CN107129527B

CN107129527B - Streptococcus equi subsp zooepidemicus protective antigen HP0623 and preparation method thereof

Info

Publication number: CN107129527B
Application number: CN201710395446.2A
Authority: CN
Inventors: 魏子贡; 赵鹏鹏; 梁辉煌; 唐斌
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2017-05-26
Filing date: 2017-05-26
Publication date: 2020-05-22
Anticipated expiration: 2037-05-26
Also published as: CN107129527A

Abstract

The invention relates to a streptococcus equi subsp zooepidemicus protective antigen HP0623 and its preparation method, said streptococcus equi subsp zooepidemicus protective antigen HP0623 is SEZ HP0623 recombinant protein, made up of 429 amino acid residues, the molecular weight is 47.04 kDa; the preparation method comprises gene cloning, enzyme digestion and enzyme ligation, induced expression and protein purification; the HP0623 can be used for preparing vaccines. The streptococcus equi subsp zooepidemicus protective antigen HP0623 shows good immunoreactivity in a mouse experiment, the generated antibody can provide stronger protection and induce high-level bactericidal capacity, the streptococcus equi subsp zooepidemicus protective antigen HP0623 is positioned on the surface of SEZ, and rHP0623 can inhibit the adhesion of SEZ to Hep-2 cells.

Description

Streptococcus equi subsp zooepidemicus protective antigen HP0623 and preparation method thereof

Technical Field

The invention relates to a streptococcus protective antigen, in particular to a streptococcus equi subsp zooepidemicus protective antigen HP0623 and a preparation method thereof.

Background

Streptococcosis is a very common animal pathogen, which can be divided into 20 groups, from a to V, lacking I and J, based on group-specific antigens. Animal pathogenic bacteria are more of Group B Streptococci (GBS) and Group C Streptococci (GCS), while human pathogenic bacteria are more of Group A Streptococci (GAS).

Streptococcus equi subsp zooepidemicus (SEZ) belongs to group C Streptococcus of Lancefield subgroup, has no host specific tropism, is easy to generate variation, and strains from different sources have different antigenicity. The bacterium can infect animals through the ways of alimentary canal, operation, trauma, vaccine injection, trauma and the like, thereby causing animal epidemic diseases such as septicemia, arthritis, mastitis, meningitis, endocarditis and the like of the animals. Humans can develop infections by either close contact with the diseased animal or eating food contaminated with the fungus. Antibiotics such as penicillin and amoxicillin have been used for preventing and treating the disease, but the use of a large amount of antibiotics causes problems such as the generation of drug resistance of the bacteria and the residue of antibiotics in animal products. Therefore, the use of vaccines to combat the disease can fundamentally solve these problems. However, because inactivated whole-cell vaccines often cause side effects such as immune syndrome, development of novel subunit protein vaccines is required to prevent the diseases. The cell surface anchored glyco-binding protein (HP0623) is a newly discovered protective antigen on the cell surface of streptococcus equi subsp zooepidemicus, which acts mainly on host cells and is therefore expected to be developed as a subunit vaccine against SEZ.

Disclosure of Invention

In order to solve the problems, the invention provides a streptococcus equi subsp zooepidemicus protective antigen HP0623 and a preparation method thereof, and the streptococcus equi subsp zooepidemicus protective antigen HP0623 can be effectively used for controlling streptococcus equi subsp zooepidemicus.

The technical scheme of the invention is as follows:

the HP0623 recombinant protein is SEZ HP0623 recombinant protein (rHP0623), is encoded by SEZ _0623 gene, consists of 429 amino acid residues, has a molecular weight of 47.04kDa, and has an amino acid sequence shown in SEQ ID NO. 2.

