nucleotides that specifically bind to Linc00324 based on the Linc00324 information.

The agent for inhibiting the expression of Linc00324 is not limited as long as the agent can inhibit the expression or activity of Linc00324 or factors related to the upstream or downstream pathway of Linc00324, and can inhibit apoptosis of Ad-MSCs induced by high sugar or promote wound repair of diabetes.

Further, the agent for inhibiting the expression of Linc00324 comprises antisense nucleic acid, dsRNA, ribozyme and aptamer.

"antisense nucleic acid" refers to a nucleic acid comprising a sequence complementary to a sequence encoding Linc 00324. Antisense nucleic acids can be composed of DNA, RNA, or both. The antisense nucleic acid may contain non-complementary bases as long as it is capable of specifically hybridizing under stringent conditions. When an antisense nucleic acid is introduced into a cell, it binds to the target polynucleotide and inhibits transcription, RNA processing, or stability. In addition to antisense polynucleotides, antisense nucleic acids also include polynucleotide mimetics that include a modified backbone, and 3 'and 5' terminal portions. Such antisense nucleic acids can be appropriately designed based on the Linc00324 sequence information and generated using methods well known to those skilled in the art.

"dsRNA" refers to RNA containing a double-stranded RNA structure that inhibits gene expression by RNA interference (RNAi), including siRNA (short interfering RNA) and shRNA (short hairpin RNA). The dsRNA need not have 100% homology with the target gene sequence as long as it can inhibit the target gene expression. A portion of the dsRNA may be replaced with DNA for stabilization or other purposes. Preferably, the siRNA is a double stranded RNA of 21-23 bases. siRNA may be prepared by methods well known to those skilled in the art, for example by chemical synthesis or as analogues of naturally occurring RNA. shRNA is a short-chain RNA having a hairpin turn (hairpin turn) structure. The shRNA can be prepared by methods well known to those skilled in the art, for example, by chemical synthesis or by introducing a DNA encoding the shRNA into a cell and expressing the DNA.

"ribozyme" refers to an RNA having catalytic activity that is capable of cleaving, attaching, inserting, and transferring RNA. The structure of ribozymes may include hammerheads, hairpins, and the like.

"aptamer" refers to a nucleic acid that binds to a substance, such as a protein. Aptamers can be RNA or DNA. The nucleic acid may be in double-stranded or single-stranded form. The length of the aptamer is not limited as long as it can specifically bind to a target molecule, and may be composed of, for example, 10 to 200 nucleotides, preferably 10 to 100 nucleotides, more preferably 15 to 80 nucleotides, and further more preferably 15 to 50 nucleotides. Aptamers can be selected using methods well known to those skilled in the art. For example, SELEX (systematic evolution of ligands by exponential enrichment) can be employed.

The pharmaceutically inactive ingredients of the present invention include a pharmaceutically acceptable carrier.

The phrase "pharmaceutically acceptable carrier" is art-recognized and includes, for example, pharmaceutically acceptable materials, compositions or excipients, such as liquid or solid fillers, diluents, solvents or encapsulating materials, involved in carrying or transporting any subject composition from one organ or portion of the body to another organ or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not injurious to the patient. In certain embodiments, the pharmaceutically acceptable carrier is pyrogen-free. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered gum tragacanth; (5) malt; (6) gelatin; (7) talc powder; (8) cocoa butter and suppository waxes; (9) oils such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible materials used in pharmaceutical formulations.

The medicament of the present invention may be administered alone or together with other medicaments as a medicine. The other drug that can be administered together with the drug of the present invention is not limited as long as it does not impair the effect of the therapeutic or prophylactic drug of the present invention.

The medicine of the present invention may be prepared into various preparation forms. Including, but not limited to, tablets, solutions, granules, patches, ointments, capsules, aerosols or suppositories for transdermal, mucosal, nasal, buccal, sublingual or oral use.

The route of administration of the drug of the present invention is not limited as long as it exerts the desired therapeutic or prophylactic effect, and includes, but is not limited to, intravenous, intraperitoneal, intraocular, intraarterial, intrapulmonary, oral, intravesicular, intramuscular, intratracheal, subcutaneous, transdermal, transpleural, topical, inhalation, mucosal, cutaneous, gastrointestinal, intraarticular, intraventricular, rectal, vaginal, intracranial, intraurethral, intrahepatic. In some cases, the administration may be systemic. In some cases topical administration.

