KR101526886B1 - Recombinant Protein Comprising Epitope of Fowl Adenovirus fiber 2 Protein and Antibody thereto - Google Patents

Abstract

The present invention relates to a recombinant protein comprising the antigenic determinant of the poultry adenovirus fiber 2 protein and an antibody thereto. More specifically, a recombinant protein comprising an antigenic determinant of the poultice adenovirus Fib 2 protein, a gene encoding the recombinant protein, an expression vector containing the gene, a host cell transformed with the expression vector, a preparation of the recombinant protein A vaccine composition for the treatment or prevention of poultry adenovirus infection comprising the recombinant protein as an active ingredient, an antibody recognizing the recombinant protein to be effective And a method for treating or preventing poultry adenovirus infection by administering the vaccine composition or the pharmaceutical composition to an animal other than a human. The present invention also relates to a method for treating or preventing poultry adenovirus infection, Will. The recombinant poultry adenovirus fiber 2 protein and the antibody thereof according to the present invention can be effectively used for treating or preventing infectious diseases against poultry adenovirus more efficiently.

Description

{Recombinant Protein Comprising Epitope of Fowl Adenovirus Fibers 2 Protein and Antibody}, which comprises an antigenic determinant of poultry adenovirus fiber 2 protein,

The present invention relates to a recombinant protein comprising the antigenic determinant of the poultry adenovirus fiber 2 protein and an antibody thereto. More specifically, a recombinant protein comprising an antigenic determinant of the poultice adenovirus Fib 2 protein, a gene encoding the recombinant protein, an expression vector containing the gene, a host cell transformed with the expression vector, a preparation of the recombinant protein A vaccine composition for the treatment or prevention of poultry adenovirus infection comprising the recombinant protein as an active ingredient, an antibody recognizing the recombinant protein to be effective And a method for treating or preventing poultry adenovirus infection by administering the vaccine composition or the pharmaceutical composition to an animal other than a human. The present invention also relates to a method for treating or preventing poultry adenovirus infection, Will.

Poultry adenovirus is a virus that causes chickenpox causing diseases such as intestinal hepatitis, pericardial adenocarcinoma and proximal erosion. Especially, it is a virus that causes hypogastric hypoplasia which causes degradation of eggs and degradation of egg quality in laying hens. It is infected by horizontal propagation due to vertical propagation and environmental pollution. Poultry adenovirus can cause mortalities as a single infection, but it is reported that the damage is more serious if the infection is combined with an immunosuppressive disease such as IBD or CIA. However, there is no effective treatment and preventive measures such as negative administration of liver function-improving agent or use of formalin-based disinfectant at the onset of poultry adenovirus.

On the other hand, Virology, 2008, Majida et al. Discloses a technique for producing the protein 2 protein of poultry adenovirus type 1 and revealing the structure of the protein 2, but there is no description about the antigenic determinant. In the present invention, an antigen is produced by recombining a fiber 2 protein, which plays a major role as an antigenic determinant of poultry adenovirus type 1, and is technically different from that used for producing antibodies by immunizing a laying hens.

 Virology, 2008, Majida et al, Structure of the C-terminal head domain of the fowl adenovirus type 1 378 (1): 169176

It is an object of the present invention to provide a recombinant protein comprising an epitope of poultry adenovirus fiber 2 protein and an antibody thereto to thereby more effectively treat or prevent infectious diseases against poultry adenovirus.

In order to achieve the above object, the present invention provides a recombinant protein comprising an epitope of poultry adenovirus fiber 2 protein.

The present invention also provides a gene encoding the recombinant protein.

The present invention also provides an expression vector comprising the gene.

The present invention also provides a host cell transformed with the expression vector.

The present invention also provides a method for producing the recombinant protein.

The present invention also provides an antibody recognizing an antigenic epitope of the poultry adenovirus fiber 2 protein and a method of producing the antibody.

The present invention also provides a vaccine composition for treating or preventing poultry adenovirus infection comprising the recombinant protein as an active ingredient.

In addition, the present invention provides a pharmaceutical composition or feed composition for treating or preventing infectious diseases against poultry adenovirus comprising an antibody against the recombinant protein as an effective ingredient.

The present invention also provides a method for treating or preventing a poultry adenovirus infection by administering the vaccine composition or pharmaceutical composition to an animal other than a human.

The recombinant protein comprising the antigenic determinant of the poultice adenovirus fiber 2 protein according to the present invention and the antibody therefor can be usefully used for more effectively treating or preventing infectious diseases against poultry adenovirus.