A preparation method of a streptococcus equi subsp zooepidemicus protective antigen HP0623 comprises the following steps:

1) and (3) PCR amplification: PCR amplification is carried out by using a genome of streptococcus equi subsp zooepidemicus SEZ C55138 strain as a template and using primers;

2) and (3) connecting with a carrier: the PCR product is cut by restriction endonuclease and then connected with pET-32a cut by the same enzyme; the restriction enzymes are BamH I and Hind III;

3) transformation and induction: transforming the connected vector into escherichia coli (E.coli BL21), placing the escherichia coli into a shaker at 37 ℃ for shake cultivation, and adding IPTG (isopropyl-beta-thiogalactoside) for induction for 3-5 hours when the OD value is 0.6-1.0;

4) and (3) purification: and centrifuging to collect thalli, carrying out heavy suspension by PBS, carrying out high-pressure crushing, centrifuging to collect supernatant, and purifying target protein of the supernatant by a Ni-NTA chromatographic column to obtain purified HP0623 recombinant protein.

The primers comprise a forward primer and a reverse primer, and the forward primer and the reverse primer respectively have 1 enzyme cutting site.

Further, the primers are:

forward primer (SEQ ID NO. 3): 5'-CCCGGATCCGCTTGCCTGCTAGTG-3', the underlined part is BamH I enzyme cutting site;

reverse primer (SEQ ID NO. 4): 5'-CTCAAGCTTGAGGGGAAGATCGTATC-3', the underlined part is HindIII enzyme cutting site;

use of streptococcus equi subsp zooepidemicus protective antigen HP0623 in preparation of streptococcus equi subsp zooepidemicus vaccine.

The method for preparing the streptococcus equi subsp zooepidemicus vaccine by applying the streptococcus equi subsp zooepidemicus protective antigen HP0623 comprises the following steps: the successfully expressed and purified recombinant protein, namely streptococcus equi subsp zooepidemicus protective antigen HP0623, is emulsified with Montanide Gel 01PR (SEPPIC, France) adjuvant to be used as a vaccine, wherein the concentration of the recombinant protein in the vaccine is 100 mu g/mL, and the concentration is the lowest effective concentration of the recombinant protein in the vaccine.

The invention has the technical effects that:

compared with the prior art, the purified streptococcus equi subsp zooepidemicus protective antigen HP0623 recombinant protein is obtained through the steps of gene cloning, expression, purification and the like. The invention firstly obtains a target gene by a PCR technology, obtains a recombinant plasmid by a method of enzyme digestion and enzyme ligation, transfers the recombinant plasmid into escherichia coli for induced expression of HP0623 recombinant protein, and shows that the recombinant protein has good immunogenicity through a protein immunoblotting test. The HP0623 recombinant protein can provide higher protective efficacy for mice after being emulsified by an adjuvant, and the serum of the hyperimmune mice can provide better passive immune protection for the mice. The antibody titer of the serum of the mouse immunized by the rHP0623 recombinant protein is measured by ELISA, which shows that the recombinant protein can induce high-level antibody titer, and the immune response type is mainly Th 2. The HP0623 recombinant protein antibody can induce stronger bactericidal ability, and after SEZ infects mice, the transcription level of SEZ _0623 gene of SEZ extracted from spleen tissues of the mice is higher than that of in vitro culture, rHP0623 can inhibit the adhesion and infection of SEZ to Hep-2 cells.

Drawings

FIG. 1 shows SDS-PAGE and immunoblotting patterns of the HP0623 protein.

In FIG. 1, lanes 1-3 are HP0623 protein before, after, and after recombinant E.coli induction, respectively; lane M shows protein prestained Marker.

Lane 4 shows the results of Westernblot detection of rHP0623 and SEZ-infected convalescent pig sera.

FIG. 2 and FIG. 3 are graphs showing the results of ELISA detection of the immunoreaction induced in mice after the mice were immunized with the recombinant protein.

FIG. 2 shows a comparison of antibody levels in the immunization group and the negative control group; FIG. 3 shows a comparison of the types of antibody responses induced by HP 0623.

FIG. 4 is a graph showing the comparison of survival rates of mice subjected to SEZ challenge in the immunization group, the negative control group and the positive control group.

