WO2013102492A1 - Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application - Google Patents

Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application Download PDF

Info

Publication number
WO2013102492A1
WO2013102492A1 PCT/EP2012/050097 EP2012050097W WO2013102492A1 WO 2013102492 A1 WO2013102492 A1 WO 2013102492A1 EP 2012050097 W EP2012050097 W EP 2012050097W WO 2013102492 A1 WO2013102492 A1 WO 2013102492A1
Authority
WO
WIPO (PCT)
Prior art keywords
asn
leu
glu
ser
ile
Prior art date
Application number
PCT/EP2012/050097
Other languages
French (fr)
Inventor
Agnieszka SZCZEPANKOWSKA
Katarzyna SZATRAJ
Jacek Bardowski
Tamara Aleksandrzak-Piekarczyk
Włodzimierz ZAGÓRSKI-OSTOJA
Piotr Borowicz
Anna GÓRA-SOCHACKA
Beata Gromadzka
Bogusław SZEWCZYK
Grazyna Plucienniczak
Zenon MINTA
Józef Kapusta
Katarzyna FLORYS
Krzysztof Kucharczyk
Krzysztof Smietanka
Agnieszka Sirko
Violetta Saczynska
Original Assignee
Instytut Biochemii I Biofizyki Pan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Instytut Biochemii I Biofizyki Pan filed Critical Instytut Biochemii I Biofizyki Pan
Priority to PCT/EP2012/050097 priority Critical patent/WO2013102492A1/en
Publication of WO2013102492A1 publication Critical patent/WO2013102492A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55522—Cytokines; Lymphokines; Interferons
    • A61K2039/55527—Interleukins
    • A61K2039/55533—IL-2
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the subject of the invention is the means of constructing lactic acid bacteria strains containing genes encoding heterologous avian influenza virus haemagglutinin (HA) protein, which nucleotide sequence is presented on fig. 1 (HA 1-568), and/or its derivatives, which nucleotide sequences are shown on fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), as well as the chicken interleukin 2 gene, which sequence is presented on fig.
  • HA heterologous avian influenza virus haemagglutinin
  • chIL-2 means of producting these heterologous proteins
  • lactic acid bacteria strains Lactococcus, Lactobacillus or Bifidobacterium carrying this gene(s) immunogenic composition containing at least one of these strains, and the application of this strain(s) to induce an effective immunological response against the avian influenza virus.
  • the subject of the invention is application of the ptcB gene promoter region to optimize the production of heterologous proteins.
  • Avian influenza is an infectious disease commonly occurring in birds.
  • the ethiological factor of this disease is a virus from the Orthomyxoviridae family, which causes ilnesses of epidemic or pandemic character.
  • the main source of risk for the health of humans and birds are undomiesticated birds (mainly waterfowl), which are symptomless carriers of the avian influenza virus.
  • the most likely source of infection in domestic poultry is direct or indirect contact (through drinking water) with wild birds.
  • the animal reservoir of influenza viruses and repetitive since 1997 cases of human infections by avian viruses indicate a genuine threat of a pandemic.
  • the most dangerous avian influenza viral strain is H5N1.
  • H5N1 human influenza
  • the illness evoked by H5N1 is more severe than the ‘classical’ human influenza.
  • the following symptoms were observed: fever, sore throat, cough, viral pneumonia leading to acute respiratory failure.
  • Human-to-human transmission of the virus has not been confirmed; yet, such possibility cannot be excluded taking into account the capacity of the virus to mutate.
  • Due to the substantial economic losses a potential outbreak of the disease (mortality in case of poultry can reach upto 100%) can cause, there is a need to undertake actions to protect human and animal health against the threat of infection by a highly pathogenic avian influenza virus and reduce the risk of disease spread.
  • the available antiviral drugs are quite expensive and in order for them to provide reliable protection they need to be administered for long peroids of time.
  • the method considered to be the most effective in fighting the avian influenza virus is the prophilactic vaccination of birds.
  • This approach can limit dissemination of the virus onto healthy birds in the flock and prevent outbreaks of the disease.
  • Such solution would also have economical advantages.
  • the advantage of effective vaccinations would be avoiding the necessity to eliminate the whole bird flocks, where only single sick individuals have been found. Limiting the dissemination of the virus among animals would minimalize also the danger of the avian influenza pandemic among humans.
  • currently intensive work is conducted to design a vaccine against the avian influenza virus.
  • RNA viruses e.g. rabies, rubella or Heine-Medin disease
  • Constant antigenic changes of the influenza virus impede designing an effective vaccine.
  • Anti-influenza vaccines need systematic modifications. Therefore, intesively seeked are flexible systems enabling easy introduction of viral genes and their new variants as well as effective and relatively quick and economically profitable methods of antigen production.
  • Haemagglutinin is the major protein of the influenza virus able to induce antibody production in the infected host. Cloned sequences, comprising the HA gene (underlined fragment) are presented on fig. 1-5 .
  • Haemagglutinin exhibits the following biological properties: (i) causes clumping of erythrocytes, (ii) enables binding of the virus with host red blood cells, (iii) allows adsorption of the virus to the receptor of the host cell, (iv) is responsible for the binding of the virus with the host by fusion of the viral envelope with the cellular membrane, (v) conditions the integration of the viral envelope with the cellular membrane of the host, (vi) causes penetration of the viron into the cytoplasm of the host cell and release of its content, which facilitates penetration of the infected cell, (vii) enables release of mature virons from the infected cell by gemmation, (viii) is necessary for further dissemination of the virus in the infected organism, (ix) prevents agglutination of viral particles by eliminating the sialic acid from the carbohydrate residue of the synthesized viral HA and NA glicoproteins.
  • Chicken interleukin 2 (IL-2) is an immunostimulator, which enhances local and systemic activity of the immune system.
  • the cloned sequence, comprising the chIL-2 gene (underlined fragment), is presented on fig. 6 .
  • Interleukin 2 is a glycoprotein produced by T-type lymphocytes under the influence of specific and nonspecific mitogens. It induces proliferation of the T helper and suppressor as well as cytotoxic cells and enhances the activity of NK cells. Due to such properties, it can be used in designing vaccines as a natural adjuvant.
  • lactic acid bacteria strains can have an immunomodulatory effect on human and animal organisms.
  • lactic acid bacteria producing heterologous antigen proteins or engaged in the immune response of the organism (e.g. Helicobacter pylori urease, LcrV – antigen responding to low calcium concentrations from Yersinia pseudotuberculosis , EP7 antigen of the human type 16 papilloma virus or human interleukins IL10 and IL12) as oral vaccines.
  • heterologous antigen proteins e.g. Helicobacter pylori urease, LcrV – antigen responding to low calcium concentrations from Yersinia pseudotuberculosis , EP7 antigen of the human type 16 papilloma virus or human interleukins IL10 and IL12
  • Nucleotide sequences of the avian influenza virus haemagglutinin (HA) gene and its derivatives are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), and amino acid sequences encoded by the respective heterologous proteins are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His).
  • the nucleotide sequence of the chicken interleukin 2 gene is presented on fig. 6 (chIL-2), and the amino acid sequence of the respective protein is presented on fig. 6a (chIL-2).
  • HA avian influenza virus haemagglutinin
  • fig. 1 HA 1-568
  • fig. 2 HA 17-568
  • fig. 3 HA17-522
  • fig. 4 HA1-568His
  • fig. 5 HA17-568His
  • encoding respective proteins which amino acid sequences are presented respectively on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig.
  • HA17-568His is based on their synthesis by PCR method using cDNA as template and 2 primers complementary to each gene (Table 1), which nucleotide sequences have been designed in such a way so they would correspond to codons preferably occurring in bacteria Lactococcus, Lactobacillus and Bifidobacterium, favorably from Lactococcus lactis species . Additionally, nucleotide sequences of the forward primers for each gene were modified by introducing a sequence corresponding to the translation START codon (ATG), just before the sequence encoding the first amino acid of the original protein sequence.
  • ATG translation START codon
  • the 5’ ends of the forward primers contain an additional, typical for Lactococcus lactis bacteria, RBS (ribosome-binding site) sequence, recognized by the translation machinery, and a ‘spacer’ sequence (linker) localized between the RBS region and the translation START codon.
  • RBS ribosome-binding site
  • spacer linker
  • the 5’ ends of the primers it is favorable for the 5’ ends of the primers to carry additional sequences recognized by specific restriction nucleases, preferably BamHI (forward) and XhoI (reverse) for HA genes. Additionally, 5’ ends of reverse primers carry a repeated sequence corresponding to the translation STOP codon (TAA), and one - a His-tag (6xHis) sequence.
  • specific restriction nucleases preferably BamHI (forward) and XhoI (reverse) for HA genes.
  • 5’ ends of reverse primers carry a repeated sequence corresponding to the translation STOP codon (TAA), and one - a His-tag (6xHis) sequence.
  • the method of generating the gene encoding the chicken interleukin 2 (chIL-2) protein which sequence is presented on fig. 6 , according to the invention, is based on its synthesis by PCR method using cDNA as template and 2 complementary primers (Table 1), which nucleotide sequences were designed in such a way so they would correspond to codons preferably occurring in Lactococcus, Lactobacillus and Bifidobacterium bacteria. Additionally, the nucleotide sequence of the forward primer was modified by introducing a sequence corresponding to the translation START codon (ATG), just before the sequence encoding the first amino acid of the original protein sequence.
  • ATG translation START codon
  • the 5’ end of the forward primer contains an additional, typical for the Lactococcus lactis bacteria, RBS (ribosome-binding site) sequence, recognized by the translation machinery, and a ‘spacer’ (linker) sequence localized between the RBS region and the translation START codon.
  • RBS ribosome-binding site
  • spacer linker sequence localized between the RBS region and the translation START codon.
  • the 5’ ends of both primers carry additional sequences recognized by specific restriction enzymes, preferably BoxI (forward) and AgeI and BoxI (reverse), for the gene encoding chIL-2.
  • 5’ ends of reverse primers carry a repeated sequence corresponding to the translation STOP codon (TAA), and one - a His-tag (6xHis) sequence.
  • DNA fragments are obtained, which nucleotide sequences are presented on fig. 1, 2, 3, 4 , 5, 6 , and comprise sequences of genes encoding the studied heterologous proteins (underlined fragments).
  • the method of cloning the generated genes of selected heterologous proteins in lactic acid bacteria strains is based, according to the invention, on subjecting them to double digestion by restriction enzymes, preferably BamHI and XhoI for HA and BoxI for chIL-2, and then ligating them with a plasmid vector that replicates in lactic acid bacteria cells, favorably in Lactococcus genus , in particular with pIL253, digested beforehand with the same restriction enzymes to obtain recombinant plasmids, in which the orientation of the cloned PCR products (inserts) would be in accordance with the direction of transcription directed from the internal promoter present on the vector.
  • restriction enzymes preferably BamHI and XhoI for HA and BoxI for chIL-2
  • the recombinant DNA is introduced by electroporation into cells of bacterial strains, which are cultured in a known manner.
  • Cells containing the new gene are isolated from the culture population, favorably by analyzing the obtained transformants by PCR technique for the presence of inserts which contain respective genes.
  • Nucleotide sequences of the cloned genes are examined for conformity with the nucleotide sequences of the synthetic genes by DNA sequencig technique.
  • the subject of the invention are also bacterial strains from strains from Lactococcus genus, e.g. Lactococcus lactis IL1403, Lactococcus lactis IBB477 and Lactococcus lactis IBB360, differing in their viability in the mammalian gut as well as other genera of lactic acid bacteria, preferably Lactobacillus and Bifidobacterium , carrying a plasmid selected from a group of plasmids harboring single variants of the viral haemagglutinin gene, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig.
  • fig. 4 (HA1-568His), fig. 5 (HA17-568His) and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig. 6 (chIL-2), encoding respective heterologous proteins, which amino acid sequences are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and chicken interleukin 2 protein, which sequence is presented on fig. 6a (chIL-2).
  • RNA is isolated by known method from bacterial strains carrying the recombinant plasmids, which after specific treatment is subjected to reverse transcription reaction using primers (reverse) complementary to the 3’ end of the gene, favorably reverse starters listed in TABLE 2.
  • Obatined cDNA is subsequently subjected to amplification by the classical PCR technique using an appropriate pair of primers (forward and reverse), favorably primers which sequences are listed in TABLE 1.
  • primers reverse transcriptase PCR
  • the method of analyzing expression of genes of selected heterologous proteins on the translation level is carried out by known immunolgical methods, preferably dot-blot and western-blot techniques, using protein extracts, obtained by described methods from particular recombinant bacterial cells and suspended in a buffer of slightly alkalic pH, preferably in PBS buffer, pH 7.4, and adequate specific antibodies.
  • the method of optimizing the biosynthesis of selected heterologous proteins is based, according to the invention, on replacing the internal, constitutive promoter of the plasmid vector, replicating in L. lactis cells, favorably with the promoter region of a gene deriving from the genome of L. lactis bacteria, preferably by a promoter region of the ptcB gene engaged in sugar catabolism in lactic acid bacteria from the Lactococcus genus , which is regulated by the presence of various sugars in the medium, such as: glucose, cellobiose, galactose, salicin, esculin.
  • genes of selected heterologous proteins in cells of lactic acid bacteria favourably from Lactococcus genus, according to the invetion, is based on culturing cells carrying the recombinant plasmid vector (with the cloned gene and adequate promoter region, favourably promoter of the ptcB gene, which comprises the -10 and -35 sequence region, presented on fig.
  • the method of cloning the ptcB promoter region is favorably based on generating by PCR technique the promoter region of the ptcB gene , which is induced by various sugars as carbon source, preferably cellobiose, by using chromosomal DNA of L. lactis IL1403 strain as template and appropriate pair of primers (forward and reverse) complementary to the ends of the promoter region of the chormolsomal ptcB gene and modified in such a way that their 5’ ends contain sequences recognized by specific restriction endonucleases, preferably VspI (for the forward primer) and NciI (for the reverse primer) (TABLE 3).
  • nucleotide sequence is presented on fig. 7 , comprising the cloned promoter region including the -10 and -35 region (underlined fragment).
  • the obtained PCR product is subjected to digestion preferably using the listed enzymes and ligating it with the reombinant vectors carrying genes encoding selected heterologous proteins, from which the original promoter region was removed (e.g. by distestion using the same restictases).
  • the recombinant DNA is introduced by electroporation method into cells of bacterial strains which are then cultured by known means. Cells containing the new promoter region are isolated from the cultured population, favorably by analyzing the obtained transformants by PCR technique for the presence of expected DNA fragments. Nucleotide sequences of the cloned promoter region are confirmed by DNA sequencing.
  • the immunogenic composition for induction of immunological response against the avian influenza virus in the bird host contains at least one Lactococcus , Lactobacillus or Bifidobacterium strain , favorably from Lactococcus lactis, carrying a plasmid selected from a group of plasmids harboring single genes of viral haemagglutinin variants, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig.
  • chIL-2 that encode respective heterologous proteins, which amino acid sequences are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and the chicken interleukin 2 protein, which amino acid sequence is presented on fig. 6a (chIL-2).
  • An effective vaccine against the avian influenza virus is characteristic by the fact that it contains the immunogenic composition of at least one Lactococcus , Lactobacillus or Bifidobacterium strain , favorably from Lactococcus lactis, in particular Lactococcus lactis IL1403, Lactococcus lactis IBB477 or Lactococcus lactis IBB360, which carries a plasmid selected from a group of plasmids harboring single genes of the viral haemagglutinin variants, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig.
  • fig. 4 (HA1-568His), fig. 5 (HA17-568His), and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig. 6 (chIL-2), encoding respective heterologous proteins, which amino acid sequences are shown on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and the chicken interleukin 2 protein, which amino acid sequence is presented on fig. 6a (chIL-2).
  • lactic acid bacteria strains preferably Lactococcus lactis IL1403, Lactococcus lactis IBB477 and Lactococcus lactis IBB360 or other lactic acid bacteria, preferably Lactobacillus and Bifidobacterium, as vaccines, is induction of specific immune response in birds, which leads to generating immunological protection against infection by a virulent avian influenza viral strain.
  • the most effective variants may serve to combat the avian influenza virus at the prevention level.
  • haemagglutinin (HA) gene of the avian influenza virus, its individual variants and the chicken interleukin 2 (chIL-2) gene were generated by amplification by PCR method using specific cDNA as template and 2 complementary primers for each gene encoding a selected protein (TABLE 1).
  • PCR products were obtained: HA1-568, HA17-568, HA17-522, HA1-568His, HA17-568His, chIL-2, encoding respective amino acid sequences: HA1-568 aa, HA17-568 aa, HA17-522 aa, HA1-568His aa, HA17-568His aa, chIL-2 aa.
  • the obtained products were subjected to digestion by specific restriction enzymes: BamHI (forward) and XhoI (reverse) for HA gene varinats and BoxI for the chIL-2 gene.
  • the digested products were recombined with the Lactococcus lactis plasmid vector , pIL253, digested beforehand with the same restriction enzymes to obtain adequate recombinant plasmids, in which the orientation of the cloned PCR products (inserts) is in accordance with the direction of transcription directed from the internal promoter present on the vector.
  • the recombinant DNA was introduced by electroporation into selected Lactococcus lactis bacteria strains: IL1403, IBB360 and IBB477, which were cultured in a known manner. The presence of specific gene sequences was confirmed by PCR method. Nucleotide sequences of the cloned genes were examined for conformity with the nucleotide sequences of the original genes by DNA sequencig.
  • HA1-568 aa, HA17-568 aa, HA17-522 aa, HA1-568His aa, HA17-568His aa, chIL-2 aa were based on culturing the cells of the transformed strains on defined CDM medium, supplemented with glucose or cellobiose, at a concentration of 0.5%, at a temperature of 30 C, until reaching optical density OD 600 > 0.6. Both, from the obtained bacterial mass as well as from the supernatant proteins were isolated, which were suspended in PBS buffer, pH 7.4. Identification of specific proteins was performed using dot-blot and western-blot reactions using adequate mono- and polyclonal antibodies. Positive reaction results were obtained for all examined variants.
  • the internal promoter present in the pIL253 plasmid vector was replaced by the ptcB promoter.
  • the promoter region was amplified by PCR reaction using a pair of specific primers (Table 3). Obtained PCR product was digested by restriction enzymes VspI and NciI.
  • the promoter region prepared in such way was introduced in the pIL253 vector, digested beforehand by the same restriction enzymes, in place of the original plasmid promoter. Transformants were analyzed by PCR technique to confirm the presence of the expected DNA fragment. Conformity of the nucleotide sequence was confirmed by sequencing.
  • strain variants were obtained, in which the studied heterologous genes, HA1-568, HA17-568, HA17-522, HA1-568His, HA17-568His, chIL-2, were under the regulation of the ptcB promoter undergoing induction in the presence of various sugars as carbon source. Functionality of the promoter and the expression level of the studied genes were analyzed as in examples II and III.
  • Bacterial strains, culture conditions and plasmids used Bacterial strains, culture conditions and plasmids used.
  • Lactococcus lactis strains were cultured in M17 medium (Oxoid, Yale) supplemented with 0.5 % glucose or in defined CDM medium supplemented with glucose or cellobiose (0.5%- 1%), at a temperature of 30 C.
  • M17 medium Oxoid, Yale
  • CDM medium supplemented with glucose or cellobiose (0.5%- 1%)
  • the following antibiotics were used: erythromycin 5 ⁇ g/ml for L. lactis IL1403 and IBB360 strains and erythromycin 5 ⁇ g/ml and tetracyclin 2 ⁇ g/ml for IBB 477 strain.
  • ⁇ 120> Means of constructing lactic acid bacteria strains containing genes encoding heterologous avian influenza virus haemagglutinin and chicken interleukin 2 (chIL-2) protein and their production, lactic acid bacteria strain(s) carrying these genes (or gene), their application to induce an effective immunological response against the avian influenza virus and application of the ptcB gene promoter region to optimize the production of heterologous proteins
  • gaatttcaac gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa 360
  • gaatttcaac gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa 360
  • gaatttcaac gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa 360