FIG. 1A is an electrophoresis image (lane 1: 100 bp DNA marker, lane 2: PCR product) to identify a gene coding for the product of poultry adenovirus Fib 2 protein, which is obtained through PCR.
FIG. 1B is a photograph showing electrophoresis in order to clone a PCR product obtained according to Example 1 of the present invention and confirm its base sequence.
FIG. 2A schematically illustrates the structure of an expression vector according to Example 2 of the present invention. FIG.
FIG. 2B is a photograph of the gene encoding the recombinant protein containing the antigenic determinant of the poultry adenovirus fiber 2 protein by electrophoresis after isolating the expression vector of the present invention and digesting with restriction enzymes NheI and XhoI 1: 1 kb DNA marker, lane 2: pET-21d (+) / poultry adenovirus fiber 2).
FIG. 2C is a photograph of a recombinant protein containing the antigenic determinant of the poultice adenovirus fiber 2 protein according to the present invention, which is electrophoretically analyzed by Western blot analysis (lane 1: protein molecular weight marker, lane 2: poultry adenovirus Lane 3: recombinant poultry adenovirus fiber 2 protein).
FIG. 3 is a graph showing antibody titers according to the number of weeks after immunization to analyze antibody titers against recombinant proteins containing antigenic determinants of poultry adenovirus fiber 2 protein from separated antiserum and egg yolk.
FIG. 4 is a photograph showing Western blot analysis for confirming neutralization test using an egg yolk antibody recognizing antigenic determinant of poultry adenovirus fiber 2 protein (lane 1: protein molecular weight marker, lane 2: protein extracted from poultry adenovirus ).
5 is a diagram showing a specific base sequence of a gene encoding a recombinant protein having the nucleotide sequence of SEQ ID NO: 1 of the present invention.
6 is a view showing a specific amino acid sequence of the recombinant protein of the present invention having the amino acid sequence of SEQ ID NO: 2 of the present invention.

Hereinafter, the present invention will be described in detail.

The present invention relates to a recombinant protein comprising an antigenic epitope of the poultry adenovirus fiber 2 protein. Fiber 2 protein contains a cell receptor binding site and is a protein that plays a major role in the growth and propagation of virus in chicken.

The poultry adenovirus type 1 fiber 2 protein is an important antigenic determinant that acts as a binding receptor essential for virus infection in poultry cells. The fiber 2 protein is divided into three parts, head, shaft, and tail. The head part corresponds to the part (630 bp) used in the present invention. The structure of the adenovirus fiber 2 protein is very similar to each strain but there is a difference in the nucleotide sequence. The main difference between these fiber head structures is found in the loop regions connected to the β-strand. According to a study by Majida El Bakkouri (2008), the AB loop is very important for the binding of the well known receptor CAR (coxackie and adenovirus receptor). The head part of the fiber 2 binding to CAR is AA'loop Specific < / RTI >

Therefore, in the present invention, the head portion (630 bp) of the adenovirus fiber 2 protein was used for recombination.

The term " epitope " in the present invention means a site where an antibody binds to an antigen such as viruses and bacteria. In general, the antigenic determinant is composed of polypeptide fragments.

The recombinant protein of the present invention,

(A) inserting a gene encoding a recombinant protein comprising an antigenic epitope of a poultry adenovirus fiber 2 protein into a vector comprising one or more expression control sequences that control its expression; ;

(B) transforming the host cell with an expression vector formed from the step (a);

Culturing the transformant produced in step (b); And

And separating and purifying the recombinant protein comprising the epitope of the poultry adenovirus Fib 2 protein from the culture obtained from step (b).

In order to produce the recombinant protein of the present invention by the above-mentioned recombinant technology, a gene encoding the recombinant protein is required. The gene can be prepared by carrying out PCR using an oligonucleotide having a sequence complementary to both ends of a gene encoding a desired recombinant protein as a template, using genomic DNA of a poultry adenovirus as a primer. In the present invention, the gene encoding the recombinant protein was named as the nucleotide sequence of SEQ ID NO: 1.

In one embodiment of the present invention, the PCR is performed using a genomic DNA template of a virus, a forward primer (G GCTAGC CTGTACCAAGCGCCCACTAG: SEQ ID NO: 3), and a reverse primer (G CTCGAG GACCGTAACGGGGGCGCGTA: SEQ ID NO: 4) in a PCR premix Respectively.

The gene encoding the recombinant protein of the present invention may be prepared by amplifying a gene encoding a recombinant protein comprising an epitope of the poultry adenovirus Fib 2 protein according to the step (a) Into a vector comprising an expression control sequence.

As used herein, the term "expression vector" refers to a DNA molecule capable of introducing and expressing a foreign gene into a host cell, which may be a plasmid, phage particle, or simply a potential genome insert. Various expression vectors that efficiently induce expression of a foreign gene in a specific host cell are commercially available. For example, pUC19, pQE30, pGEX, and pET21 can be used in the present invention, and pET-21d (+) is preferably used Do. pET System is a system developed for the cloning and expression of recombinant proteins in E. coli. It is a powerful system in which the protein of this gene can occupy more than 50% of the total protein after induction of protein expression of the target gene cloned in pET plasmid to be. The pET-21d (+) vector is a vector for cloning, expression, detection and purification of a target gene and has the ability and flexibility to be optimized for the expression of a range of genes.