FIG. 5 is a graph showing a comparison of rHP0623 hyperimmune serum (experimental group), SEZ inactivated vaccine hyperimmune serum (positive control group), and normal serum (negative control group) for passive immune protection in mice.

FIG. 6 is a graph showing the analysis results of the quantitative PCR.

In FIG. 6, the expression of bacterial genes in the spleen of each of three mice is shown from left to right.

FIG. 7 and FIG. 8 show the surface distribution of HP0623 at the SEZ for flow cytometry analysis.

FIG. 9 is a graph showing the results of comparing the results of lethal application of whole blood in mice.

In fig. 9, 1 is an experimental group, 2 is a positive control group, and 3 is a negative control group.

FIG. 10 is a graph showing the results of the measurement of the adhesion of SEZ to Hep-2 cells.

Detailed Description

For a better understanding of the present invention, reference will now be made to the following examples and accompanying drawings.

In the examples of the present invention, conventional experimental methods and conditions are used, and the conditions in the present invention are not known to those skilled in the art, and those skilled in the art can implement the present invention by combining the prior art.

Example one, strains and growth conditions

The strain is SEZ C55138 strain; the culture condition is TSB culture medium or TSA culture medium added with 5% fetal calf serum; shake culturing at 37 deg.C for about 8h, or OD600 reaches 0.6-1.0. The vector is Escherichia coli pET-32a, and the competent cell is Escherichia coli BL 21.

The SEZ C55138 strain, Escherichia coli pET-32a, fetal bovine serum and Escherichia coli BL21 competent cells are all commercially available products.

Example two, preparation method

The HP0623 protein is encoded by sez _0623 gene, the HP0623 gene has 1 BamH I cleavage site in the forward primer and 1 Hind III cleavage site in the reverse primer. The forward and reverse primers were designed from SEZ genomic sequences and synthesized by primer Synthesis.

The preparation method of the streptococcus equi subsp zooepidemicus protective antigen HP0623 comprises the following steps:

1) and (3) PCR amplification: PCR amplification was performed using the genome of C55138 strain as a template, using the following primers:

forward primer (SEQ ID NO. 3): 5' -CCCGGATCCGCTTGCCTGCTAGTG-3', the underlined part is the BamH I enzyme cutting site;

reverse primer (SEQ ID NO. 4): 5' -CTCAAGCTTGAGGGGAAGATCGTATC-3', the underlined part is HindIII enzyme cutting site;

2) and (3) connecting with a carrier: the PCR product is cut by using restriction enzyme and then connected with a pET-32a vector cut by the same enzyme;

3) transformation and induction: transforming the connected vector into escherichia coli competent cells BL21, then, waiting for the escherichia coli competent cells BL21 to reach an exponential growth phase in a constant-temperature shaking table at 37 ℃, adding IPTG (isopropyl thiogalactoside) with the final concentration of 1mM, and inducing for 3 hours; non-induced control experiments were also performed.

4) And (3) purification: centrifugally collecting the induced thallus, carrying out heavy suspension by using sterile PBS, carrying out high-pressure crushing, centrifugally collecting recombinant protein supernatant, and purifying the target protein in the supernatant by using a Ni-NTA chromatographic column to obtain the purified recombinant protein.

Immunoblot analysis: the purified recombinant protein was subjected to immunoblot analysis using SEZ-infected recovered pig serum as primary antibody and goat anti-pig IgG (H + L) -HRP as secondary antibody.

The genome of the C55138 strain is extracted from the C55138 strain by a conventional method.

The primers were synthesized by Wuhan Kingkurui bioengineering, Inc., and the restriction enzymes were BamH I and HindIII.

IPTG, i.e., isopropyl- β -D-thiogalactoside, is an active inducer of β -galactosidase, and it can be used as an expression inducer of an expression vector having a promoter such as lac or tac when a vector DNA carrying a lacZ gene is transformed with a lacZ-deficient cell as a host, based on this property.