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The subject of the invention is the means of obtaining lactic acid bacteria strains containing gene(s) encoding heterologous haemagglutinin (HA) protein of the avian influenza virus and/or its variants: HA 1-568, HA17-568, HA17-522, HA1-568His, HA17-568His as well as the gene encoding the heterologous chicken interleukin 2(chlL-2) protein, the microbiological method of producing these proteins, lactic acid bacteria strain(s) carrying these gene (or genes), their application, immunogenic composition containing at least one of these strains, and an effective vaccine preparation against the avian influenza virus. Additionally, the subject of the invention is application of the ptcB gene promoter region to optimize the production of heterologous proteins, according to the invention (claim 7).

Description

[Title established by the ISA under Rule 37.2] SYNTHETIC GENES ENCODING PEPTIDE FRAGMENTS OF NATURAL MYELIN PROTEINS FOR INDUCTION OF ORAL TOLERANCE, DNA FRAGMENT COMPRISING THESE GENES, MEANS OF OBTAINING THESE PEPTIDES IN A MICROBIAL (BACTERIAL) SYSTEM AND THEIR MEDICAL APPLICATION Technical Field
The subject of the invention is the means of constructing lactic acid bacteria strains containing genes encoding heterologous avian influenza virus haemagglutinin (HA) protein, which nucleotide sequence is presented on fig. 1 (HA 1-568), and/or its derivatives, which nucleotide sequences are shown on fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), as well as the chicken interleukin 2 gene, which sequence is presented on fig. 6 (chIL-2) and means of producting these heterologous proteins, lactic acid bacteria strains Lactococcus, Lactobacillus or Bifidobacterium carrying this gene(s), immunogenic composition containing at least one of these strains, and the application of this strain(s) to induce an effective immunological response against the avian influenza virus. Additionally, the subject of the invention is application of the ptcB gene promoter region to optimize the production of heterologous proteins.
Background Art
Avian influenza is an infectious disease commonly occurring in birds. The ethiological factor of this disease is a virus from the Orthomyxoviridae family, which causes ilnesses of epidemic or pandemic character. The main source of risk for the health of humans and birds (poultry) are undomiesticated birds (mainly waterfowl), which are symptomless carriers of the avian influenza virus. The most likely source of infection in domestic poultry is direct or indirect contact (through drinking water) with wild birds. The animal reservoir of influenza viruses and repetitive since 1997 cases of human infections by avian viruses indicate a genuine threat of a pandemic. Currently, the most dangerous avian influenza viral strain is H5N1. In regards to human infections, the illness evoked by H5N1 is more severe than the ‘classical’ human influenza. In many infection cases the following symptoms were observed: fever, sore throat, cough, viral pneumonia leading to acute respiratory failure. Human-to-human transmission of the virus has not been confirmed; yet, such possibility cannot be excluded taking into account the capacity of the virus to mutate. Due to the substantial economic losses a potential outbreak of the disease (mortality in case of poultry can reach upto 100%) can cause, there is a need to undertake actions to protect human and animal health against the threat of infection by a highly pathogenic avian influenza virus and reduce the risk of disease spread. The available antiviral drugs are quite expensive and in order for them to provide reliable protection they need to be administered for long peroids of time. Yet, it is still uncertain whether the currenty available antiviral drugs will be effective in case of a mutated virus. The most commonly used pharmaceuticals in influenza treatment are: Tamiflu (Oseltamivir) and Relenza (Zanamivir), which inhibit the neuraminidase of A and B viruses responsible for releasing the replicated viral particles from infected cells. The mentioned drugs limit progression of the diseaase and decreases the risk of complications. However, application of such medicaments is burdened with a possible risk of side effects.
The method considered to be the most effective in fighting the avian influenza virus is the prophilactic vaccination of birds. This approach can limit dissemination of the virus onto healthy birds in the flock and prevent outbreaks of the disease. Such solution would also have economical advantages. The advantage of effective vaccinations would be avoiding the necessity to eliminate the whole bird flocks, where only single sick individuals have been found. Limiting the dissemination of the virus among animals would minimalize also the danger of the avian influenza pandemic among humans. Thus, currently intensive work is conducted to design a vaccine against the avian influenza virus. Researchers identified so far 15 types of haemagglutinin and 9 neuraminidases; some of them are present in different arrangements in human influenza strains. Combinations of these proteins constitute vaccine components against the influenza virus. Introduction of the antigen protein into the organism causes development of a certain immunity against a specific substance. Despite attempts of researchers to fully control the onset of influenza by protective vaccinations, like in the case of other diseases induced by RNA viruses (e.g. rabies, rubella or Heine-Medin disease), such efforts have failed. Constant antigenic changes of the influenza virus impede designing an effective vaccine. A change even in single amino acids, resulting from point mutations, can destroy the bond between the viral antigen and the antibody. Anti-influenza vaccines need systematic modifications. Therefore, intesively seeked are flexible systems enabling easy introduction of viral genes and their new variants as well as effective and relatively quick and economically profitable methods of antigen production.
Studies aimed at developing a method to produce HA and its derivatives as well as the chicken IL-2 protein in lactic acid bacteria was associated with a number of premises: (i) earlier positive results of using lactic acid bacteria as producers of immunomodulatory factors (cytokines and antigens), including vaccines, (ii) demonstrated potential of the haemagglutinin (HA) protein to induce immunological response and the immunomodulatory properties of the chicken interleukin 2(IL-2) protein, (iii) large economic losses in poultry industry connected with bird falls and virus eradication, (iv) necessity to undertake effective actions in preventing dissemination of the virus and the lack of effective vaccine so far.
Disclosure of Invention
Haemagglutinin is the major protein of the influenza virus able to induce antibody production in the infected host. Cloned sequences, comprising the HA gene (underlined fragment) are presented on fig. 1-5.
It is known that irrelevantly of the serotype of the infecting virus, neutralizing anti-HA antibodies bind always to the same epitope within the fragment responsible for the fusion. Most studies indicate that the most immunogenic (giving the highest antibody titer) vaccine are those containing the whole haemagglutinin antigen. On the other hand, it is believed that the future belongs to vaccines with optimized epitopes. Haemagglutinin exhibits the following biological properties: (i) causes clumping of erythrocytes, (ii) enables binding of the virus with host red blood cells, (iii) allows adsorption of the virus to the receptor of the host cell, (iv) is responsible for the binding of the virus with the host by fusion of the viral envelope with the cellular membrane, (v) conditions the integration of the viral envelope with the cellular membrane of the host, (vi) causes penetration of the viron into the cytoplasm of the host cell and release of its content, which facilitates penetration of the infected cell, (vii) enables release of mature virons from the infected cell by gemmation, (viii) is necessary for further dissemination of the virus in the infected organism, (ix) prevents agglutination of viral particles by eliminating the sialic acid from the carbohydrate residue of the synthesized viral HA and NA glicoproteins.
Chicken interleukin 2 (IL-2) is an immunostimulator, which enhances local and systemic activity of the immune system. The cloned sequence, comprising the chIL-2 gene (underlined fragment), is presented on fig. 6.
Interleukin 2 is a glycoprotein produced by T-type lymphocytes under the influence of specific and nonspecific mitogens. It induces proliferation of the T helper and suppressor as well as cytotoxic cells and enhances the activity of NK cells. Due to such properties, it can be used in designing vaccines as a natural adjuvant.
Unexpectedly, it occurred that application of lactic acid bacteria as biological factories to produce heterologous proteins, according to the invention, is greatly attractive both from the scientific and application point of view. Such approach presents multiple valuable medical and pharmaceutical advantages. Among them is the great hope connected with the possibility of applying lactic acid bacteria as vaccine vectors, e.g. for production of oral vaccines. Two facts contribute to broadening the range of biotechnological application of lactic acid bacteria. Firstly, it is the GRAS status granted to these bacteria, meaning that they are nonpathogenic and safe for the health of humans and animals. Secondly, it is the extremely developed and intensive scientific research on lactic acid bacteria. Genomics, functional genomic as well as metagenomics of these bacteria using global gene expression analyses are the recently advanced research areas. The natural properties of specific lactic acid bacterial strains can have an immunomodulatory effect on human and animal organisms. There are also studies indicating the possibility of applying lactic acid bacteria producing heterologous antigen proteins or engaged in the immune response of the organism (e.g. Helicobacter pylori urease, LcrV – antigen responding to low calcium concentrations from Yersinia pseudotuberculosis, EP7 antigen of the human type 16 papilloma virus or human interleukins IL10 and IL12) as oral vaccines.
It occurred that it is possible to develop a system for expressing genes encoding heterologous proteins, according to the invention, in the cells of lactic acid bacteria from genus Lactococcus, Lactobacillus and Bifidobacterium and apply them as bacterial producers and subsequently as effective immunomodulators to create a preparation of potential vaccine application.
Moreover, during implementation of the invention, it occurred that it is possible to:
  1. generate by PCR method synthetic genes encoding heterologous proteins: avian influenza virus HA protein variants and chicken interleukin 2;
  2. clone, in cells of selected strains of Gram-positive lactic acid bacteria from Lactococcus, Lactobacillus and Bifidobacterium genus, the obtained recombinant genes in adequate cloning vectors and express them;