The pET-21d (+) vector contains a T7 promoter (promoter gene) and an operator (promoter gene) optimized for protein expression and a T7 terminator (transcription termination gene) to prevent read-through transcription Β-lactamase gene (bla) present in the pET-21d (+) vector is resistant to antibiotics such as ampicillin and kanamycin. Therefore, only the pET21d (+) vector can be screened using both antibiotics .

When protein expression is performed using the pET21d (+) vector, the 6xHis tag gene located at the C-terminal will be used. In general, GST or His-tag gene is used for protein expression. GST has a large molecular weight and strong charge, so it has a great influence on the experiment. On the other hand, His-tag has a merit that it is not affected by steric hindrance It can also be used for antigen production.

The DNA molecule obtained by operably connecting the gene encoding the recombinant protein of the present invention to the regulatory sequence of such an expression vector is referred to as a "recombinant expression vector ".

The expression vector thus prepared is transformed into a host cell according to the above step (b). The host cell of the present invention may be a prokaryotic or eukaryotic cell. A host having high efficiency of introduction of DNA and high efficiency of expression of the introduced DNA is usually used. Known eukaryotic and prokaryotic hosts such as Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast can be used, and E. coli is preferably used.

Methods for transforming host cells include conventional transformation methods such as cationic lipid-mediated transfection, electroporation, DEAE-dextran mediated transfection ), Calcium phosphate transfection can be used. Other optimal transformation methods may be introduced depending on the type of host cell and expression vector, etc., as known in the art.

The transformed host cells may be cultured in a nutrient medium suitable for the production of the recombinant protein according to the present invention according to the step (c). For example, the host cells can be cultured by small or large scale fermentation, Shake flask culture in a laboratory or industrial fermentor conducted under conditions that facilitate expression and / or isolation of the appropriate medium and recombinant protein. Cultivation is carried out in a suitable nutrient medium containing carbon, nitrogen source and inorganic salt using known techniques. Such suitable media are commercially available or may be prepared as known from the literature (e.g., catalogs of the American Type Culture Collection).

The recombinant protein produced in the transformed host cell can be isolated using conventional protein separation methods according to step (d). For example, the recombinant protein may be isolated from the culture according to methods including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. In addition, the recombinant protein may be purified through known methods including chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion), electrophoresis, fractional solubility (e.g., ammonium sulfate precipitation), SDS- .

The recombinant protein comprising the epitope of the poultry adenovirus Fib 2 protein of the present invention prepared using the gene was named as SEQ ID NO: 2.

In addition, the present invention can provide an antibody against a recombinant protein, particularly an egg yolk antibody.

Immunoglobulin G (IgG) is called an immunoglobulin of egg yolk (IgY) among the immune substances accumulated in egg yolk of birds such as chicken (Kim et al., 1999; Shin et al., 2003). This egg yolk antibody has been used for the prevention, treatment and diagnosis of various diseases in humans and livestock. The principle is to immune an antigen isolated from the causative agent of disease to the egg yolk, Is accumulated and it is fed to induce passive immunity or to use this antibody for diagnosis. Since the egg specificity of the pathogen is much different from that of the mammal by immunizing a polyclonal antibody or a laying hens egg yolk antibody, the antigen specificity such as a monoclonal antibody is very high, the productivity is very high, and the production cost is very low .

The present invention can provide an antibody recognizing an epitope of the poultry adenovirus Fib 2 protein comprising the amino acid sequence of SEQ ID NO: 2. More specifically, monoclonal and polyclonal antibodies specific for poultry adenovirus can be prepared using the recombinant protein of the present invention as an antigen. Polyclonal antibodies are generally prepared by immunizing a mammal with an appropriate amount of antigen at one or more times and recovering from the antiserum of the mammal when the titer of the antibody has reached a certain level and, if desired, Purified and stored in freeze-buffered solution until use. On the other hand, the monoclonal antibody can be produced by separating B lymphocytes formed by injecting an antigen into a mammal and fusing with myeloma cells to produce hybridoma cells and culturing them. Details of such processes are well known in the art.

In the case of the yolk antibody of the present invention,

(a) immunizing a recombinant protein by administering the recombinant protein to a laying hensystem; And

(b) recovering the eggs scattered from the egg yolk immunized through the step (a), and then separating the egg yolk antibody against the recombinant protein from the yolk of the recovered eggs. And can be manufactured by a manufacturing method.

The laying hens used in the present invention are not particularly limited, and for example, it is preferable to use a white leghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh, Routes of administration of the antigen to the laying hens include intraperitoneal, intramuscular, guided or subcutaneous injection, and the like. The antigen of the present invention, that is, the recombinant poultry adenovirus fiber 2 protein, can increase its immunity using adjuvants such as Freund's complete adjuvant or incomplete adjuvant.