The dose of the drug of the present invention is not limited as long as the desired therapeutic effect or prophylactic effect is obtained, and can be appropriately determined depending on the symptoms, sex, age, and the like. The dose of the therapeutic agent or prophylactic agent of the present invention can be determined using, for example, the therapeutic effect or prophylactic effect on a disease as an index.

The invention has the advantages and beneficial effects that:

the invention discloses that graphene oxide can inhibit apoptosis of Ad-MSCs for the first time, and can be used as an apoptosis inhibitor in-vitro culture of Ad-MSCs.

The research of the invention finds that Linc00324 is used as the downstream molecule of graphene oxide to participate in apoptosis of Ad-MSCs, so that the Linc00324 can be used as a target spot to prepare an apoptosis inhibitor for in vitro culture of Ad-MSCs, and in addition, the Linc00324 can be used as a target spot to develop a medicine for promoting the repair of diabetic wound surfaces.

Drawings

FIG. 1 shows a graph of the results of GO on the high sugar induced apoptosis of Ad-MSCs, where A: a streaming graph; b: a stream result statistical chart; c: TUNEL results plot; d: TUNEL results statistical plots;

FIG. 2 shows a graph of the results of GO effect on apoptosis-related factor expression during hyperglycemia-induced apoptosis of Ad-MSCs, where A: a western blot; b: a statistical map of western blot results;

fig. 3 shows a graph of the results of GO on Linc00324 expression, where a: gene sequencing result graph; b: a qPCR histogram; c: a result graph of the effect of different GO concentrations on Linc00324 expression under high-sugar conditions; d: a result graph of the effect of different GO concentrations on Linc00324 expression under non-high sugar conditions;

FIG. 4 shows graphs showing the results of Linc00324 expression assays in Linc00324 expression downregulated cell lines and overexpressed cell lines, where A: an immunofluorescence profile; b: a qPCR histogram;

fig. 5 shows a graph of the results of the effect of Linc00324 expression on apoptosis, where a: TUNEL results plot; b: TUNEL results statistical plots; c: a streaming graph; d: a stream result statistical chart; e: immunoblot patterns of apoptosis-related factor expression;

fig. 6 shows a graph of the effect of co-culture of a cell line highly expressing Linc00324 with GO on apoptosis, where a: TUNEL results plot; b: TUNEL results statistical plots; c: a streaming graph; d: a stream result statistical chart;

fig. 7 shows a graph of the results of the Linc00324 localization, where a: (ii) a nucleic acid electropherogram; b: a qPCR histogram;

FIG. 8 shows a graph of the results of Linc00324 expression on miR-7977 expression regulation;

FIG. 9 shows a graph of the results of detecting miR-7977 localization using FISH assay;

FIG. 10 shows a result chart of predicting the action site of Linc00324 in miR-7977, in which A: schematic diagram of experimental scheme; b: a result graph;

fig. 11 shows a graph of the results of detecting binding between miR-7977 and Linc00324, where a: RIP experiment; b: in vitro affinity experiments;

FIG. 12 is a graph showing the results of the effect of miR-7977 inhibitors on the expression level of Linc 00324;

FIG. 13 shows a graph of the results of flow cytometry analysis of the effect of miR-7977 mimetics on apoptosis of Ad-MSCs in a high sugar environment, wherein A: a streaming graph; b, flow type statistical chart;

FIG. 14 shows a graph of the results of analyzing the effect of miR-7977 mimetics on apoptosis of Ad-MSCs in high sugar environments using the TUNEL method, wherein A: TUNEL results plot; b: TUNEL results statistical plots;

figure 15 shows a graph of the results of miR-7977 mimetics on the expression of apoptosis-related factors, where a: a western blot; b: a western blot statistical map;

fig. 16 shows a graph of the results of detecting the effect of miR7977 on STK4 expression using a luciferase reporter, where a: a scheme of an experiment; b: a result graph;

fig. 17 shows a graph of the results of detecting the effect of miR7977 on STK4 expression using qPCR and Western blot experiments, wherein a: a western blot; b: a western blot result chart; c: a qPCR histogram;

FIG. 18 shows a graph of the results of flow cytometry analysis of the effect of XMU-MP-1 on apoptosis, where A: a streaming graph; b: a stream type statistical graph;

FIG. 19 is a graph showing the results of analysis of the effect of XMU-MP-1 on apoptosis using the TUNEL method, wherein A: TUNEL results plot; b: TUNEL results statistical plots;