  3. clone the Lactococcus lactis chromosomal ptcB gene promoter region
optimize the biosynthesis of heterologous proteins in lactic acid bacteria by replacing the original internal promoter region of the plasmid vector with the L. lactis ptcB gene promoter region;
Brief Description of Drawings
Nucleotide sequences of the avian influenza virus haemagglutinin (HA) gene and its derivatives are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), and amino acid sequences encoded by the respective heterologous proteins are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His).
The nucleotide sequence of the chicken interleukin 2 gene is presented on fig. 6 (chIL-2), and the amino acid sequence of the respective protein is presented on fig. 6a (chIL-2).
The method of constructing lactic acid bacteria strains producing individual genes encoding the avian influenza virus haemagglutinin (HA) and its selected variants presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), encoding respective proteins, which amino acid sequences are presented respectively on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), according to the invention, is based on their synthesis by PCR method using cDNA as template and 2 primers complementary to each gene (Table 1), which nucleotide sequences have been designed in such a way so they would correspond to codons preferably occurring in bacteria Lactococcus, Lactobacillus and Bifidobacterium, favorably from Lactococcus lactis species. Additionally, nucleotide sequences of the forward primers for each gene were modified by introducing a sequence corresponding to the translation START codon (ATG), just before the sequence encoding the first amino acid of the original protein sequence. At the same time, the 5’ ends of the forward primers contain an additional, typical for Lactococcus lactis bacteria, RBS (ribosome-binding site) sequence, recognized by the translation machinery, and a ‘spacer’ sequence (linker) localized between the RBS region and the translation START codon.
In the method, according to the invention, it is favorable for the 5’ ends of the primers to carry additional sequences recognized by specific restriction nucleases, preferably BamHI (forward) and XhoI (reverse) for HA genes. Additionally, 5’ ends of reverse primers carry a repeated sequence corresponding to the translation STOP codon (TAA), and one - a His-tag (6xHis) sequence.
The method of generating the gene encoding the chicken interleukin 2 (chIL-2) protein, which sequence is presented on fig. 6, according to the invention, is based on its synthesis by PCR method using cDNA as template and 2 complementary primers (Table 1), which nucleotide sequences were designed in such a way so they would correspond to codons preferably occurring in Lactococcus, Lactobacillus and Bifidobacterium bacteria. Additionally, the nucleotide sequence of the forward primer was modified by introducing a sequence corresponding to the translation START codon (ATG), just before the sequence encoding the first amino acid of the original protein sequence. At the same time, the 5’ end of the forward primer contains an additional, typical for the Lactococcus lactis bacteria, RBS (ribosome-binding site) sequence, recognized by the translation machinery, and a ‘spacer’ (linker) sequence localized between the RBS region and the translation START codon. In the method, according to the invention, favorably, the 5’ ends of both primers carry additional sequences recognized by specific restriction enzymes, preferably BoxI (forward) and AgeI and BoxI (reverse), for the gene encoding chIL-2. Additionally, 5’ ends of reverse primers carry a repeated sequence corresponding to the translation STOP codon (TAA), and one - a His-tag (6xHis) sequence.
In effect of PCR amplification using such designed primers, according to the invention, DNA fragments are obtained, which nucleotide sequences are presented on fig. 1, 2, 3, 4 , 5, 6, and comprise sequences of genes encoding the studied heterologous proteins (underlined fragments).
The method of cloning the generated genes of selected heterologous proteins in lactic acid bacteria strains is based, according to the invention, on subjecting them to double digestion by restriction enzymes, preferably BamHI and XhoI for HA and BoxI for chIL-2, and then ligating them with a plasmid vector that replicates in lactic acid bacteria cells, favorably in Lactococcus genus, in particular with pIL253, digested beforehand with the same restriction enzymes to obtain recombinant plasmids, in which the orientation of the cloned PCR products (inserts) would be in accordance with the direction of transcription directed from the internal promoter present on the vector. The recombinant DNA is introduced by electroporation into cells of bacterial strains, which are cultured in a known manner. Cells containing the new gene are isolated from the culture population, favorably by analyzing the obtained transformants by PCR technique for the presence of inserts which contain respective genes. Nucleotide sequences of the cloned genes are examined for conformity with the nucleotide sequences of the synthetic genes by DNA sequencig technique.
Best Mode for Carrying Out the Invention
The subject of the invention are also bacterial strains from strains from Lactococcus genus, e.g. Lactococcus lactis IL1403, Lactococcus lactis IBB477 and Lactococcus lactis IBB360, differing in their viability in the mammalian gut as well as other genera of lactic acid bacteria, preferably Lactobacillus and Bifidobacterium, carrying a plasmid selected from a group of plasmids harboring single variants of the viral haemagglutinin gene, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His) and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig. 6 (chIL-2), encoding respective heterologous proteins, which amino acid sequences are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and chicken interleukin 2 protein, which sequence is presented on fig. 6a (chIL-2).
In the method, accroding to the invention, it is favourable to carry out the expression of genes of selected heterologous proteins in cells of lactic acid bacteria strains, in particular from Lactococcus genus, by culturing them in a known medium specific for lactic acid bacteria, preferably on M17 medium or defined CDM medium (chemically defined medium), supplemented with sugar, favorably glucose or cellobiose, at a concentration no less than 0.5% or on milk, or other suitable medium, at a temperature ranging between 20
Figure eolf-appb-I000001
C-30
Figure eolf-appb-I000002
C, preferably at 30
Figure eolf-appb-I000003
C, until reaching optical density OD600 > 0.6. Bacterial material obtained this way is used in respective expression analyses of the studied genes.
The method of analyzing expression of genes encoding selected heterologous proteins on the transcription level, according to the invention, is carried out using the RT-PCR (reverse transcriptase PCR) method. Total RNA is isolated by known method from bacterial strains carrying the recombinant plasmids, which after specific treatment is subjected to reverse transcription reaction using primers (reverse) complementary to the 3’ end of the gene, favorably reverse starters listed in TABLE 2. Obatined cDNA is subsequently subjected to amplification by the classical PCR technique using an appropriate pair of primers (forward and reverse), favorably primers which sequences are listed in TABLE 1. In result of the carried out experiment specific products are obtained for each of the analyzed genes, which length corresponds to the length of the amplified region.
The method of analyzing expression of genes of selected heterologous proteins on the translation level, according to the invention, is carried out by known immunolgical methods, preferably dot-blot and western-blot techniques, using protein extracts, obtained by described methods from particular recombinant bacterial cells and suspended in a buffer of slightly alkalic pH, preferably in PBS buffer, pH 7.4, and adequate specific antibodies.
The method of optimizing the biosynthesis of selected heterologous proteins is based, according to the invention, on replacing the internal, constitutive promoter of the plasmid vector, replicating in L. lactis cells, favorably with the promoter region of a gene deriving from the genome of L. lactis bacteria, preferably by a promoter region of the ptcB gene engaged in sugar catabolism in lactic acid bacteria from the Lactococcus genus, which is regulated by the presence of various sugars in the medium, such as: glucose, cellobiose, galactose, salicin, esculin. Expression of genes of selected heterologous proteins in cells of lactic acid bacteria, favourably from Lactococcus genus, according to the invetion, is based on culturing cells carrying the recombinant plasmid vector (with the cloned gene and adequate promoter region, favourably promoter of the ptcB gene, which comprises the -10 and -35 sequence region, presented on fig. 7, from the genome fo the Lactococcus lactis IL1403 bacterial strain) on known medium specific for lactic acid bacteria, especially on milk or whey, preferably on defined CDM (chemically defined medium) medium, supplemented with sugar, favorably glucose or cellobiose, at a concentration ≥ 0.5%, at a temperature ranging between 20
Figure eolf-appb-I000004
C-30
Figure eolf-appb-I000005
C, preferably at 30
Figure eolf-appb-I000006
C, until reaching optical density OD600 > 0.6, pelleting the bacterial culture, collecting the supernatant and isolating, from both, proteins with known methods.
The method of cloning the ptcB promoter region, according to the invention, is favorably based on generating by PCR technique the promoter region of the ptcB gene, which is induced by various sugars as carbon source, preferably cellobiose, by using chromosomal DNA of L. lactis IL1403 strain as template and appropriate pair of primers (forward and reverse) complementary to the ends of the promoter region of the chormolsomal ptcB gene and modified in such a way that their 5’ ends contain sequences recognized by specific restriction endonucleases, preferably VspI (for the forward primer) and NciI (for the reverse primer) (TABLE 3). In result of the PCR reaction, by using such designed primers, according to the invention, a DNA fragment is obtained, which nucleotide sequence is presented on fig. 7, comprising the cloned promoter region including the -10 and -35 region (underlined fragment).
In the next step, the obtained PCR product is subjected to digestion preferably using the listed enzymes and ligating it with the reombinant vectors carrying genes encoding selected heterologous proteins, from which the original promoter region was removed (e.g. by distestion using the same restictases). The recombinant DNA is introduced by electroporation method into cells of bacterial strains which are then cultured by known means. Cells containing the new promoter region are isolated from the cultured population, favorably by analyzing the obtained transformants by PCR technique for the presence of expected DNA fragments. Nucleotide sequences of the cloned promoter region are confirmed by DNA sequencing.