Additional boosts (booster) can be performed until sufficient antibodies are obtained. Preferably, immunization is carried out about 3 times at about 2 week intervals and 6 to 10 weeks if necessary. After collecting the eggs from the immunized laying hens and separating the desired antibodies from them, the amount of the induced antibodies is measured. When the increase amount reaches the stagnation state, the eggs are finally recovered.

The amount of the derived antibody can be measured according to a conventional method in the art. Preferably, it is measured by enzyme immunoassay or microtiter method. More preferably, the antigen (the recombinant protein comprising the antigenic determinant of the poultice adenovirus fiber 2 protein) attached to the microplate is reacted with the antibody separated from the egg yolk of the immunized egg according to the present invention, Enzyme Linked Immunosorbent Assay (ELISA), which is a method that can quantitate antibodies induced by reacting antibodies, adding a substrate solution thereto, causing a color reaction by enzymatic action and measuring at a specific wavelength .

The egg yolk antibody of the present invention is prepared by separating egg yolk from the recovered eggs, diluting the egg yolk with distilled water, adjusting the pH of the diluted solution to 4.0 to 6.0, freezing, thawing the frozen material, centrifuging, . Preferably, the egg yolk is separated from the recovered egg, diluted 10-fold by adding distilled water, and then the pH of the diluted solution is adjusted to about 5.0, and then frozen at -30 캜 to -10 캜 for 10 to 20 hours or more, And centrifuged at 5,000 to 15,000 x g at 1 DEG C to 10 DEG C for 20 to 40 minutes. The formed supernatant is separated by filtration through a filter paper.

As described above, the recombinant proteins of the present invention and the antibodies thereto can be all used to treat or prevent poultry adenovirus infection. The recombinant protein comprising the antigenic determinant of the poultry adenovirus fiber 2 protein can be treated through active immunization and the antibody against it can be treated or prevented through passive immunization. Active immune means that when the pathogen invades, the living body itself is immune to the generation of antibodies in the body, and passive immunization means immunity obtained by accepting an immune body generated in another body in its own body.

The recombinant protein or the antibody comprising the antigenic determinant of the poultice adenovirus Fib 2 protein capable of treating or preventing the poultry adenovirus infection produced by the above method can be used as an active ingredient of a vaccine composition or a pharmaceutical composition. In this case, the active ingredient is preferably used in a form mixed with a pharmaceutically acceptable carrier, rather than being used alone.

Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers for use in the vaccine composition or pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, Alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The vaccine composition or the pharmaceutical composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, oral formulations such as suspensions, emulsions, syrups and aerosols, external preparations, suppositories or sterilized injection solutions, Can be used.

In the case of formulation, it can be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid preparations may contain at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin And the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Examples of liquid formulations for oral use include suspensions, solutions, emulsions and syrups. In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like have.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories. Propellants, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used. As the base of suppositories, witepsol, tween 61, cacao paper, laurin, and glycerogelatin can be used.

Particularly, in the case of a liquid preparation, it is preferable to sterilize by incorporating a bactericide or the like by filtration through a bacteria trapping filter or the like. The sterilized composition can be solidified, for example, by lyophilization, and dissolved in sterile water or a sterile diluent at the time of use.

The vaccine composition or pharmaceutical composition according to the present invention can be administered to mammals such as rats, mice, livestock, dogs, and humans in various routes. All modes of administration may be expected, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection. The dose of the vaccine composition or pharmaceutical composition according to the present invention is selected in consideration of the age, weight, sex, physical condition, etc. of the animal. The amount necessary to induce an immunoprotective response in an animal without appreciable side effects may vary depending upon the optional presence of the recombinant protein and excipient used as immunogen. The daily dose of the vaccine composition or pharmaceutical composition of the present invention may be 0.1 to 1000 μg protein, preferably 0.1 to 100 μg, per ml of sterilized solution of the immunogenic dose of the recombinant protein or antibody of the present invention. In the case of a vaccine composition, antigen stimulation may be optionally repeated in addition to the initial dose as necessary.

In addition, an antibody recognizing an epitope of the poultice adenovirus fiber 2 protein of the present invention may be mixed with an ordinary feed to prepare a feed composition for treating or preventing infectious disease of poultry adenovirus.

Examples of feeds include, but are not limited to, by-products such as pork, beef, and chicken, as well as corn, rice, common rice straw, grasses, grasses, Do. Methods for adding an antibody to recombinant poultry adenovirus fiber 2 protein of the present invention to such feeds and mixing them include mechanical mixing, adsorption, occlusion, and the like, but the present invention is not limited thereto.