FIG. 20 is a graph showing the results of analyzing the effect of XMU-MP-1 on apoptosis using Western blot;

figure 21 shows a graph of the results of flow cytometry analysis of the effect of miR-7977 mimetics on apoptosis, where a: a streaming graph; b: a stream type statistical graph;

figure 22 shows a graph of the results of analyzing the effect of miR-7977 mimetics on apoptosis using the TUNEL method, where a: TUNEL results plot; b: TUNEL results statistical plots;

FIG. 23 shows a graph of the results of analyzing the effect of miR-7977 mimetics on apoptosis using Western blot, A: a western blot; b: a western blot result graph;

figure 24 shows a graph of results of flow cytometry analysis of the effect of miR-7977 inhibitors on apoptosis, where a: a streaming graph; b: a stream type statistical graph;

fig. 25 shows a graph of the results of analyzing the effect of miR-7977 inhibitors on apoptosis using the TUNEL method, wherein a: TUNEL results plot; b: TUNEL results statistical plots;

FIG. 26 shows a graph of the results of analyzing the effect of miR-7977 inhibitor on apoptosis using Western blot, A: a western blot; b: a western blot result chart;

fig. 27 shows a result graph of GO detection on wound repair impact using fluorescent staining method, where a: a fluorescent substance picture; b: a statistical chart;

fig. 28 shows a graph of results characterizing wound healing effects using a wound healing index, where a: a real object diagram; b: a statistical chart;

FIG. 29 is a graph showing the results of HE staining of a tissue section;

FIG. 30 is a graph showing Masson staining results;

FIG. 31 shows a fluorescence plot of tissue immunofluorescence detecting CD31 and TNF-. alpha.expression;

FIG. 32 shows a histogram of tissue immunofluorescence detected CD31 and TNF-. alpha.expression, wherein A: TNF-alpha; b: CD 31;

FIG. 33 is a graph showing the results of ELISA detection of wound-healing-associated cell secretion.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. Experimental procedures without specific conditions noted in the examples, generally following conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations.

Examples

Method and device

1. Cell co-culture

Graphene oxide (GO (graphene oxide)) solutions at final concentrations of 0.1mg/ml (+), 0.2mg/ml (++), and 0.4mg/ml (+++) were added to Ad-MSCs medium at 37 deg.C with 5% CO₂While adding glucose to a final concentration of 16.7 mmol/L. After 48 hours of incubation, further experiments were performed.

2. CM-Dil staining

CM-Dil (Invitrogen, USA) labels cells by binding to lipid molecules of the membrane structure with strong and stable red fluorescence (excitation 420 nm/emission 488nm) detected by the Xenogen IVIS200 imaging system (Xenogen Corp).

3. Western blotting

Cell extracts were separated on SDS-polyacrylamide gels, and the proteins were then transferred to nitrocellulose membranes and incubated with rabbit polyclonal antibodies against STK4, anti-BIM, anti-Bax, anti-BCL-2, anti-AGO 2(1:500, Cell Signaling Technology) and monoclonal antibodies against beta-actin (1:1000, Cell Signaling Technology). Immunoreactive protein bands were detected using the Tanon scanning system (Tanon Science & Technology co., ltd., beijing, china).

4. Flow cytometry

Following experimental treatment, Ad-MSCs were stained with annexin V-Fluorescein Isothiocyanate (FITC)/PE (Roche, USA) for 1h at 37 deg.C, then detected by flow cytometry, and analyzed for apoptosis using FlowJo _ V10 software.

5. TUNEL assay

Terminal deoxynucleotidyl transferase mediated dUTP nick end labeling (TUNEL) assay (in situ cell death detection kit; roche diagnostics) was used to determine apoptosis of Ad-MSCs. Ad-MSCs were incubated with TdT and fluorescein-labeled dUTP for 45 min at 37 ℃. The percentage of apoptotic cells was then assessed.

6. RNA-pull down experiment

Pierce^TMMagnetic RNA protein pull down kit (Thermo Fisher Scientific, Massachusetts, USA) was used for RNA-pull down assay. The high-yield in vitro transcription kit (Thermo Fisher Scientific) and the Pierce RNA 3' end desulfatobiotinylation kit (Thermo Fisher Scientific) were used with biotin-labeled RNA Transcript Aid T7 and then treated with RNase-free DNase I (Thermo Scientific). Recovered protein was detected by western blot. The procedure is based on the Western blot protocol previously described according to the manufacturer's instructions and standards.