The immunogenic composition for induction of immunological response against the avian influenza virus in the bird host, according to the invention, contains at least one Lactococcus, Lactobacillus or Bifidobacterium strain, favorably from Lactococcus lactis, carrying a plasmid selected from a group of plasmids harboring single genes of viral haemagglutinin variants, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig. 6 (chIL-2) that encode respective heterologous proteins, which amino acid sequences are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and the chicken interleukin 2 protein, which amino acid sequence is presented on fig. 6a (chIL-2).
An effective vaccine against the avian influenza virus, according to the invention, is characteristic by the fact that it contains the immunogenic composition of at least one Lactococcus, Lactobacillus or Bifidobacterium strain, favorably from Lactococcus lactis, in particular Lactococcus lactis IL1403, Lactococcus lactis IBB477 or Lactococcus lactis IBB360, which carries a plasmid selected from a group of plasmids harboring single genes of the viral haemagglutinin variants, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig. 6 (chIL-2), encoding respective heterologous proteins, which amino acid sequences are shown on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and the chicken interleukin 2 protein, which amino acid sequence is presented on fig. 6a (chIL-2).
The effect of applying the constructed, according to the invention, lactic acid bacteria strains, preferably Lactococcus lactis IL1403, Lactococcus lactis IBB477 and Lactococcus lactis IBB360 or other lactic acid bacteria, preferably Lactobacillus and Bifidobacterium, as vaccines, is induction of specific immune response in birds, which leads to generating immunological protection against infection by a virulent avian influenza viral strain. The most effective variants may serve to combat the avian influenza virus at the prevention level.
Presented below are examples of the implementing the invention.
Example I.
The haemagglutinin (HA) gene of the avian influenza virus, its individual variants and the chicken interleukin 2 (chIL-2) gene were generated by amplification by PCR method using specific cDNA as template and 2 complementary primers for each gene encoding a selected protein (TABLE 1). In result of the PCR amplification reactions, the following PCR products were obtained: HA1-568, HA17-568, HA17-522, HA1-568His, HA17-568His, chIL-2, encoding respective amino acid sequences: HA1-568 aa, HA17-568 aa, HA17-522 aa, HA1-568His aa, HA17-568His aa, chIL-2 aa. Next, the obtained products were subjected to digestion by specific restriction enzymes: BamHI (forward) and XhoI (reverse) for HA gene varinats and BoxI for the chIL-2 gene. Subsequently, the digested products were recombined with the Lactococcus lactis plasmid vector, pIL253, digested beforehand with the same restriction enzymes to obtain adequate recombinant plasmids, in which the orientation of the cloned PCR products (inserts) is in accordance with the direction of transcription directed from the internal promoter present on the vector. The recombinant DNA was introduced by electroporation into selected Lactococcus lactis bacteria strains: IL1403, IBB360 and IBB477, which were cultured in a known manner. The presence of specific gene sequences was confirmed by PCR method. Nucleotide sequences of the cloned genes were examined for conformity with the nucleotide sequences of the original genes by DNA sequencig.
Example II.
Cloned genes: HA1-568, HA17-568, HA17-522, HA1-568His, HA17-568His, chIL-2, were analyzed on the transcriptional level by the RT-PCR method. Total RNA was isolated from bacterial strains carrying the recombinant plasmids and, after specific treatment, was subjected to reverse transcription reaction using primers (reverse) complementary to the 3’ end of the gene (TABLE 2). Obatined cDNA was subsequently subjected to amplification by the classical PCR technique using a pair of primers (forward and reverse), specific for the cloned genes (TABLE 1). For all constructs, amplification products were obtained, which on the agarose gel had a length corresponding to the length of the examined region.
Example III.
Studies on expression of genes encoding proteins: HA1-568 aa, HA17-568 aa, HA17-522 aa, HA1-568His aa, HA17-568His aa, chIL-2 aa, were based on culturing the cells of the transformed strains on defined CDM medium, supplemented with glucose or cellobiose, at a concentration of 0.5%, at a temperature of 30
Figure eolf-appb-I000007
C, until reaching optical density OD600 > 0.6. Both, from the obtained bacterial mass as well as from the supernatant proteins were isolated, which were suspended in PBS buffer, pH 7.4. Identification of specific proteins was performed using dot-blot and western-blot reactions using adequate mono- and polyclonal antibodies. Positive reaction results were obtained for all examined variants.
Example IV.
To increase the efficiency of production of the analyzed heterologous proteins, the internal promoter present in the pIL253 plasmid vector was replaced by the ptcB promoter. The promoter region was amplified by PCR reaction using a pair of specific primers (Table 3). Obtained PCR product was digested by restriction enzymes VspI and NciI. The promoter region prepared in such way was introduced in the pIL253 vector, digested beforehand by the same restriction enzymes, in place of the original plasmid promoter. Transformants were analyzed by PCR technique to confirm the presence of the expected DNA fragment. Conformity of the nucleotide sequence was confirmed by sequencing. Using such approach, strain variants were obtained, in which the studied heterologous genes, HA1-568, HA17-568, HA17-522, HA1-568His, HA17-568His, chIL-2, were under the regulation of the ptcB promoter undergoing induction in the presence of various sugars as carbon source. Functionality of the promoter and the expression level of the studied genes were analyzed as in examples II and III.
Materials and methods
Bacterial strains, culture conditions and plasmids used.
Bacterial strains and plasmids used in presented studies are shown in TABLE 4. Lactococcus lactis strains were cultured in M17 medium (Oxoid, Anglia) supplemented with 0.5 % glucose or in defined CDM medium supplemented with glucose or cellobiose (0.5%- 1%), at a temperature of 30
Figure eolf-appb-I000008
C. When needed, for selection purposes, the following antibiotics were used: erythromycin 5 µg/ml for L. lactis IL1403 and IBB360 strains and erythromycin 5 µg/ml and tetracyclin 2 µg/ml for IBB 477 strain.
TABLE 1.
Table 1
Primer name Nucleotide sequence
HA For 5’ CGGGATCCCG AAGGAGTATT TCTATGGAGA ATATAGTGC TTCTTT 3’
HA17 For 5’ CGGGATCCG AAGGAGTATT TCTATG CAGATTTGCATTGGTTACC 3’
HA Rev 5’ CCGCTCGAGTTAAATGCAAATTCT 3’
HA522 Rev 5’ CCGGCTCGAGTTATTATACTCCACTTATTTCCTC 3’
HA His Rev 5’CCGCTCGAGTTATTAATGATGATGATGATGATGAATGCAAATTCTGCGTTG 3’
chIL-2 For 5’GC GACGAGCGTCAAAAGGAGGTATTTCTATGATGTGCAAATGA3’
chIL-2 Rev 5’ CGGACGAGCGTCGCGACCGGTTTATTATTTTTGCAG3’
TABLE 2.
Table 2
Name of reverse primer in RT-PCR reaction Nucleotide sequence
HA Rev 5’ CCGCTCGAGTTAAATGCAAATTCT 3’
HA 522 Rev 5’ CCGGCTCGAGTTATTATACTCCACTTATTTCCTC 3’
chIL-2 Rev 5’CGGACGAGCGTCGCGACCGGTTTATTATTTTTGCAG3’
TABLE 3.
Table 3
Primer name Nucleotide sequence
ptcB For 5’GCGATTAATGTCGCCTAAAGGTTGC3’
ptcB Rev 5’ AATCCCGGCGTTTTATAATTTAACGTTC3’
TABLE 4.
Table 4
Lactococcus strains and plasmids used source Name
Plasmid-free laboratory strain Chopin et al. 1984 IL1403
Autolytic strain J. Bardowski – IBB PAN collection IBB 360
Adhesive strain J. Zycka-Krzesinska – IBB PAN collection IBB 477
Lactococcus bacterial plasmid Simon and Chopin 1988 pIL253
Sequence Listing Free Text
SEQUENCE LISTING
<110> INSTYTUT BIOCHEMII I BIOFIZYKI PAN
<120> Means of constructing lactic acid bacteria strains containing genes encoding heterologous avian influenza virus haemagglutinin and chicken interleukin 2 (chIL-2) protein and their production, lactic acid bacteria strain(s) carrying these genes (or gene), their application to induce an effective immunological response against the avian influenza virus and application of the ptcB gene promoter region to optimize the production of heterologous proteins
<130> 4288
<140> EPPL391994
<141> 2010-07-02
<160> 12
<170> BiSSAP 1.0
<210> 1
<211> 1739
<212> DNA
<213> Influenza A virus
<220>
<221> source
<222> 1..1739
<223> /mol_type="DNA"
/note="lactic acid bascteria"
/organism="Influenza A virus"
<400> 1
cgggatcccg aaggagtatt tctatggaga atatagtgct tctttttgca atagtcagtc 60
ttgttaaaag tgatcagatt tgcattggtt accatgcaaa caactcgaca gagcaggttg 120
acacaataat ggaaaagaac gtcactgtta cacacgccca agacatactg gaaaagacac 180
acaacgggaa gctctgcgat ctagatggag tgaagcctct aattttaaga gattgtagtg 240
tagctggatg gctcctcggg aacccaatgt gtgacgaatt cctcaatgtg ccggaatggt 300
cttacatagt ggagaagatc aatccagcca atgacctctg ttacccaggg aatttcaacg 360
actatgaaga actgaaacac ctattgagca gaataaacca ttttgagaaa attcagatca 420
tccccaaaag ttcttggtca gatcatgaag cctcatcagg ggtgagctca gcatgtccat 480
accagggaag gtcctccttt tttagaaatg tggtatggct tatcaaaaat gacaatgcat 540
acccaacaat aaagagaagc tacaataata ccaaccaaga agatcttttg gtactgtggg 600
ggattcacca tccaaatgat gcggcagagc agacaaggct ctatcaaaac ccaaccacct 660
atatttccgt tgggacatca acactaaacc agagattggt accaaaaata gctactagat 720
ccaaggtaaa cgggcaaagt ggaaggatgg agttcttttg gacaatttta aaaccgaatg 780
atgcaataaa ctttgagagt aatggaaatt tcattgctcc agaaaatgca tacaaaattg 840
tcaagaaagg ggactcaaca attatgaaaa gtgaattgga atatggtaac tgcaacacca 900
agtgtcaaac tccaataggg gcgataaact ctagtatgcc attccacaac atccaccctc 960
tcaccatcgg ggaatgcccc aaatatgtga aatcaaacag attagtcctt gcgactgggc 1020
tcagaaatag ccctcaagga gagagaagaa gaaaaaagag aggactattt ggagctatag 1080
caggttttat agagggagga tggcagggaa tggtagatgg ttggtatggg taccaccata 1140
gcaacgagca ggggagtggg tacgctgcag acaaagaatc cactcaaaag gcaatagatg 1200
gagtcaccaa taaggtcaac tcgatcatta acaaaatgaa cactcagttt gaggccgttg 1260
gaagggaatt taataactta gaaaggagaa tagaaaattt aaacaagaag atggaagacg 1320
gattcctaga tgtctggact tataatgctg aacttctggt tctcatggaa aatgagagaa 1380
ctctagactt tcatgactca aatgtcaaga acctttacga caaggtccga ctacagctta 1440
gggataatgc aaaggagctt ggtaacggtt gtttcgagtt ctatcacaga tgtgataatg 1500
aatgcatgga aagtgtaaga aacggaacgt atgactaccc gcagtattca gaagaagcaa 1560
gattaaaaag agaggaaata agtggagtaa aattggaatc aataggaacc taccaaatac 1620
tgtcaattta ttcaacagtg gcgagctccc tagcactggc aatcatggtg gctggtctat 1680
ctttatggat gtgctccaat ggatcgttac aacgcagaat ttgcatttaa ctcgagcgg 1739
<210> 2
<211> 1690
<212> DNA
<213> Influenza A virus
<220>
<221> source
<222> 1..1690
<223> /mol_type="DNA"
/organism="Influenza A virus"
<400> 2
cgggatccga aggagtattt ctatgcagat ttgcattggt taccatgcaa acaactcgac 60
agagcaggtt gacacaataa tggaaaagaa cgtcactgtt acacacgccc aagacatact 120
ggaaaagaca cacaacggga agctctgcga tctagatgga gtgaagcctc taattttaag 180
agattgtagt gtagctggat ggctcctcgg gaacccaatg tgtgacgaat tcctcaatgt 240
gccggaatgg tcttacatag tggagaagat caatccagcc aatgacctct gttacccagg 300