In addition, the vaccine composition or pharmaceutical composition comprising the recombinant protein of the present invention or an antibody thereof can be used in a method for treating or preventing poultry adenovirus infection by administration to an animal other than human. Through the active immunization, the recombinant protein can treat or prevent the poultry adenovirus infection through the passive immunization of the antibody against the recombinant protein.

It will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in view of the gist of the present invention, It will be obvious.

Example  1: poultry Adenovirus  Securing the strain and genetic recombination

1-1: Securing the poultry adenovirus strain

Using the tissue collected from the roundabouts of broiler farms located in Asan city, Chungcheongnam-do, it was stored at -70 ℃ for adenovirus isolation and used for the experiment. (NBCS) (Invitrogen, USA) after the liver tissues of 14-day-old embryonated eggs were incubated with 0.05% trypsin-EDTA (Invitrogen, USA) to produce primary chicken embryo liver Lt; / RTI > Cells were centrifuged and suspended two times. Cells were cultured using Medium 199 (M199) (Invitrogen, USA) supplemented with 5% NBCS, penicillin (100 U / ml) and streptomycin (100 ug / ml) (Invitrogen, USA) Fowl adenoviruses (KVCC-VR1100022) was purchased from the National Veterinary Research and Quarantine Service and used as a control for this experiment. When cytopathic effects (CPEs) were confirmed after infecting the CEL cells cultured in 25 cm 2-tissue culture flasks, the virus was liberated by repeating the freezing and thawing process three times and centrifuged at 4,000 rpm for 10 minutes The resulting supernatant was collected and stored at -70 ° C and used for the experiment.

1-2: DNA extraction of poultry adenovirus

Using the Viral DNA Extraction kit (Intron Biotechnology, Korea), poultry adenoviral viral DNA was isolated according to the manufacturer's manual.

1-3: Recombination of the gene encoding the Fibroin 2 protein of the poultry adenovirus

The gene coding for the protein 2 of avian adenovirus was prepared by PCR using a primer specific for the gene of the poultry adenovirus fiber 2 protein. The primer specific for the gene of the poultry adenovirus fiber 2 protein is GenBank's data (630 bp) of the poultry adenovirus fiber 2 protein gene was amplified on the basis of the amplification of the gene. 1 μl of the genomic DNA template of the virus, 1 μl of the forward primer (G GCTAGC CTGTACCAAGCGCCCACTAG) and 1 μl of the reverse primer (G CTCGAG GACCGTAACGGGGGCGCGG) was added to the PCR premix (Intron, Korea) Distilled water was added, and denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 1 minute, annealing at 50 ° C for 1 minute, and extension at 72 ° C for 2 minutes were repeated 35 times. Min [Pro-DNi Termal Cycler (GnC Bio. Korea)]. The amplified PCR product was electrophoresed on a 1% agarose gel (SeaKem LE agarose, BMA, USA) at 100 V for 30 minutes and then stained with ethidium bromide to confirm the band.

As shown in FIG. 1A, the product obtained through the PCR confirmed a gene encoding a 630 bp poultry adenovirus fiber 2 protein (lane 1: 100 bp DNA marker, lane 2: PCR product). In Fig. 1 (a), the dark font showed a restriction enzyme recognition site.

The obtained PCR product was cloned into a T & A plasmid vector (RBC Co, Taiwan) as shown in FIG. 1B, and the nucleotide sequence was confirmed based on the database of GenBank. The homology of the analyzed nucleotide sequence was analyzed using the National Center for Biotechnology Information). As a result, it showed 99% similarity with the poultry adenovirus fiber protein gene.

Example  2: Construction of expression vector and protein expression and confirmation

2-1: Construction of expression vector

After selecting a positive clone for the gene of the recombinant poultry adenovirus fiber 2 protein by the above method, the plasmid was digested with restriction enzymes NheI and XhoI to obtain a DNA fragment of 630 bp, followed by digesting the fragment with the restriction enzyme The expression vector pET-21d (+) was ligated. The E. coli transformant Dh5α was transformed into a blue / white colony. The white colonies were selected and transformed into BL21 (DE3), and positive clones were selected (see FIG. 2a).

The expression vector was separated therefrom, digested with restriction enzymes NheI and XhoI, and subjected to electrophoresis using agarose gel. As shown in FIG. 2B, a gene encoding a recombinant poultry adenovirus fiber 2 protein was identified (lane 1 : 1 kb DNA marker, lane 2: pET-21d (+) / poultry adenovirus fiber 2).