7. Establishment of diabetic nude mouse wound model

All procedures were approved by the Xuzhou university of medical care and use Committee (project No.: XYFY2016-KL 033). After 12 hours of fasting (free drinking water), the body weight was weighed and injected intraperitoneally with 2% STZ at a dose of 150 mg/kg. After one week, the blood glucose concentration of the rats was measured from the tail vein with a glucometer, the blood glucose concentration being greater than 16.7 mmol/L.

8. RNA binding protein immunoprecipitation (RIP)

Using Magna RIP^TMRIP analysis was performed using RNA binding protein immunopurification kit (Millipore). A positive control anti-SNRNP 70 antibody was used in the RIP procedure. The sample was incubated with proteinase K and the non-precipitated RNA was isolated.

9. Fluorescence In Situ Hybridization (FISH)

Genephrma synthesized FITC-labeled probes for detecting Linc00324 and Cy 3-labeled probes for detecting miR-7977. The signal of the probe was detected by fluorescence in situ hybridization kit (Genephrma, Shanghai, China) according to the manufacturer's instructions. Images were recorded digitally using a Lei TCS SP8 laser scanning confocal microscope (Leica Microsystems, Mannheim, Germany).

10、qRT-PCR

RNA was extracted and prepared for RT-qPCR. The total RNA was reverse transcribed to cDNA using Prime Script reverse transcriptase kit (chinese grand union, Takara) according to the manufacturer's protocol. Quantitative RT-PCR was performed by a Roche-Light Cycler 96 sequence detector (Roche, Germany) using SYBR Green chemistry. Specific primers are shown in table 1.

TABLE 1 primer sequences

11. Establishment of cell line with Linc00324 expression down-regulation and over-expression

The method comprises the following steps: the downregulated plasmid of Linc00324 (vector name pLKD-CMV-EGFP-2A-Puro-U6-shRNA) and the overexpression plasmid (vector name GL109 pSLenti-EF1a-EGFP-F2A-Puro-CMV-MCS) were co-transfected with the viral packaging helper plasmids pMD2.G and pSPAX2 into 293T cells for viral packaging. After 48 hours of transfection, concentration and purification, the viral supernatant from the infected supernatant was collected. Mu.l of the collected viral supernatant was added to Ad-MSCs cells with 3. mu.l of polybrene reagent (1. mu.g/ml). Transfection efficiency was observed using a fluorescence microscope 72 hours after virus infection of cells. At this time, cells were collected and dispersed in a single cell suspension, and the expression or overexpression level of the target gene was detected using qPCR and Western blotting. Cell lines that stably express or overexpress the target gene are tested for more than three consecutive generations.

Interference sequence:

shLinc00324-F：CCGGCCACTTCCTTGACGCTATTCTCAAGAGAAATAGCGTCAAGGAAGTGGTTTTTTG(SEQ ID NO.13)；shLinc00324-R：AATTCAAAAAACCACTTCCTTGACGCTATTTCTCTTGAGAATAGCGTCAAGGAAGTGG(SEQ ID NO.14)；

an overexpression sequence:

CMV-F：CGCAAATGGGCGGTAGGCGTG(SEQ ID NO.15)；H101-Kpn I-R：CGTTGGGAGTGAATTAGCC(SEQ ID NO.16)。

12. construction of wild-type (WT) and mutant (Mut) luciferase reporter genes

The method comprises the following steps: one day prior to transfection, Ad-MSCs cells were plated in 24-well plates and inoculated with 5X 104 cells/well Ad-MSCs cells. And the cell fusion degree reaches 80-90% on the third day. The medium was removed, washed carefully with PBS and replaced with serum-free medium, 250. mu.l per well, 5% CO at 37 ℃₂Culturing in a cell culture box. According to the amount of 20pmol of Linc00324 plasmid/NC per well, it was added to 100. mu.l of Opti-MEM. At the same time, another EP tube was changed. Mu.l Lipofectamine2000 was taken and added to 100. mu.l Opti-MEM. After mixing, it was allowed to stand at room temperature for 5 minutes; addition of RNA in the previous step&Reporter gene and Lipofectamine 2000. Mix well and incubate at room temperature for 20 minutes. This was added to a 24-well plate, and four replicate wells were made. At 37 ℃ 5% CO₂Incubate in cell incubator for 4-6 hours and replace with complete medium. After 24 to 48 hours of culture, the medium was discarded, washed 2-3 times with PBS, and the protein was collected with 1X Passive lysine Buffer.