gaatttcaac gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa 360
aattcagatc atccccaaaa gttcttggtc agatcatgaa gcctcatcag gggtgagctc 420
agcatgtcca taccagggaa ggtcctcctt ttttagaaat gtggtatggc ttatcaaaaa 480
tgacaatgca tacccaacaa taaagagaag ctacaataat accaaccaag aagatctttt 540
ggtactgtgg gggattcacc atccaaatga tgcggcagag cagacaaggc tctatcaaaa 600
cccaaccacc tatatttccg ttgggacatc aacactaaac cagagattgg taccaaaaat 660
agctactaga tccaaggtaa acgggcaaag tggaaggatg gagttctttt ggacaatttt 720
aaaaccgaat gatgcaataa actttgagag taatggaaat ttcattgctc cagaaaatgc 780
atacaaaatt gtcaagaaag gggactcaac aattatgaaa agtgaattgg aatatggtaa 840
ctgcaacacc aagtgtcaaa ctccaatagg ggcgataaac tctagtatgc cattccacaa 900
catccaccct ctcaccatcg gggaatgccc caaatatgtg aaatcaaaca gattagtcct 960
tgcgactggg ctcagaaata gccctcaagg agagagaaga agaaaaaaga gaggactatt 1020
tggagctata gcaggtttta tagagggagg atggcaggga atggtagatg gttggtatgg 1080
gtaccaccat agcaacgagc aggggagtgg gtacgctgca gacaaagaat ccactcaaaa 1140
ggcaatagat ggagtcacca ataaggtcaa ctcgatcatt aacaaaatga acactcagtt 1200
tgaggccgtt ggaagggaat ttaataactt agaaaggaga atagaaaatt taaacaagaa 1260
gatggaagac ggattcctag atgtctggac ttataatgct gaacttctgg ttctcatgga 1320
aaatgagaga actctagact ttcatgactc aaatgtcaag aacctttacg acaaggtccg 1380
actacagctt agggataatg caaaggagct tggtaacggt tgtttcgagt tctatcacag 1440
atgtgataat gaatgcatgg aaagtgtaag aaacggaacg tatgactacc cgcagtattc 1500
agaagaagca agattaaaaa gagaggaaat aagtggagta aaattggaat caataggaac 1560
ctaccaaata ctgtcaattt attcaacagt ggcgagctcc ctagcactgg caatcatggt 1620
ggctggtcta tctttatgga tgtgctccaa tggatcgtta caacgcagaa tttgcattta 1680
actcgagcgg 1690
<210> 3
<211> 1556
<212> DNA
<213> Influenza A virus
<220>
<221> source
<222> 1..1556
<223> /mol_type="DNA"
/organism="Influenza A virus"
<400> 3
cgggatccga aggagtattt ctatgcagat ttgcattggt taccatgcaa acaactcgac 60
agagcaggtt gacacaataa tggaaaagaa cgtcactgtt acacacgccc aagacatact 120
ggaaaagaca cacaacggga agctctgcga tctagatgga gtgaagcctc taattttaag 180
agattgtagt gtagctggat ggctcctcgg gaacccaatg tgtgacgaat tcctcaatgt 240
gccggaatgg tcttacatag tggagaagat caatccagcc aatgacctct gttacccagg 300
gaatttcaac gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa 360
aattcagatc atccccaaaa gttcttggtc agatcatgaa gcctcatcag gggtgagctc 420
agcatgtcca taccagggaa ggtcctcctt ttttagaaat gtggtatggc ttatcaaaaa 480
tgacaatgca tacccaacaa taaagagaag ctacaataat accaaccaag aagatctttt 540
ggtactgtgg gggattcacc atccaaatga tgcggcagag cagacaaggc tctatcaaaa 600
cccaaccacc tatatttccg ttgggacatc aacactaaac cagagattgg taccaaaaat 660
agctactaga tccaaggtaa acgggcaaag tggaaggatg gagttctttt ggacaatttt 720
aaaaccgaat gatgcaataa actttgagag taatggaaat ttcattgctc cagaaaatgc 780
atacaaaatt gtcaagaaag gggactcaac aattatgaaa agtgaattgg aatatggtaa 840
ctgcaacacc aagtgtcaaa ctccaatagg ggcgataaac tctagtatgc cattccacaa 900
catccaccct ctcaccatcg gggaatgccc caaatatgtg aaatcaaaca gattagtcct 960
tgcgactggg ctcagaaata gccctcaagg agagagaaga agaaaaaaga gaggactatt 1020
tggagctata gcaggtttta tagagggagg atggcaggga atggtagatg gttggtatgg 1080
gtaccaccat agcaacgagc aggggagtgg gtacgctgca gacaaagaat ccactcaaaa 1140
ggcaatagat ggagtcacca ataaggtcaa ctcgatcatt aacaaaatga acactcagtt 1200
tgaggccgtt ggaagggaat ttaataactt agaaaggaga atagaaaatt taaacaagaa 1260
gatggaagac ggattcctag atgtctggac ttataatgct gaacttctgg ttctcatgga 1320
aaatgagaga actctagact ttcatgactc aaatgtcaag aacctttacg acaaggtccg 1380
actacagctt agggataatg caaaggagct tggtaacggt tgtttcgagt tctatcacag 1440
atgtgataat gaatgcatgg aaagtgtaag aaacggaacg tatgactacc cgcagtattc 1500
agaagaagca agattaaaaa gagaggaaat aagtggagta ccggctcgag ttatta 1556
<210> 4
<211> 1757
<212> DNA
<213> Influenza A virus
<220>
<221> source
<222> 1..1757
<223> /mol_type="DNA"
/organism="Influenza A virus"
<400> 4
cgggatcccg aaggagtatt tctatggaga atatagtgct tctttttgca atagtcagtc 60
ttgttaaaag tgatcagatt tgcattggtt accatgcaaa caactcgaca gagcaggttg 120
acacaataat ggaaaagaac gtcactgtta cacacgccca agacatactg gaaaagacac 180
acaacgggaa gctctgcgat ctagatggag tgaagcctct aattttaaga gattgtagtg 240
tagctggatg gctcctcggg aacccaatgt gtgacgaatt cctcaatgtg ccggaatggt 300
cttacatagt ggagaagatc aatccagcca atgacctctg ttacccaggg aatttcaacg 360
actatgaaga actgaaacac ctattgagca gaataaacca ttttgagaaa attcagatca 420
tccccaaaag ttcttggtca gatcatgaag cctcatcagg ggtgagctca gcatgtccat 480
accagggaag gtcctccttt tttagaaatg tggtatggct tatcaaaaat gacaatgcat 540
acccaacaat aaagagaagc tacaataata ccaaccaaga agatcttttg gtactgtggg 600
ggattcacca tccaaatgat gcggcagagc agacaaggct ctatcaaaac ccaaccacct 660
atatttccgt tgggacatca acactaaacc agagattggt accaaaaata gctactagat 720
ccaaggtaaa cgggcaaagt ggaaggatgg agttcttttg gacaatttta aaaccgaatg 780
atgcaataaa ctttgagagt aatggaaatt tcattgctcc agaaaatgca tacaaaattg 840
tcaagaaagg ggactcaaca attatgaaaa gtgaattgga atatggtaac tgcaacacca 900
agtgtcaaac tccaataggg gcgataaact ctagtatgcc attccacaac atccaccctc 960
tcaccatcgg ggaatgcccc aaatatgtga aatcaaacag attagtcctt gcgactgggc 1020
tcagaaatag ccctcaagga gagagaagaa gaaaaaagag aggactattt ggagctatag 1080
caggttttat agagggagga tggcagggaa tggtagatgg ttggtatggg taccaccata 1140
gcaacgagca ggggagtggg tacgctgcag acaaagaatc cactcaaaag gcaatagatg 1200
gagtcaccaa taaggtcaac tcgatcatta acaaaatgaa cactcagttt gaggccgttg 1260
gaagggaatt taataactta gaaaggagaa tagaaaattt aaacaagaag atggaagacg 1320
gattcctaga tgtctggact tataatgctg aacttctggt tctcatggaa aatgagagaa 1380
ctctagactt tcatgactca aatgtcaaga acctttacga caaggtccga ctacagctta 1440
gggataatgc aaaggagctt ggtaacggtt gtttcgagtt ctatcacaga tgtgataatg 1500
aatgcatgga aagtgtaaga aacggaacgt atgactaccc gcagtattca gaagaagcaa 1560
gattaaaaag agaggaaata agtggagtaa aattggaatc aataggaacc taccaaatac 1620
tgtcaattta ttcaacagtg gcgagctccc tagcactggc aatcatggtg gctggtctat 1680
ctttatggat gtgctccaat ggatcgttac aacgcagaat ttgcattcat catcatcatc 1740
atcattaact cgagcgg 1757
<210> 5
<211> 1708
<212> DNA
<213> Influenza A virus
<220>
<221> source
<222> 1..1708
<223> /mol_type="DNA"
/organism="Influenza A virus"
<400> 5
cgggatccga aggagtattt ctatgcagat ttgcattggt taccatgcaa acaactcgac 60
agagcaggtt gacacaataa tggaaaagaa cgtcactgtt acacacgccc aagacatact 120
ggaaaagaca cacaacggga agctctgcga tctagatgga gtgaagcctc taattttaag 180
agattgtagt gtagctggat ggctcctcgg gaacccaatg tgtgacgaat tcctcaatgt 240
gccggaatgg tcttacatag tggagaagat caatccagcc aatgacctct gttacccagg 300
gaatttcaac gactatgaag aactgaaaca cctattgagc agaataaacc attttgagaa 360
aattcagatc atccccaaaa gttcttggtc agatcatgaa gcctcatcag gggtgagctc 420
agcatgtcca taccagggaa ggtcctcctt ttttagaaat gtggtatggc ttatcaaaaa 480
tgacaatgca tacccaacaa taaagagaag ctacaataat accaaccaag aagatctttt 540
ggtactgtgg gggattcacc atccaaatga tgcggcagag cagacaaggc tctatcaaaa 600
cccaaccacc tatatttccg ttgggacatc aacactaaac cagagattgg taccaaaaat 660
agctactaga tccaaggtaa acgggcaaag tggaaggatg gagttctttt ggacaatttt 720
aaaaccgaat gatgcaataa actttgagag taatggaaat ttcattgctc cagaaaatgc 780
atacaaaatt gtcaagaaag gggactcaac aattatgaaa agtgaattgg aatatggtaa 840
ctgcaacacc aagtgtcaaa ctccaatagg ggcgataaac tctagtatgc cattccacaa 900
catccaccct ctcaccatcg gggaatgccc caaatatgtg aaatcaaaca gattagtcct 960
tgcgactggg ctcagaaata gccctcaagg agagagaaga agaaaaaaga gaggactatt 1020
tggagctata gcaggtttta tagagggagg atggcaggga atggtagatg gttggtatgg 1080
gtaccaccat agcaacgagc aggggagtgg gtacgctgca gacaaagaat ccactcaaaa 1140
ggcaatagat ggagtcacca ataaggtcaa ctcgatcatt aacaaaatga acactcagtt 1200
tgaggccgtt ggaagggaat ttaataactt agaaaggaga atagaaaatt taaacaagaa 1260
gatggaagac ggattcctag atgtctggac ttataatgct gaacttctgg ttctcatgga 1320
aaatgagaga actctagact ttcatgactc aaatgtcaag aacctttacg acaaggtccg 1380
actacagctt agggataatg caaaggagct tggtaacggt tgtttcgagt tctatcacag 1440
atgtgataat gaatgcatgg aaagtgtaag aaacggaacg tatgactacc cgcagtattc 1500
agaagaagca agattaaaaa gagaggaaat aagtggagta aaattggaat caataggaac 1560
ctaccaaata ctgtcaattt attcaacagt ggcgagctcc ctagcactgg caatcatggt 1620
ggctggtcta tctttatgga tgtgctccaa tggatcgtta caacgcagaa tttgcattca 1680
tcatcatcat catcattaac tcgagcgg 1708
<210> 6
<211> 483
<212> DNA
<213> Influenza A virus
<220>
<221> source
<222> 1..483
<223> /mol_type="DNA"
/organism="Influenza A virus"
<400> 6
gcgacgagcg tcaaaaggag gtatttctat gatgtgcaaa gtactgatct ttggctgtat 60
ttcggtagca atgctaatga ctacagctta tggagcatct ctatcatcag caaaaaggaa 120
acctcttcaa acattaataa aggatttaga aatattggaa aatatcaaga acaagattca 180
tctcgagctc tacacaccaa ctgagaccca ggagtgcacc cagcaaactc tgcagtgtta 240
cctgggagaa gtggttactc tgaagaaaga aactgaagat gacactgaaa ttaaagaaga 300
atttgtaact gctattcaaa atatcgaaaa gaacctcaag agtcttacgg gtctaaatca 360
caccggaagt gaatgcaaga tctgtgaagc taacaacaag aaaaaatttc ctgattttct 420
ccatgaactg accaactttg tgagatatct gcaaaaataa taaccatggc gggacgctcg 480
tcg 483
<210> 7
<211> 568
<212> PRT
<213> Influenza A virus
<220>
<221> SOURCE
<222> 1..568
<223> /mol_type="protein"
/organism="Influenza A virus"
<400> 7
Met Glu Asn Ile Val Leu Leu Phe Ala Ile Val Ser Leu Val Lys Ser
1 5 10 15
Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val
20 25 30
Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile
35 40 45
Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys
50 55 60
Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn
65 70 75 80
Pro Met Cys Asp Glu Phe Leu Asn Val Pro Glu Trp Ser Tyr Ile Val
85 90 95
Glu Lys Ile Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn
100 105 110
Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu
115 120 125
Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser
130 135 140
Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe
145 150 155 160
Arg Asn Val Val Trp Leu Ile Lys Asn Asp Asn Ala Tyr Pro Thr Ile
165 170 175
Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp
180 185 190
Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln
195 200 205
Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg
210 215 220
Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly
225 230 235 240
Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn
245 250 255
Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile
260 265 270
Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly
275 280 285
Asn Cys Asn Thr Lys Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser
290 295 300
Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys
305 310 315 320
Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser
325 330 335
Pro Gln Gly Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile
340 345 350
Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr
355 360 365
Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys
370 375 380
Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser
385 390 395 400
Ile Ile Asn Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe
405 410 415
Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp
420 425 430
Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met
435 440 445
Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu
450 455 460
Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly
465 470 475 480
Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu
485 490 495
Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala
500 505 510
Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly
515 520 525
Thr Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala
530 535 540
Leu Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly
545 550 555 560
Ser Leu Gln Arg Arg Ile Cys Ile
565
<210> 8
<211> 552
<212> PRT
<213> Influenza A virus
<220>
<221> SOURCE
<222> 1..552
<223> /mol_type="protein"
/organism="Influenza A virus"
<400> 8
Met Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val
1 5 10 15
Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile
20 25 30
Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys
35 40 45
Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn
50 55 60
Pro Met Cys Asp Glu Phe Leu Asn Val Pro Glu Trp Ser Tyr Ile Val
65 70 75 80
Glu Lys Ile Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn
85 90 95
Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu
100 105 110
Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser
115 120 125
Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe
130 135 140
Arg Asn Val Val Trp Leu Ile Lys Asn Asp Asn Ala Tyr Pro Thr Ile
145 150 155 160
Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp
165 170 175
Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln
180 185 190
Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg
195 200 205
Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly
210 215 220
Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn
225 230 235 240
Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile
245 250 255
Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly
260 265 270
Asn Cys Asn Thr Lys Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser
275 280 285
Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys
290 295 300
Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser
305 310 315 320
Pro Gln Gly Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile
325 330 335
Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr
340 345 350
Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys
355 360 365
Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser
370 375 380
Ile Ile Asn Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe
385 390 395 400
Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp
405 410 415
Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met
420 425 430
Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu
435 440 445
Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly
450 455 460
Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu
465 470 475 480
Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala
485 490 495
Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly
500 505 510
Thr Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala
515 520 525
Leu Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly
530 535 540
Ser Leu Gln Arg Arg Ile Cys Ile
545 550
<210> 9
<211> 506
<212> PRT
<213> Influenza A virus
<220>
<221> SOURCE
<222> 1..506
<223> /mol_type="protein"
/organism="Influenza A virus"
<400> 9
Met Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val
1 5 10 15
Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile
20 25 30
Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys
35 40 45
Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn
50 55 60
Pro Met Cys Asp Glu Phe Leu Asn Val Pro Glu Trp Ser Tyr Ile Val
65 70 75 80
Glu Lys Ile Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn
85 90 95
Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu
100 105 110
Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser
115 120 125
Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe
130 135 140
Arg Asn Val Val Trp Leu Ile Lys Asn Asp Asn Ala Tyr Pro Thr Ile
145 150 155 160
Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp
165 170 175
Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln
180 185 190
Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg
195 200 205
Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly
210 215 220
Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn
225 230 235 240
Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile
245 250 255
Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly
260 265 270
Asn Cys Asn Thr Lys Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser
275 280 285
Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys
290 295 300
Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser
305 310 315 320
Pro Gln Gly Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile
325 330 335
Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr
340 345 350
Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys
355 360 365
Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser
370 375 380
Ile Ile Asn Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe
385 390 395 400
Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp
405 410 415
Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met
420 425 430
Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu
435 440 445
Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly
450 455 460
Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu
465 470 475 480
Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala
485 490 495
Arg Leu Lys Arg Glu Glu Ile Ser Gly Val
500 505
<210> 10
<211> 574
<212> PRT
<213> Influenza A virus
<220>
<221> SOURCE
<222> 1..574
<223> /mol_type="protein"
/organism="Influenza A virus"
<400> 10
Met Glu Asn Ile Val Leu Leu Phe Ala Ile Val Ser Leu Val Lys Ser
1 5 10 15
Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val
20 25 30
Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile
35 40 45
Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys
50 55 60
Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn
65 70 75 80
Pro Met Cys Asp Glu Phe Leu Asn Val Pro Glu Trp Ser Tyr Ile Val
85 90 95
Glu Lys Ile Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn
100 105 110
Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu
115 120 125
Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser
130 135 140
Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe
145 150 155 160
Arg Asn Val Val Trp Leu Ile Lys Asn Asp Asn Ala Tyr Pro Thr Ile
165 170 175
Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp
180 185 190
Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln
195 200 205
Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg
210 215 220
Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly
225 230 235 240
Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn
245 250 255
Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile
260 265 270
Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly
275 280 285
Asn Cys Asn Thr Lys Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser
290 295 300
Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys
305 310 315 320
Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser
325 330 335
Pro Gln Gly Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile
340 345 350
Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr
355 360 365
Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys
370 375 380
Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser
385 390 395 400
Ile Ile Asn Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe
405 410 415
Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp
420 425 430
Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met
435 440 445
Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu
450 455 460
Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly
465 470 475 480
Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu
485 490 495
Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala
500 505 510
Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly
515 520 525
Thr Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala
530 535 540
Leu Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly
545 550 555 560
Ser Leu Gln Arg Arg Ile Cys Ile His His His His His His
565 570
<210> 11
<211> 558
<212> PRT
<213> Influenza A virus
<220>
<221> SOURCE
<222> 1..558
<223> /mol_type="protein"
/organism="Influenza A virus"
<400> 11
Met Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val
1 5 10 15
Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile
20 25 30
Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys
35 40 45
Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn
50 55 60
Pro Met Cys Asp Glu Phe Leu Asn Val Pro Glu Trp Ser Tyr Ile Val
65 70 75 80
Glu Lys Ile Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn
85 90 95
Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu
100 105 110
Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser
115 120 125
Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe
130 135 140
Arg Asn Val Val Trp Leu Ile Lys Asn Asp Asn Ala Tyr Pro Thr Ile
145 150 155 160
Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp
165 170 175
Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln
180 185 190
Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg
195 200 205
Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly
210 215 220
Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn
225 230 235 240
Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile
245 250 255
Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly
260 265 270
Asn Cys Asn Thr Lys Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser
275 280 285
Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys
290 295 300
Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser
305 310 315 320
Pro Gln Gly Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile
325 330 335
Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr
340 345 350
Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys
355 360 365
Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser
370 375 380
Ile Ile Asn Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe
385 390 395 400
Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp
405 410 415
Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met
420 425 430
Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu
435 440 445
Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly
450 455 460
Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu
465 470 475 480
Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala
485 490 495
Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly
500 505 510
Thr Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala
515 520 525
Leu Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly
530 535 540
Ser Leu Gln Arg Arg Ile Cys Ile His His His His His His
545 550 555
<210> 12
<211> 143
<212> PRT
<213> Influenza A virus
<220>
<221> SOURCE
<222> 1..143
<223> /mol_type="protein"
/organism="Influenza A virus"
<400> 12
Met Met Cys Lys Val Leu Ile Phe Gly Cys Ile Ser Val Ala Met Leu
1 5 10 15
Met Thr Thr Ala Tyr Gly Ala Ser Leu Ser Ser Ala Lys Arg Lys Pro
20 25 30
Leu Gln Thr Leu Ile Lys Asp Leu Glu Ile Leu Glu Asn Ile Lys Asn
35 40 45
Lys Ile His Leu Glu Leu Tyr Thr Pro Thr Glu Thr Gln Glu Cys Thr
50 55 60
Gln Gln Thr Leu Gln Cys Tyr Leu Gly Glu Val Val Thr Leu Lys Lys
65 70 75 80
Glu Thr Glu Asp Asp Thr Glu Ile Lys Glu Glu Phe Val Thr Ala Ile
85 90 95
Gln Asn Ile Glu Lys Asn Leu Lys Ser Leu Thr Gly Leu Asn His Thr
100 105 110
Gly Ser Glu Cys Lys Ile Cys Glu Ala Asn Asn Lys Lys Lys Phe Pro
115 120 125
Asp Phe Leu His Glu Leu Thr Asn Phe Val Arg Tyr Leu Gln Lys
130 135 140