2-2: Expression and isolation of recombinant protein containing antigenic determinant of poultry adenovirus fiber 2 protein using Escherichia coli

The positive clones obtained above were inoculated into 5 ml of LB broth (Duchefa co. Netherland) to which 100 占 퐂 ampicillin had been added, followed by shaking culture at 37 占 폚 and 200 rpm for 12 to 16 hours. The cultured cells were inoculated into 100 ml of LB broth supplemented with 100 占 퐂 ampicillin, and cultured at 37 占 폚 and 200 rpm until the absorbance (OD600) reached 0.6 to 0.7. When the absorbance (OD600) reached 0.6 to 0.7, 0.5 mM IPTG (isopropyl-beta-D-thio-galactopyranoside, DUCHEFA Co. Netherland) was added and cultured for 3 hours. The culture thus obtained was centrifuged at 15,000 x g for 10 minutes at 4 ° C to recover the cells, resuspended in a cell lysis buffer solution (50 mM TrisHCl, and 0.5 M NaCl, pH 8.0) Ml and allowed to stand at room temperature for 20 minutes. Through this process, the cells were thawed and thawed three times. The supernatant and pellet were separately collected by centrifugation at 10,000 xg at 4 ° C for 10 minutes to obtain an antigenic determinant of poultry adenovirus fiber 2 protein Lt; / RTI >

2-3: Analysis of recombinant proteins containing antigenic determinant of poultry adenovirus fiber 2 protein

Whether the previously obtained protein was a poultry adenovirus fiber 2 protein was confirmed by Western blot analysis. Here, two sheets of SDS-polyacrylamide gel were used at the same time, and the same proteins were also loaded into two SDS-polyacrylamide gels and electrophoresed by dividing the proteins by half in the same 1.5 ml tube. After electrophoresis, one of the sections was stained with Kusami Blue R-250 (SIGMA Co. USA) and visually observed for protein. The other portion was blotted on a nylon membrane (Amersham Pharmacia Biosciences, UK) skim milk / TBS-T at < RTI ID = 0.0 > 4 C < / RTI > for 16 hours. Then, the membrane was washed four times with TBST (100 mM Tris-Cl pH 7.5, 0.9% NaCl, 0.1% Tween 20), and the primary antibody monoclonal rabbit anti-His-Tag antibody (1: 2,000) (KOMA biotech, Korea) and then washed four times with TBS-T. (5-Bromo-4-Chloro-3-Indolyl Phosphate, Amersham Pharmacia Bioscience, Sigma-Aldrich) was reacted with AP-conjugated goat anti-rabbit IgG UK) and NBT (Nitro blue tetrazolium, Amersham Pharmacia Bioscience, UK). As shown in FIG. 2C, it was confirmed that a protein of 22 kDa in lane 3 was detected (lane 1: protein molecular weight marker, lane 2: vector in which poultry adenovirus fiber 2 was not recombined, 3: recombinant poultry adenovirus fiber 2 protein). It was confirmed that the protein expressed in Escherichia coli was specifically reacted with the anti-His-Tag antiserum, and thus the protein expressed in Escherichia coli was a recombinant protein containing the antigenic determinant of the poultry adenovirus fiber 2 protein.

2-4: Purification and protein concentration analysis of recombinant protein containing antigenic determinant of poultry adenovirus fiber 2 protein

The recombinant protein containing the antigenic determinant of the poultice adenovirus fiber 2 protein obtained in Example 2-2 was separated by centrifugation into a supernatant containing soluble fraction and an insoluble fraction (inclusion body). The precipitate was washed with washing buffer (0.01 M TrisHCl, 0.1 M sodium phosphate buffer, and 2 M urea, pH 8), allowed to stand at room temperature for 30 minutes, and centrifuged at 10,000 × g for 10 minutes. The purified precipitate was suspended in denaturation buffer (0.01 M TrisHCl, 0.1 M sodium phosphate buffer, and 8 M urea, pH 8), left on ice for 1 hour, centrifuged at 16,000 × g for 30 minutes and the supernatant was stored at 4 ° C Respectively. The supernatant was dialyzed for 12 hours at room temperature using dialysis tubing (SIGMA, Korea) and 2 L of 1X phosphate-buffered saline (PBS). Also, the concentration of the purified recombinant protein obtained above was confirmed using BCA (Bicinochoninicacid) Kit (Pierce Co.).

Example  3: poultry Adenovirus  Antigen of the fiber 2 protein Determiner  Investigation of the immunogenicity of the recombinant proteins involved

3-1: Production of antisera and egg yolk antibodies against recombinant proteins containing antigenic determinants of poultry adenovirus fiber 2 protein

Immunization was carried out on a 28-week-old HiLine Brown laying system to produce antibodies against the recombinant protein containing the antigenic determinant of the poultry adenovirus Fibrous 2 protein obtained in the above experiment. The breeding and specifications of the laying hens were carried out by the Experimental Research Center of Dankook Univ., And the purified recombinant poultry adenovirus fiber 2 protein and plasticization complete adjuvant (Sigma Chemical Co.) were mixed and emulsified in the same amount. 1 ml of the above emulsion was injected intramuscularly in four places at 0.25 ml each in the sternum of the laying hens. The additional inoculation was emulsified with Prunes Incomplex adjuvant (Gibco Co. USA) at intervals of 2 weeks after the first inoculation, Six times in total. Before each inoculation, blood was collected from the subclavian vein of the laying hens and the serum was separated and stored at -20 ° C. The eggs were collected daily and stored in a cold room at 8 ° C for analysis.