Results of the experiment

The gene sequence SEZ _0623 (SEQ ID NO.1) was obtained by PCR, and after cloning the SEZ _0623 gene of SEZ C55138 strain, a protein consisting of 429 amino acids (SEQ ID NO.2) was expressed and the molecular weight was 47.04 kDa. Comparing the induced and non-induced cultured bacteria, it can be demonstrated that the target protein was successfully expressed and that the band size of the target protein was consistent with the predicted size. The purified recombinant protein is obtained by means of Ni-NTA affinity chromatography, and an immunoassay experiment shows that the protein shows good immunoreactivity with recovered pig serum infected with SEZ, as shown in figure 1, the size of the HP0623 protein is consistent with the predicted size, and the protein has good immunoreactivity.

EXAMPLE III determination of antibody Titers

Determining a mouse serum antibody IgG through an enzyme-linked immunosorbent assay, coating a purified recombinant protein HP0623 at 4 ℃ overnight, collecting blood of a mouse immunized for 10 days with the secondary immunization, separating serum, diluting in a gradient multiple manner, adding 100 mu L of the diluted recombinant protein into an enzyme-linked plate after all dilutions, adding horseradish enzyme labeled goat anti-mouse IgG after reaction at 37 ℃, stopping the reaction after color development is finished, reading an OD value by using an enzyme-linked immunosorbent assay, and taking the maximum dilution multiple of the serum with the OD value being more than the average OD value of control serum and 3-fold variance SD (standard deviation) as the serum antibody. To infer the immune type, IgG1 and IgG2a were further tested to determine the immune response of Th2 and Th 1.

The experimental results are as follows:

the level of IgG titer in the immunized group was significantly higher than that in the negative control group, and the antibody titer in the immunized group was significantly higher than that in the negative control group as shown in fig. 2.

The results indicate that HP0623 can elicit a significant Th1/Th2 immune response, with IgG1 antibody titers predominating compared to IgG2 antibody produced, as shown in figure 3 for the type of antibody response induced by HP0623, with a Th2 response predominating.

EXAMPLE four mouse immunization and challenge test

1. Taking 30 KM female mice with the age of 6-8 weeks, and randomly dividing the KM female mice into 3 groups, wherein each group comprises 10 KM female mice;

2. experimental groups: 50 μ g of purified rHP0623 was emulsified with Montanide Gel 01PR (SEPPIC, France) adjuvant and the first group of mice was immunized i.p. and after 14 days intervals, the mice were immunized twice in the same manner and at the same dose;

3. positive control group: inactivating SEZ C55138 strain, emulsifying with Montanide Gel 01PR (SEPPIC, France) adjuvant, and adding into a container at a ratio of 1 × 10⁹Immunizing a second group of mice by CFU/mL, and performing secondary immunization in the same way after 14 days by adopting an intraperitoneal injection mode;

4. negative control group: a third group of 10 mice was intraperitoneally injected with PBS emulsified with Montanide Gel 01PR (SEPPIC, France) adjuvant as a control;

5. after all mice are immunized for 10 days for the second time, tail vein blood is collected, serum is collected by centrifugation, and then all mice are attacked by SEZC55138 strain (2 x 10)⁵CFU/mL)；

6. Growth was observed and recorded in all mice.

The experimental results are as follows:

1) 10 mice in the experimental group died on the third day after the challenge, and the surviving mice showed slight clinical symptoms, such as poor mental state and emaciation, all of the mice recovered to normal within 6 days, and finally 4 mice died;

2) the positive control group of mice did not show obvious clinical symptoms in general, and only 1 mouse died during the whole period of challenge;

3) the mice of the negative control group died the next day after challenge, and the surviving mice showed obvious clinical symptoms, such as disorganized fur, slow response to external stimuli, immobility and the like, and died gradually within 6 days after challenge, and only 1 survived.