13. Affinity detection of Linc00324 and miR-7977

The method comprises the following steps: generally, each antibody can be labeled with 3-5 biotin, when labeling is carried out, the ratio of biotin to antibody is influenced by the concentration of the antibody, biotin should exceed protein by 12 times (mole) for a 10mg/ml antibody solution, and should exceed 20 times for a 2mg/ml antibody solution, and biotin can also be directly added into a protein solution in the form of powder. The protein sample must not contain sodium azide, BSA, glycine, Tris or any other additive with free amino groups.

13.1 pretreatment of antibody/protein:

13.1.1 mu.l of the labeled reaction solution (0.1M PBS pH7.2) was added to an ultrafiltration column of appropriate cut-off, 1mg of the antibody was added thereto, and the mixture was mixed well.

13.1.24 deg.C, 6,000rpm, centrifuging for 2min, and discarding the filtrate; add 200. mu.l of labeled reaction solution to the ultrafiltration column and mix well. Centrifuging at 6,000rpm at 4 deg.C for 2min,

13.1.3 repeating the steps 1.26-7 times.

13.1.4 mixing the residual liquid in the ultrafiltration column, and standing at room temperature for 1 min; the ultrafiltration column was inverted and placed in a new ultrafiltration tube at 4 ℃ and 6,000rpm for 2min and the liquid was collected.

13.1.5 mu.l PBS was mixed in the ultrafiltration column and left to stand for 1 min. The column was inverted, filtered at 4 ℃ and 6,000rpm for 2min, and the liquid was collected.

13.1.6 step 1.4 was combined with the collected filtrate of step 1.5, the antibody concentration was adjusted to 2mg/ml with the labeled reaction solution, and the mixture was left at 4 ℃ until use.

13.2 labeling of Biotin:

13.2.1 biotin was dissolved in a suitable solvent (see the specification of biotin purchased, different biotin and different solvents) at a concentration of 20mg/ml, and the mixture was added to the antibody solution at a molar ratio of biotin to antibody molecules of 1:20 and reacted at room temperature for 1 hour.

13.2.2 Sephadex separation purification/dialysis bags or ultrafiltration tubes to remove free biotin and other reagents.

13.2.3 the antibodies are preserved in a suitable antibody preservation solution.

14. Transfection of miR-7977 mimic group and inhibitor group

The method comprises the following steps:

1) inoculating the recovered conventionally cultured cells into a 6-well plate according to 105, adding 2-4mL of complete culture medium, uniformly mixing, and placing in a carbon dioxide incubator at 37 ℃ overnight;

2) preparing the following solution in a sterile state: mu.g of the miR-7977 plasmid to be transfected (purchased from Kayji organism) was diluted with 100. mu.l of serum-free medium, b: diluting 25. mu.l of Lipofectamine transfection reagent with 100. mu.l of serum-free medium;

3) mixing the solutions a and b, shaking up, and standing at room temperature for about 30 min;

4) culturing the cells to about 80% of a monolayer, washing the cells for 2 times by using a serum-free culture medium, adding 1mL of the serum-free culture medium into each hole, dropwise adding the mixed solution a and b into each hole, shaking gently and uniformly in the cross direction, and culturing for 24 hours in a carbon dioxide incubator at 37 ℃;

5) and pouring out the transfection solution, replacing the transfection solution with a complete culture medium for continuous culture, and detecting the protein expression amount after culturing for 3-4 days.

15. Construction of STK4 mutant 3' -UTR reporter gene without binding site of miR-7977

The method comprises the following steps: the miR-7977 and STK4 are interchanged to construct a chimeric mutant variant which can be obtained by an overlapping PCR method. The principle is as follows: for example, two genes, one designated as A and one designated as B.

The sequence of A is 5'-atgcatgctagctagaacgctacgctgactaccccctgatc-3' (SEQ ID NO.17),

the sequence of B is 5'-atgctagtagctagccccccccaggggataattttttaaaacg-3' (SEQ ID NO. 18).

First we will design a primer, assuming that the sequence of the primer is:

A1:5’-atgcatgctagctagaacgct-3’(SEQ ID NO.19)

A2:5’-ggggggctagctactagcatgatcagggggtagtcagcgt-3’(SEQ ID NO.20)

B1:5’-acgctgactaccccctgatcatgctagtagctagcccccc-3’(SEQ ID NO.21)

B2:5’-cgttttaaaaaattatcccct-3’(SEQ ID NO.22)

(in designing primers, 20 sequences of the 5 'end of the B gene were added to the 3' end of A2, and 20 sequences of the 3'end of the A gene were added to the 5' end of B1.)