Claims (10)

  1. Lactococcus lactis, Lactobacillus and Bifidobacterium strains, in particular Lactococcus lactis IL1403, Lactococcus lactis IBB477, Lactococcus lactis IBB360, carrying a gene, which nucleotide sequence is presented on fig. 1 – 6, encoding selected respective heterologous protein, which amino acid sequence presented on fig. 1a - 6a.
  2. The method of generating the gene encoding a heterologous haemagglutinin protein (HA) of the avian influenza virus and its variants, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), characteristic by the fact that such genes are synthesized by PCR method using cDNA as template and 2 complementary primers for each gene (Table 1), which nucleotide sequences were designed in such a way so they would correspond to codons preferably occurring in bacteria from Lactococcus lactis species as well as Lactobacillus and Bifidobacterium genera, where additionally the nucleotide sequence of forward primers for each gene was modified by introducing a sequence corresponding to the translation START codon (ATG), just before the sequence encoding the first amino acid of the original peptide sequence. At the same time, the 5’ ends of the forward primers contain an additional, typical of the Lactococcus lactis, RBS (ribosome-binding site) sequence recognized by the translation machinery and a ‘spacer’ sequence (linker) localized between the RBS region and the translation START codon.
  3. The method, according to claim 2, characteristic by the fact that 5’ ends of primers carry additional sequences recognized by specific restriction endonucleases, preferably BamHI (forward) and XhoI (reverse) for HA genes.
  4. The method of generating the gene encoding the chicken interleukin 2 chIL-2 protein, which nucleotide sequence is presented on fig. 6, characteristic by the fact, that the gene is synthesized by PCR method using cDNA as template and 2 complementary primers (Table 1), which nucleotide sequences were designed in such a way so they would correspond to codons preferably occurring in bacteria from Lactococcus lactis species as well as Lactobacillus and Bifidobacterium genera, where, additionally, nucleotide sequences of each forward primers were modified by introducing a sequence corresponding to the translational codon START (ATG), just before the sequence encoding the first amino acid of the original protein sequence. At the same time, 5’ ends of forward primers contain an additional, typical for the Lactococcus lactis, RBS (ribosome-binding site) sequence recognized by the translational machinery and a ‘spacer’ sequence localized between the RBS region and the translation START codon.
  5. The method, according to claim 4, characteristic by the fact that the 5’ ends of the primers carry additional sequences recognized by specific restriction endonucleases, preferably BoxI (forward) and AgeI and BoxI (reverse) for the chIL-2 gene.
  6. The method of generating the promoter region of the ptcB gene, which nucleotide sequence is presented on fig.7, characteristic by the fact that the gene is synthesized by PCR method using chromosomal DNA of the L. lactis IL1403 strain as template and a pair of primers (forward and reverse) complementary to the ends of the sequence of the promoter region of the chromosomal ptcB gene and modified in such a way so the 5’ ends would include sequences recognized by adequate restriction endonucleases, preferably VspI (for forward primer) and NciI (for reverse primer) (TABLE 3).
  7. Application of the ptcB promoter, which comprises the -10 and -35 nucleotide sequences, presented on fig.7, according to claim 6, to optimize production of heterologous proteins.
  8. Immunogenic composition for induction of immune response against the avian influenza virus in the bird host, characteristic by the fact that it comprises at least one bacterial strain from the Lactococcus, Lactobacillus or Bifidobacterium genus, favorably from Lactococcus lactis species, carrying a plasmid harboring single variants of the viral haemagglutinin gene, which nucleotide sequences are presented on fig. 1 (HA 1-568), fig. 2 (HA 17-568), fig. 3 (HA17-522), fig. 4 (HA1-568His), fig. 5 (HA17-568His), encoding respective heterologous proteins, which amino acid sequences are presented on fig. 1a (HA 1-568), fig. 2a (HA 17-568), fig. 3a (HA17-522), fig. 4a (HA1-568His), fig. 5a (HA17-568His), and optionally the chicken interleukin 2 gene, which nucleotide sequence is presented on fig. 6 (chIL-2), encoding the respective protein, which amino acid sequence is presented on fig. 6a (chIL-2).
  9. Application of lactic acid bacteria containing the avian influenza virus HA gene variant(s) and/or chicken interleukin 2 gene, according to claim 1, to produce the immunogenic composition for induction of immunological response in birds.
  10. Effective vaccine against the avian influenza virus, characteristic by the fact that it contains the composition, according to claim 11, or an adequate lactic acid bacteria strain, according to claim 8.
PCT/EP2012/050097 2012-01-04 2012-01-04 Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application WO2013102492A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2012/050097 WO2013102492A1 (en) 2012-01-04 2012-01-04 Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2012/050097 WO2013102492A1 (en) 2012-01-04 2012-01-04 Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application