As shown in fig. 4, the positive control group and the immune group both provided higher immune protection for the mice, and the positive control group was higher than the experimental group. The result shows that the recombinant rHP0623 protein can provide immune protection for mice and resist the infection of SEZ virulent strains.

Example five analysis of passive protection test

To confirm that protection was due to the specific stimulatory immune response of HP0623, mice were passively immunized with rHP0623 hyperimmune serum and then challenge experiments were performed.

1. 30 KM female mice with the age of 6 weeks are randomly divided into 3 groups, and each group comprises 10 KM female mice;

2. positive control group: immunizing a first group of mice by using SEZ inactivated vaccine secondary immune serum for intravenous injection;

3. negative control group: immunizing a second group of mice with normal mouse serum by intravenous injection;

4. experimental groups: a third group of mice was immunized intravenously with rHP0623 hyperimmune serum;

5. 24h after immunization, all mice were challenged with the SEZ C55138 strain (2X 10)⁵CFU/mL)；

6. Growth was observed and recorded in all mice.

The experimental results are as follows:

1) none of the positive control mice showed clinical symptoms in the challenge test, and 1 mouse died finally during the entire challenge period;

2) the negative control group mice mainly show listlessness, slow response to external stimulation, rough and disorderly hair and other symptoms after being attacked by toxin, and die continuously within 3 days;

3) after being attacked, the mice in the experimental group are mainly manifested by listlessness, slow response to external stimulation, rough and disorderly hair and other symptoms, but basically recover to be normal after 3 days, and the final survival rate of the mice is 70 percent.

As shown in fig. 5, the results showed that the passive protective ability of the mice in the experimental group and the positive control group was significantly stronger than that in the negative control group.

EXAMPLE six fluorescent quantitative PCR analysis

To assess the expression level of the SEZ SEZ _0623 gene in vitro and in vivo in mice, the transcription level of the SEZ _0623 gene in vitro and in vivo was quantitatively determined by a fluorescent quantitative PCR technique.

1. Obtaining in vivo proliferation bacteria from spleen of mice infected with SEZ, aseptically collecting spleen tissue, grinding, centrifuging at 4 deg.C and 850 Xg for 5min, collecting supernatant, centrifuging at 4 deg.C and 15500 Xg for 5min, and precipitating to obtain bacteria in spleen tissue; the bacteria cultured in vitro are centrifuged and collected after the bacteria grow to the middle exponential phase;

2. extracting total RNA of bacteria by an acid phenol method;

3. reverse transcribing the RNA to cDNAs, performing quantitative PCR reactions using the cDNA sample as a template, and repeating all reactions for three times;

in real-time fluorescent quantitative PCR, the sez _0623 gene was quantitatively analyzed using the following primer pairs:

forward primer (SEQ ID NO. 5): 5'-CGGTATAGTATAGCCAAGC-3', respectively;

reverse primer (SEQ ID NO. 6): 5'-GCATTTCTCCCAACGA-3', respectively;

in real-time fluorescent quantitative PCR, the 16S rRNA gene was quantitatively analyzed using the following primers:

forward primer (SEQ ID NO. 5): 5'-ATCCGAACTGAGATTGGC-3', respectively;

reverse primer (SEQ ID NO. 6): 5'-CCCTTATGACCTGGGCTA-3', respectively;

the experimental results are as follows:

as shown in FIG. 6, it was revealed that the SEZ _0623 gene transcription level of SEZ extracted from the mouse spleen was significantly higher than that of SEZ cultured in vitro.

EXAMPLE seventhly, flow cytometry analysis

1. Resuspend the bacteria with PBS/BSA (PBS containing 1% BSA), and take 200. mu.L of the bacterial solution;

2. adding 100 μ L of rHP0623 immunized mouse serum into experimental group, adding 100 μ L of PBS immunized mouse serum into control group, incubating at 4 deg.C for 15min, and incubating at room temperature for 30 min;

3. centrifuging at 5000rpm for 3min, and collecting bacteria;

4. washing with PBS/BSA for 3 times, adding FITC-goat anti-mouse secondary antibody, and incubating at room temperature for 45 min;

5. washed 3 times with PBS/BSA, resuspended in 500. mu.L of PBS, and added to the flow cytometer for detection.