The method comprises the following steps:

1) amplifying the A gene by A1 and A2 and amplifying the B gene by B1 and B2;

2) recovering the A and B genes;

3) a + B is amplified by taking A and B as a common template and A1 and B2 as primers, so that the A + B is spliced by using a recombinant PCR method.

16. MiR-7977 mimetics and overexpressed Linc00324 co-transfected Ad-MSCs

1) pCDNA3.1 vector double digestion

2) Connecting the processed target fragment with the vector

The above ligation solution was incubated overnight at 16 ℃. Transformation (competent cells: DH5 a). Resistance: amp, 37 ℃, cultured overnight. After transformation, the Linc00324 genes are respectively subjected to plate selection, bacteria shaking at 37 ℃ at 250 rpm for 14 hours, and PCR identification. Stable cell lines were established as described in (1) and cotransfection was carried out as described in (14).

17. MiR-7977 inhibitor and expression-down-regulated Linc00324 co-transfected Ad-MSCs

The method comprises the following steps: 3 to 4 siRNA targets are designed according to the transcript of the Human Linc00324 gene, and primer synthesis is arranged. Annealing the single-stranded primer into a double-stranded oligo sequence, connecting the double-stranded oligo sequence with a double-enzyme digestion linearized RNA interference vector, and replacing the original ccdB toxic gene. Transformants are screened by colony PCR, and sequencing verification is carried out on the screened positive clones. And (5) sequencing to verify correct clone, and performing high-purity plasmid extraction. Stable cell lines were established as described in (1) and cotransfection was carried out as described in (14).

18. Statistical analysis

The results shown represent at least three replicates. All quantitative data are expressed as mean + SEM. Statistical analysis was performed using SPSS version 22.0 (SPSS Inc, Chicago, Il). Differences in multiple groups were compared by one-way analysis of variance (ANOVA) followed by post-test. The difference between the two groups was determined by t-test. P values <0.05 were considered statistically significant (./P < 0.05).

Second, result in

(1) GO can reduce the apoptosis of Ad-MSCs induced by high sugar.

And after co-culturing GO and Ad-MSCs, detecting the apoptosis condition of the Ad-MSCs by using a flow cytometer. A significant decrease in the apoptosis rate of Ad-MSCs was found after co-culture in the same high-sugar environment (FIG. 1A, B). Apoptosis was then detected with TUNEL kit with similar results (fig. 1C, D). Furthermore, the reduction of apoptotic cells was more pronounced with increasing GO concentration. Western blot and QPCR experimental results show that the expression of pro-apoptotic molecules Bax, BIM and STK4 is reduced along with the increase of GO, and the expression of anti-apoptotic molecules bcl-2 is increased along with the increase of GO (figure 2), which indicates that GO has an inhibiting effect on the apoptosis of adipose mesenchymal stem cells in a high-sugar environment.

(2) GO (graphene oxide) inhibition expression of Linc00324 in Ad-MSCs (Ad-MSCs)

And (3) carrying out gene sequencing on the cells after the GO and the Ad-MSCs are co-cultured. Sequencing showed that multiple LncRNA expression was changed after co-culture (fig. 3A). The expression of Linc00324 was significantly different as verified by qPCR (FIG. 3B). It was found that Linc00324 expression in Ad-MSCs decreased with increasing GO concentration during co-culture (FIG. 3C, D).

Establishing a Linc00324 expression down-regulation and over-expression cell line (figure 4), and verifying the cell line, wherein the apoptosis of a Linc00324 expression down-regulation group is obviously reduced under the high-sugar condition, and the apoptosis rate of a Linc00324 over-expression group is opposite; linc00324 expression down-regulated expression of the pro-apoptotic molecules Bax, BIM, STK4 decreased, expression of the anti-apoptotic molecule bcl-2 increased, whereas Linc00324 over-expressed the set trended in the opposite direction (FIG. 5). To further verify whether GO regulates apoptosis via Linc00324, co-culture of GO with a cell line highly expressing Linc00324 revealed no reduction in apoptosis (fig. 6). Thus, Linc00324 is one of the factors by GO that regulates apoptosis.

(3) Linc00324 as molecular sponge of miR-7977

To determine the mechanism by which Linc00324 regulates apoptosis in Ad-MSCs, the localization of Linc00324 was examined. The results show that Linc00324 is localized predominantly to the cytoplasm (fig. 7), suggesting that it may have a function to compete for endogenous RNA, and may serve as a molecular sponge for mirnas.