Publications (1)

Publication Number Publication Date
WO2013102492A1 true WO2013102492A1 (en) 2013-07-11

Family

ID=45476511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/050097 WO2013102492A1 (en) 2012-01-04 2012-01-04 Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application

Country Status (1)

Country Link
WO (1) WO2013102492A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110437317A (en) * 2019-01-30 2019-11-12 上海科技大学 Adeno-associated virus and application thereof with variant capsids albumen
CN111848759A (en) * 2020-07-27 2020-10-30 齐鲁工业大学 Cellulosomal dockerin mutant 36741 with improved activity and application thereof
CN113683707A (en) * 2021-09-13 2021-11-23 内江师范学院 Antigen fusion protein and coding gene and application thereof
CN113754785A (en) * 2021-09-30 2021-12-07 中南大学 Fusion protein, preparation method thereof and application thereof in preparation of fucosylation product
CN113773372A (en) * 2021-08-15 2021-12-10 北京科兴中维生物技术有限公司 Recombinant protein and preparation method and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LEI H ET AL: "Immunoprotection against influenza H5N1 virus by oral administration of enteric-coated recombinant Lactococcus lactis mini-capsules", VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 407, no. 2, 25 November 2010 (2010-11-25), pages 319 - 324, XP027402378, ISSN: 0042-6822, [retrieved on 20100920] *
LEI HAN ET AL: "Evaluation of Oral Immunization with Recombinant Avian Influenza Virus HA1 Displayed on the Lactococcus lactis Surface and Combined with the Mucosal Adjuvant Cholera Toxin Subunit B", CLINICAL AND VACCINE IMMUNOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, DC, US, vol. 18, no. 7, 1 July 2011 (2011-07-01), pages 1046 - 1051, XP009157582, ISSN: 1556-6811, [retrieved on 20110601] *
SEEGERS J F M L: "Lactobacilli as live vaccine delivery vectors: progress and prospects", TRENDS IN BIOTECHNOLOGY, ELSEVIER PUBLICATIONS, CAMBRIDGE, GB, vol. 20, no. 12, 1 December 2002 (2002-12-01), pages 508 - 515, XP004393459, ISSN: 0167-7799, DOI: 10.1016/S0167-7799(02)02075-9 *
WANG ZHISHENG ET AL: "Mucosal and Systemic Immune Responses Induced by Recombinant Lactobacillus spp. Expressing the Hemagglutinin of the Avian Influenza Virus H5N1", CLINICAL AND VACCINE IMMUNOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, DC, US, vol. 19, no. 2, 30 November 2011 (2011-11-30), pages 174 - 179, XP009157563, ISSN: 1556-6811 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110437317A (en) * 2019-01-30 2019-11-12 上海科技大学 Adeno-associated virus and application thereof with variant capsids albumen
CN110437317B (en) * 2019-01-30 2023-05-02 上海科技大学 Adeno-associated virus with variant capsid proteins and uses thereof
CN111848759A (en) * 2020-07-27 2020-10-30 齐鲁工业大学 Cellulosomal dockerin mutant 36741 with improved activity and application thereof
CN113773372A (en) * 2021-08-15 2021-12-10 北京科兴中维生物技术有限公司 Recombinant protein and preparation method and application thereof
CN113683707A (en) * 2021-09-13 2021-11-23 内江师范学院 Antigen fusion protein and coding gene and application thereof
CN113754785A (en) * 2021-09-30 2021-12-07 中南大学 Fusion protein, preparation method thereof and application thereof in preparation of fucosylation product
CN113754785B (en) * 2021-09-30 2023-07-21 中南大学 Fusion protein, preparation method thereof and application thereof in preparation of fucosylation product

Similar Documents

Publication Publication Date Title
US8142771B2 (en) Use of coccidian
CN110317278B (en) Fusion protein of SVV and FMDV, encoding gene, expression vector, cell line, engineering bacterium, vaccine and application thereof
CN113201507B (en) Recombinant pseudorabies virus and vaccine composition thereof
CN107257853A (en) New enterohemorrhagic escherichia coli phage E sc CHP 1 and its purposes for suppressing enterohemorrhagic escherichia coli propagation
Yan et al. Protection of chickens against infectious bronchitis virus with a multivalent DNA vaccine and boosting with an inactivated vaccine
US20220054625A1 (en) Immunogenic composition
WO2013102492A1 (en) Synthetic genes encoding peptide fragments of natural myelin proteins for induction of oral tolerance, dna fragment comprising these genes, means of obtaining these peptides in a microbial (bacterial) system and their medical application
CN113354743A (en) Multi-epitope antigen and vaccine for piglet diarrhea as well as preparation method and application of multi-epitope antigen and vaccine
CN115725002A (en) Escherichia coli specific antigen fusion protein and recombinant lactococcus lactis thereof
CN108330142B (en) Mermaid photorhabditis hemolysin Hly with immune protection effectchProtein
CN110564751A (en) Design and application of micro-ring DNA vaccine
US20240140996A1 (en) Method for increasing etec cs6 antigen presentation on cell surface and products obtainable thereof
CN112159479B (en) Mycoplasma gallisepticum multi-antigen epitope fusion protein pMG-mEA and application thereof
CN107129527B (en) Streptococcus equi subsp zooepidemicus protective antigen HP0623 and preparation method thereof
Nuñez-Ortiz et al. Immunostimulant properties of full-length and truncated Marinobacter algicola flagellins, and their effects against viral hemorrhagic septicemia virus (VHSV) in trout
KR102400570B1 (en) Virus-like particles comprising the apical membrane antigen 1 protein of toxoplasma worms, and vaccine composition using the same
CN104127883B (en) With many t cell epitopes tuberculosis gene vaccine that HSP65 is epi-position support
KR102016919B1 (en) Novel Salmonella specific bacteriophage SC1 and antibacterial composition comprising the same
CN101985630B (en) Recombinant Lactobacillus acidophilus for expressing highly pathogenic avian influenza virus H5 subtype hemagglutinin (HA) protein
CN105907776B (en) The subunit vaccine of the immune response for pig blue-ear disease poison can be induced
CN115819625B (en) Escherichia coli tetravalent antigen fusion polypeptide
CN112592410B (en) Canine adenovirus gene engineering subunit vaccine, preparation method and application thereof
CN104470537B (en) Salmonella typhi ty21a expressing yersinia pestis f1-v fusion protein and uses thereof
CN116813795B (en) Recombinant AaLS-BSP fusion peptide, preparation method and application
PL217827B1 (en) Gene encoding the heterologous protein of the avian influenza virus hemagglutinin, a gene encoding a heterologous protein of chicken interleukin-second (Chile-2), a method for obtaining these genes, a strain of lactic acid bacteria containing this gene/these genes, application thereof, immunogenic composition, a vaccine against avian influenza and the nucleotide sequence of the promoter region pf ptcB gene

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12700214

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12700214

Country of ref document: EP

Kind code of ref document: A1