3-2: Identification of antibodies from egg yolk and serum in laying hens

ELISA was performed to analyze the antibody titers against the recombinant proteins including the antigenic determinant of the poultry adenovirus fiber 2 protein from the separated antiserum and egg yolk. The recombinant protein was diluted with carbonate-bicarbonate buffer (pH 9.6) to a concentration of 5 μg / ml and dispensed into each well of a Microtest III flexible assay plate (Falcon 3911, BD Biosciences, USA) Lt; / RTI > overnight. Buffer solution for the coating layer washed _{(PBST, 0.02M NaH 2 PO 4} , 0.13M NaCl, 0.05% Tween 20, pH 7.2) was washed three times with 5% skim milk (pH 7.3) / 175㎕ of PBS to each sphere And then cultured at 37 ° C for 2 hours. Next, the antiserum and yolk sac obtained by using the dilution buffer solution, which was washed five times with PBS-T and mixed with an equal volume of 5% skim milk / PBS and PBS buffer (PBS-T, phosphate buffered saline-Tween 20) Diluted 2-fold, diluted 3-fold, and then dispensed into the wells coated with the recombinant protein at 37 占 폚 for 1 hour and 30 minutes. On the other hand, alkaline phosphatase conjugated rabbit anti-chicken IgG (Jackson Immuno Research Laboratories Inc. USA) was diluted 5,000 times as the secondary antibody and reacted at 37 ° C for 1 hour and 30 minutes in the plate. As a substrate buffer solution, a phosphate substrate tablet (ρ-nitrophenyl phosphate, PIERCE Co. USA) was dissolved in 10% diethanolamine (pH 9.8) containing 0.5 mM MgCl ₂ and reacted at 37 ° C. for 20 minutes , The absorbance was measured at 405 nm using a microplate reader (EL-800, BIO-TEK Instrument Inc. USA).

As shown in FIG. 3, antibody titer increased steadily from 2 weeks after immunization, and the highest antibody titer was shown at 14 weeks (359,000 in serum and 344,000 in yolk antibody).

3-3: Isolation of egg yolk antibodies

Eggs obtained from immunized inoculated eggs were collected and the yolk protein fraction was isolated by the method of Kim et al. (1998, Master's thesis, Dankook University). First, only the yolk was removed from the collected eggs, diluted 10 times with distilled water, the diluted egg yolk solution was adjusted to pH 5.0, and then frozen at -20 ° C for 2 days. The frozen egg yolks were thawed at room temperature, and then the supernatant was collected by centrifugation at 10,000 x g for 30 minutes at 4 ° C. The supernatant was filtered to separate the water soluble fraction (WSF), lyophilized and stored.

Example  4: poultry Adenovirus  Antigen of the fiber 2 protein Determiner  Neutralization test using recognized yolk antibody

Neutralization tests were conducted to investigate whether the egg yolk antibody recognizing the antigenic determinant of poultry adenovirus fiber 2 protein produced earlier exerts neutralizing effect against poultry adenovirus. The chicken embryo liver cell culture infected with poultry adenovirus was centrifuged at 4,000 rpm for 10 minutes. After submerged cells were lysed with M-PER buffer (Pierce), protein band was expressed by Coomassie blue stained gel. Western blot analysis was performed to confirm the binding activity of the egg yolk antibody and poultry adenovirus. When the egg yolk antibody was diluted to 1: 10,000, it was confirmed to bind to the poultry adenovirus. As shown in Fig. 4, the protein size was about 48 kDa, and it was confirmed that the recombinant poultry adenovirus fiber 2 fragment protein (22 kDa) binds to the total size (48 kDa) of poultry adenovirus fiber 2 (Lane 1: protein molecular weight marker, lane 2: protein extracted from poultry adenovirus).