A search of the miRDB database showed the 5 miRNAs with the highest binding scores. qPCR primers were designed against these 5 miRNAs to determine if they were regulated by Linc 00324. Notably, the miR-7977 level of the Linc00324 overexpression group is obviously reduced, while the miR-7977 level of the Linc00324 knockout group is increased (FIG. 8).

The localization of miR-7977 using FISH assay revealed that miR-7977 is mainly localized in the cytoplasm (FIG. 9). In addition, to predict the likely sites of Linc00324 in miR-7977, wild-type (WT) and mutant (Mut) luciferase reporter genes were constructed, including firefly and Renila luciferase sequences (FIG. 10A). Luciferase assay results showed that the miR-7977 mimetic reduced the fluorescence intensity of Linc00324WT, but had no effect on Linc00324MUT (fig. 10B).

Endogenous binding between miR-7977 and Linc00324 was studied using RIP. The results show that compared with miR-7977 point mutation (Linc00324-mut), an empty vector (MS2) and another lncRNA-ATB without miR-7977 targeting site vector, the wild type (Linc00324-wt) with miR-7977 targeting site has obvious enrichment effect on miR-7977. (FIG. 11A).

Biotin-labeled Linc00324 down-regulated the affinity of miR-7977 in vitro, further confirming endogenous binding between miR-7977 and Linc00324 (FIG. 11B).

In addition, the expression levels of the miR-7977 mimetic group and the inhibitor group Linc00324 were also examined, and it was found that the expression level of the Linc00324 was decreased in the miR-7977 mimetic group, while the expression level of the Linc00324 was increased in the miR-7977 inhibitor group (FIG. 12). Therefore, Linc00324 acts as a sponge for miR-7977.

(4) MiR-7977 targeting STK4 to inhibit apoptosis of Ad-MSCs

Flow cytometry analysis (FIG. 13) and TUNEL method (FIG. 14) showed that the miR-7977 mimetic group reduced apoptosis in high sugar environments, while the miR-7977 inhibitor group increased apoptosis rate. WB experimental results showed that after transfection of miR-7977 mimic, bax, BIM and STK4 expression decreased, while bcl-2 expression increased (FIG. 15). Therefore, miR-7977 can reduce apoptosis of Ad-MSCs.

Predicting a downstream target of miR-7977 through MiRDB microRNA target prediction, and selecting STK4 closely related to apoptosis. To determine whether miR-7977 is directed against STK4, the STK 43' -UTR sequence was cloned into psiCHECK^TM-2 in a carrier. And a mutant 3' -UTR reporter gene without a binding site with miR-7977 is constructed (FIG. 16A). The data indicate that the introduction of miR-7977 reduced the luciferase activity of the reporter gene, while the activity of the mutated 3' -UTR reporter gene remained unchanged (fig. 16B).Meanwhile, qPCR and Western blot experiments prove that miR-7977 has an inhibition effect on STK4 on the levels of mRNA and protein (FIG. 17). The STK4 inhibitor XMU-MP-1 is added into the miR-7977 inhibitor group. Flow cytometry analysis showed that XMU-MP-1 inhibited miR-7977 inhibitor and induced apoptosis (FIG. 18), which is consistent with the results of TUNEL analysis (FIG. 19) and Western blot analysis (FIG. 20). Therefore, the miR-7977 can directly target the 3' -UTR of the STK4, can reduce the expression of the STK4 and can inhibit the apoptosis of the adipose-derived mesenchymal stem cells.

(5) Linc00324 regulates and controls high-sugar-induced apoptosis of Ad-MSCs by miR-7977/STK4

The miR-7977 mimic and the over-expressed Linc00324 are co-transfected into Ad-MSCs, and flow cytometry analysis shows that the miR-7977 mimic can remarkably inhibit apoptosis caused by the over-expressed Linc00324 (figure 21). TUNEL experiments (figure 22) and Western blot experiments (figure 23) also gave consistent results. In addition, Ad-MSCs were co-transfected with miR-7977 inhibitors and Linc00324, which downregulates expression. The results show that the miR-7977 inhibitor group reversed the decrease in apoptosis caused by the down-regulation of Linc00324 (fig. 24). TUNEL experiments (figure 25) and Western blot experiments (figure 26) also gave consistent results. Based on the data, Linc00324 regulates the apoptosis of high-sugar-induced Ad-MSCs by miR-7977/STK 4.