The experimental results are as follows:

as shown in fig. 7 and 8, compared to the blank control group, the SEZ HP0623 antibody induced a stronger fluorescence signal on the surface of SEZ, and the average fluorescence intensity of the control group bacteria was weaker, while the average fluorescence intensity of the experimental group bacteria was greatly increased, indicating that the HP0623 protein was distributed on the surface of SEZ.

EXAMPLE eight analysis of lethal dose of Whole blood

To determine the bactericidal activity of the HP0623 antibody, assessment was performed after heparinization of the blood of the bab mice after incubation with the blood-surviving SEZ using rHP0623 hyperimmune serum or control serum.

1. When the SEZ C55138 strain grows to the middle exponential phase, the thalli are collected by centrifugation, and the bacteria concentration is adjusted to 10 by using sterile PBS⁴CFU/mL；

2. Positive control group: taking 900 mu L of healthy mice, performing heparin anticoagulation on whole blood, and mixing the whole blood with 100 mu of LSEZ inactivated vaccine hyperimmune serum;

3. negative control group: taking 900 mu L of healthy mice, performing heparin anticoagulation on whole blood, and mixing with 100 mu L of normal mouse serum;

4. experimental groups: taking 900 mu L of healthy mice, carrying out heparin anticoagulation on whole blood, and mixing with 100 mu L of recombinant rHP0623 serum II;

5. respectively adding 100 μ L of SEZ bacterial liquid into the mixed solution, and shake culturing for 90min in a constant temperature shaking table at 37 deg.C;

6. each group was sampled at 100 μ L each, spread on TSA plates, and 3 replicates were performed to calculate the amount of viable bacteria before and after incubation;

7. viability was calculated as the percentage of the remaining bacteria relative to the starting bacteria.

The experimental results are as follows:

the sterilization rate of the negative control group is 9.21 +/-1.29 percent; the sterilization rate of the positive control group is 91.6 +/-1.35 percent; the sterilization rate of the experimental group is 61.08 +/-1.60%.

As shown in FIG. 9, the results indicate that the anti-rHP0623 antibody can induce a high level of bactericidal activity, and the anti-HP0623 antibody can have a strong killing ability against SEZ.

EXAMPLE nine adhesion inhibition test

To examine the effect of HP0623 on SEZ adhesion to Hep-2 cells, the adhesion assay of Hep-2 cells was performed by the following main steps:

1. adding DMEM containing 10% fetal calf serum into a 24-well plate to culture Hep-2 cells, and culturing in a cell culture box at 37 ℃ until the cells grow to about 80%;

2. cells were washed 3 times with pre-chilled PBS/BSA;

3. adding 200 ug/ml of purified rSec-205 to each well and incubating for 2h, adding 200 ug/ml of BSA to the same cells and incubating as a control group;

4. after incubation was complete, wash 3 times with PBS/BSA, then add 1ml of 5X 10 to each well⁷CFU/ml SEZC55138 strain at 37 ℃ with 5% CO₂Incubating for 2h under the condition;

5. unadhered bacteria were washed with PBS/BSA and then the cells were blown out with 1ml PBS (containing 0.2% Triton X-100), diluted and counted on plates;

6. the inhibition rate of HP0623 on SEZ adhesion Hep-2 cells was calculated by the following formula:

inhibition rate ═ 1- (number of bacteria of HP 0623-treated cells/number of bacteria of BSA-treated cells) ] × 100%.

The experimental results are as follows: rHP0623 was able to inhibit the adhesion of SEZ to Hep-2 cells, as shown in FIG. 10, at a rate of 14.9% compared to the control.