<110> Industry-Academic Cooperation Foundation, Dankook University <120> Recombinant Protein Comprising Epitope of Fowl Adenovirus fiber 2          Protein and Antibody <130> P2013105 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 630 <212> DNA <213> Fowl Adenovirus fiber 2 gene <400> 1 ctgtaccaag cgcccactag cagcgtggcc gcatttacat ccgggacgat cggcttgtcc 60 tcccctacgg gcaattttgt gagctctagc aacaacccgt ttaacgggag ctacttcctg 120 cagcagatca ataccatggg catgctgact acctcgctct acgtcaaagt cgacacaacc 180 accatgggta cgcgtcccac gggcgcggta aacgagaacg cgcgatactt taccgtctgg 240 gtgagctcct tcctcacgca gtgcaacccc tcgaacatcg gtcaaggaac cctagagcca 300 agcaacatca gtatgacctc ttttgaaccc gccagaaacc ccatctcacc tcccgtgttc 360 aatatgaacc aaaacatacc ctactacgct tcccgattcg gggtactgga gtcttaccgg 420 cctatcttca ccggctcgct caacacggga agtatcgacg tacggatgca agtgacgccc 480 gtcctcgcca ccaacaacac gacctacaat ctcatcgcct ttaccttcca atgcgccagt 540 gccggactgt tcaatcccac cgtgaacggc accgtggcca tcggaccggt ggtgcatacc 600 tgtcccgctg cccgcgcccc cgttacggtc 630 <210> 2 <211> 210 <212> PRT <213> Fowl Adenovirus fiber 2 Protein <400> 2 Leu Tyr Gln Ala Pro Thr Ser Ser Ala Phe Thr Ser Gly Thr   1 5 10 15 Ile Gly Leu Ser Ser Pro Thr Gly Asn Phe Val Ser Ser Asn Asn              20 25 30 Pro Phe Asn Gly Ser Tyr Phe Leu Gln Gln Ile Asn Thr Met Gly Met          35 40 45 Leu Thr Thr Ser Leu Tyr Val Lys Val Asp Thr Thr Thr Met Gly Thr      50 55 60 Arg Pro Thr Gly Ala Val Asn Glu Asn Ala Arg Tyr Phe Thr Val Trp  65 70 75 80 Val Ser Ser Phe Leu Thr Gln Cys Asn Pro Ser Asn Ile Gly Gln Gly                  85 90 95 Thr Leu Glu Pro Ser Asn Ile Ser Met Thr Ser Phe Glu Pro Ala Arg             100 105 110 Asn Pro Ile Ser Pro Pro Val Phe Asn Met Asn Gln Asn Ile Pro Tyr         115 120 125 Tyr Ala Ser Arg Phe Gly Val Leu Glu Ser Tyr Arg Pro Ile Phe Thr     130 135 140 Gly Ser Leu Asn Thr Gly Ser Ile Asp Val Arg Met Gln Val Thr Pro 145 150 155 160 Val Leu Ala Thr Asn Asn Thr Thr Asn Leu Ile Ala Phe Thr Phe                 165 170 175 Gln Cys Ala Ser Ala Gly Leu Phe Asn Pro Thr Val Asn Gly Thr Val             180 185 190 Ala Ile Gly Pro Val Val His Thr Cys Pro Ala Ala Arg Ala Pro Val         195 200 205 Thr Val     210 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PCR <400> 3 ggctagcctg taccaagcgc ccactag 27 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PCR <400> 4 gctcgaggac cgtaacgggg gcgcgg 26

Claims (15)

Comprising an epitope of the poultry adenovirus fiber 2 protein,
A recombinant protein consisting of the amino acid sequence represented by SEQ ID NO: 2. delete A gene encoding the recombinant protein of claim 1. An expression vector comprising the gene of claim 3. 5. The expression vector according to claim 4, wherein the expression vector is pET-21d (+) shown in Fig. A host cell transformed with the expression vector of claim 4 or claim 5. [Claim 7] The host cell according to claim 6, wherein the host cell is one selected from the group consisting of Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi and yeast. (A) inserting a gene encoding a recombinant protein comprising an antigenic epitope of a poultry adenovirus fiber 2 protein into a vector comprising one or more expression control sequences that control its expression; ;
(B) transforming the host cell with an expression vector formed from the step (a);
Culturing the transformant produced in step (b); And
Separating and purifying a recombinant protein comprising an antigenic epitope of the poultry adenovirus Fib 2 protein from the culture obtained from the step (a)
Wherein the recombinant protein is an amino acid sequence represented by SEQ ID NO: 2. An antibody recognizing a recombinant protein consisting of the amino acid sequence represented by SEQ ID NO: 2. (a) immunizing a recombinant protein of claim 1 to a laying hensystem; And
(b) recovering egg laid out from the egg yolk immunized through the step (a), and then separating the egg yolk antibody against the recombinant protein from egg yolk of the recovered egg. &Lt; / RTI &gt; A vaccine composition for the treatment or prevention of poultry adenovirus infection comprising the recombinant protein of claim 1 as an active ingredient. A pharmaceutical composition for treating or preventing poultry adenovirus infection comprising the antibody of claim 9 as an active ingredient. A feed composition for treating or preventing a poultry adenovirus infection comprising the antibody of claim 9 as an active ingredient. A method for treating or preventing a poultry adenovirus infection by administering the vaccine composition of claim 11 to an animal other than a human. A method for treating or preventing a poultry adenovirus infection by administering the pharmaceutical composition of claim 12 to an animal other than a human.

Images