(6) GO inhibits apoptosis of diabetic nude mice and promotes wound healing

In order to further confirm the influence of GO on wound repair of diabetic nude mice mediated by Ad-MSCs, a skin wound repair model of diabetic nude mice is simulated and established. A wound surface with the diameter of 1.5CM is established, a fluorescent dye CM-Dil is injected into the wound margin skin of each group of nude mice intradermally, the cell survival rate is calculated according to the attenuation degree of the fluorescent dye intensity after 7 days, and the highest cell survival rate of a Linc00324 and GO mixed culture group (the concentration of 0.4mg/mL and 24 hours of co-culture) with the expression reduced is found (figure 27). The wound healing effect of nude mice was then evaluated for 14 days. Wound healing rate was calculated as the 14 day wound area divided by the original wound area. The results show that the GO group is superior to the blank control group, and the wound healing effect of the down-regulated Linc00324 and GO mixed culture group is the best (figure 28). HE staining of the tissue sections showed that the thickness of the neogenetic epidermis of the Linc00324 down-regulated group and the GO mixed culture group was significantly higher than that of the other groups (fig. 29), and Masson staining showed that the fibrous tissues of the Linc00324 down-regulated group and the GO mixed culture group were aligned, indicating that the post-healing was better (fig. 30). Further, tissue immunofluorescence was used to detect angiogenesis (CD31) and inflammatory response (TNF- α) of the wound tissue, and CD31 was highly expressed in the down-regulated and GO groups, while TNF- α was low expressed, indicating that the wound was well healed (fig. 31, 32). ELISA assays were performed on wound tissue to detect cytokines associated with wound healing and similar results were obtained (fig. 33). In vivo experiment results show that GO can inhibit apoptosis of stem cells in diabetic nude mice, thereby promoting wound healing.

The above-described embodiments are only for illustrating the present invention and are not to be construed as limiting the present invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Sequence listing

<110> Xuzhou medical university affiliated Hospital

Application of graphene oxide or regulating and controlling molecule thereof in preparation of medicine for promoting diabetic wound repair

<141> 2021-02-09

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gacgagccct cctttacctt 20

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctggggattg agatgctttc t 21

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgcgcgttcc cagccaac 18

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atccagtgca gggtccgagg 20

<210> 5

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactggtgc 50

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaaggtgaag gtcggagtc 19

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaagatggtg atgggatttc c 21

<210> 8

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctcgcttcgg cagcaca 17

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aacgcttcac gaatttgcgt 20

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gggcaggaag agggccta 18

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agagttggac agtggaggac cttc 24

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gccgcttgga ctggtacttc tg 22

<210> 13

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccggccactt ccttgacgct attctcaaga gaaatagcgt caaggaagtg gttttttg 58

<210> 14

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aattcaaaaa accacttcct tgacgctatt tctcttgaga atagcgtcaa ggaagtgg 58

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cgcaaatggg cggtaggcgt g 21

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgttgggagt gaattagcc 19

Claims (6)

1. The application of a Linc00324 inhibitor in preparing a medicament for inhibiting the apoptosis of Ad-MSCs induced by high sugar; the high sugar means that the concentration of glucose in a culture medium or the concentration of blood sugar of an experimental animal is more than or equal to 16.7 mmol/L; the Linc00324 inhibitor is an interfering RNA directed against Linc 00324.
2. Application of a Linc00324 inhibitor in preparation of a medicine for promoting diabetic wound repair; the Linc00324 inhibitor is an interfering RNA directed against Linc 00324.
3. 3. A method of inhibiting high-sugar-induced apoptosis of Ad-MSCs in vitro, comprising administering an inhibitor of Linc 00324; the high sugar refers to that the concentration of glucose in the culture medium is not less than

   16.7 mmol/L; the Linc00324 inhibitor is an interfering RNA directed against Linc 00324.
4. 4. A method for screening drugs for inhibiting high-sugar-induced apoptosis of Ad-MSCs in vitro, which is characterized by comprising the steps of contacting a Linc00324 expression system with a candidate compound; determining whether the candidate compound alters expression of Linc 00324; the high sugar refers to that the concentration of glucose in the culture medium is not less than

   16.7mmol/L。
5. 5. A method for in vitro screening of a drug for promoting diabetic wound repair, comprising contacting a system expressing Linc00324 with a candidate compound; it was determined whether the candidate compound altered expression of Linc 00324.
6. 6, Linc00324 is applied to in vitro screening of medicines for inhibiting high-sugar-induced apoptosis of Ad-MSCs or promoting diabetic wound repair; the high sugar means that the concentration of glucose in a culture medium or the concentration of blood sugar of an experimental animal is more than or equal to 16.7 mmol/L.

Images