As can be seen from the above examples, the preparation method of the streptococcus equi subsp zooepidemicus protective antigen HP0623 comprises the steps of target gene cloning, enzyme digestion and enzyme ligation, induction expression and protein purification. The recombinant HP0623 protein is analyzed by protein immunoblotting, and is shown to have good immunogenicity. The antibody titer in the serum of the mice immunized by the recombinant protein is obviously higher than that of the mice in the negative control group, and the IgG1 titer in the antibody types generated by the immunized mice is higher than that of IgG2 a. rHP0623 immune mice can provide stronger protective efficacy for mice, anti-rHP0623 mice two immune sera to mice has obvious passive protective power, anti-rHP0623 antibody can induce high level bactericidal power. SEZ _0623 gene in the SEZ infected mice in vivo transcription level is higher than in vitro culture transcription level, flow cytometry detection results show that HP0623 is located on the surface of SEZ, rHP0623 can inhibit SEZ to Hep-2 cell adhesion, and the inhibition rate is 14.9%.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit and scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> university of Hubei

<120> streptococcus equi subsp zooepidemicus protective antigen HP0623 and preparation method thereof

<130>2017.5

<160>8

<170>PatentIn version 3.3

<210>1

<211>753

<212>DNA

<213> Streptococcus equi subsp zooepidemicus

<400>1

gcttgcctgctagtgctaacaacctttatttatcagtgctgttcagttactgctgagcag 60

tattctgatactgaggctgaggtgctgcagattaacgaggagaaaagccagatcatggaa 120

agtcaagaggtgcttgaaggcctcatcacgtcgtctgatcagctaaagaagaaagcttta 180

aagcctaaagaggcagctaccaacaagagcaagcaagaggcttcgacagtttatttagct 240

gaggacgatcctgtaaccattgatagctctgacgaggaaagcaatcgagatattatagcg 300

gattctgttcctgatttggttattaaaggtgatcaggtggatgtatctgaggttatggtc 360

tctgtaaaggaggatccatcgaaagttgctaagcaaagaacaaacgcagcgcagcggtat 420

agtatagccaagcatcaattgacccaaaagcttgaggcctttaatgcggcaacggaccaa 480

ttgctgaccatgattgctaaaaaatctgatttgactggtcagtattatgtggttgggcat 540

tcgttgggagaaatgctggctgctcaaaatgagaaaaagcttgctgagcaattagtcatg 600

caacaaaagcacaaaaaaggcttagactcatcagccactattttagacgaattaggacgt 660

gtgatttctgacattagtggtcataaaggtatgcttccttttaatcgtaagatcagcttt 720

aaagcacatcaggtcagatacgatcttcccctc 753

<210>2

<211>429

<212>PRT

<213> Streptococcus equi subsp zooepidemicus

<400>2

Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp

1 5 10 15

Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp

20 25 30

Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp

35 40 45

Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn

50 55 60

Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu

65 70 75 80

Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser

85 90 95

Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly

100 105 110

Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro

115 120 125

Arg Gly Ser Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln

130 135 140

His Met Asp Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met

145 150 155 160

Ala Asp Ile Gly Ser Ala Cys Leu Leu Val Leu Thr Thr Phe Ile Tyr

165 170 175

Gln Cys Cys Ser Val Thr Ala Glu Gln Tyr Ser Asp Thr Glu Ala Glu

180 185 190

Val Leu Gln Ile Asn Glu Glu Lys Ser Gln Ile Met Glu Ser Gln Glu

195 200 205

Val Leu Glu Gly Leu Ile Thr Ser Ser Asp Gln Leu Lys Lys Lys Ala

210 215 220

Leu Lys Pro Lys Glu Ala Ala Thr Asn Lys Ser Lys Gln Glu Ala Ser

225 230 235 240

Thr Val Tyr Leu Ala Glu Asp Asp Pro Val Thr Ile Asp Ser Ser Asp

245 250 255

Glu Glu Ser Asn Arg Asp Ile Ile Ala Asp Ser Val Pro Asp Leu Val

260 265 270

Ile Lys Gly Asp Gln Val Asp Val Ser Glu Val Met Val Ser Val Lys

275 280 285

Glu Asp Pro Ser Lys Val Ala Lys Gln Arg Thr Asn Ala Ala Gln Arg

290 295 300

Tyr Ser Ile Ala Lys His Gln Leu Thr Gln Lys Leu Glu Ala Phe Asn

305 310 315 320

Ala Ala Thr Asp Gln Leu Leu Thr Met Ile Ala Lys Lys Ser Asp Leu

325 330 335

Thr Gly Gln Tyr Tyr Val Val Gly His Ser Leu Gly Glu Met Leu Ala

340 345 350

Ala Gln Asn Glu Lys Lys Leu Ala Glu Gln Leu Val Met Gln Gln Lys

355 360 365

His Lys Lys Gly Leu Asp Ser Ser Ala Thr Ile Leu Asp Glu Leu Gly

370 375 380

Arg Val Ile Ser Asp Ile Ser Gly His Lys Gly Met Leu Pro Phe Asn

385 390 395 400

Arg Lys Ile Ser Phe Lys Ala His Gln Val Arg Tyr Asp Leu Pro Leu

405 410 415

Lys Leu Ala Ala Ala Leu Glu His His His His His His

420 425

<210>3

<211>24

<212>DNA

<213> Artificial sequence primer11

<400>3

cccggatccgcttgcctgctagtg 24

<210>4

<211>26

<212>DNA

<213> Artificial sequence primer12

<400>4

ctcaagcttgaggggaagatcgtatc 26

<210>5

<211>19

<212>DNA

<213> Artificial sequence primer21

<400>5

cggtatagtatagccaagc 19

<210>6

<211>16

<212>DNA

<213> Artificial sequence primer22

<400>6

gcatttctcccaacga 16

<210>7

<211>18

<212>DNA

<213> Artificial sequence primer31

<400>7

atccgaactgagattggc 18

<210>8

<211>18

<212>DNA

<213> Artificial sequence primer32

<400>8

cccttatgacctgggcta 18

Claims

1. The streptococcus equi subsp zooepidemicus protective antigen HP0623 is used for preparing streptococcus equi subsp zooepidemicus vaccines, and the protective antigen HP0623 is SEZ HP0623 recombinant protein, is encoded by SEZ _0623 gene, consists of 429 amino acid residues, has the molecular weight of 47.04kDa, and has the amino acid sequence shown in SEQ ID NO. 2.

2. A preparation method of streptococcus equi subsp zooepidemicus protective antigen HP0623 comprises the following steps:

1) and (3) PCR amplification: PCR amplification is carried out by using a streptococcus equi subsp zooepidemicus SEZ C55138 genome as a template and using primers;

2) and (3) connection of a carrier: the PCR product is cut by restriction endonuclease and then connected with a PET-32a carrier;

3) transformation and induction: transforming the vector connected in the step 2) into escherichia coli, culturing until the OD value is 0.6-1.0, and adding IPTG (isopropyl-beta-thiogalactoside) for induction culture for 3-5 h;

4) and (3) purification: centrifugally collecting the thalli cultured in the step 3), carrying out heavy suspension by using sterile PBS, crushing, centrifugally collecting protein supernatant, taking the supernatant, purifying by using a Ni-NTA chromatographic column to obtain purified recombinant protein, namely streptococcus equi subsp zooepidemicus protective antigen HP 0623;

wherein, the primer is:

a forward primer: 5'-CCCGGATCCGCTTGCCTGCTAGTG-3', respectively;

reverse primer: 5'-CTCAAGCTTGAGGGGAAGATCGTATC-3' are provided.

3. The method of claim 2, wherein the method comprises the steps of: the forward primer and the reverse primer respectively have 1 enzyme cutting site.

4. The method of claim 3, wherein the method comprises the steps of: the enzyme cutting site of the forward primer is a BamH I enzyme cutting site; the reverse primer restriction site is Hind III restriction site.