KR101765394B1

KR101765394B1 - Epitope protein of PEDV, Recombinant vector contaning genes encoding thereof, Transformnant expressing thereof, and Composition for preventing or treating PEDV comprising thereof

Info

Publication number: KR101765394B1
Application number: KR1020150156184A
Authority: KR
Inventors: 안지영; 이은지; 김양훈; 안근아; 이세희; 박가영
Original assignee: 충북대학교 산학협력단
Priority date: 2015-11-06
Filing date: 2015-11-06
Publication date: 2017-08-04
Also published as: KR20170053537A

Abstract

The present invention relates to an epitope protein of a porcine epidemic diarrhea virus, a recombinant vector containing a gene encoding the same, a transformant expressing the recombinant vector, and a composition for preventing or treating porcine epidemic diarrhea virus comprising the same. By virtue of its harmlessness, it can reduce the disadvantages of vaccines due to the administration of existing drugs, and dramatically simplify the process of manufacturing vaccines such as cell disruption, antigen extraction, purification and stabilization, which could not have been avoided in the course of vaccine production. In addition, whole cell of yeast cells expressing Spike protein of PED which is an extrinsic protein of the present invention can be usefully used for protein array, antibody production, bioconversion, and amelioration of foreign protein.

Description

TECHNICAL FIELD [0001] The present invention relates to a recombinant vector comprising a gene encoding an epitope protein of a porcine epidemic diarrhea virus, a gene encoding the same, a transformant expressing the recombinant vector, and a composition for preventing or treating porcine epidemic diarrhea virus comprising the same. Transformant expressions thereof, and Composition for preventing or treating < RTI ID = 0.0 > PEDV <

The present invention relates to an epitope protein of a porcine epidemic diarrhea virus, a recombinant vector comprising a gene encoding the same, a transformant expressing the same, and a composition for preventing or treating porcine epidemic diarrhea virus comprising the same.

Porcine epidemic diarrhea (PED) is an infectious disease of pigs caused by infections of the causal PED virus (porcine epidemic diarrhea virus; PEDv), and is characterized by vomiting and hydrosoluble diarrhea. In addition, this disease was first reported in Korea in 1992, and then spread nationwide, which is the most damaging of diarrheal diseases in mammals, and is a major disease causing many economic damages to pig farmers. PEDv, which causes swine epidemic diarrhea, mainly proliferates to small villous cells and denatures or necrosis of choroidal epithelial cells, accompanied by atrophy and loss of villi, resulting in absorption failure and persistent hydrosoluble diarrhea. It causes enteritis, irrespective of the age of pigs, accompanied by severe diarrhea and dehydration, and even fatalities in piglets reach 80 to 90%.

Like most diseases caused by viruses, PED is also dependent only on prevention through vaccines. The vaccine system has a high production cost, such as a culture medium and an animal cell incubator, which are relatively expensive, and a variety of heterologous proteins contained in the serum medium , There is a side effect caused by these heterologous proteins when the vaccine is inoculated. Although recombinant vaccines produced in Escherichia coli have advantages of eliminating pathogen contamination and cost-effective mass production costs, the animal and plant proteins may have decreased immunity due to the difference in post-translational transformation system with Escherichia coli, and the recombinant vaccine produced by recombinant E. coli vaccine Protein is destroyed by unfavorable conditions. Although the use of protein expression systems in higher organisms such as plants can avoid immune degradation problems or unfavorable conditions in the field, it is also a genetically modified organism that inserts genes from bacteria, viruses or animals into new species . However, there is a problem about environmental risk due to safety of human body by ingesting GMO and gene contamination due to GMO cultivation. In addition, the injection vaccine system that is injected into the existing blood vessels has no effect on the immunity of PEDv inducing porcine epidemic diarrhea because the vaccine circulates only in the blood vessels and does not affect the intestines. Therefore, Only the oral vaccine system is known to be effective against PEDv immunity. However, PEDv belonging to the genus Corona virus is a type of RNA virus, and since it has a high rate of variability, it is highly likely to lose the efficacy of the existing vaccine. Therefore, research and development of a safe and stable pandemic diarrhea vaccine, which is still effective, is desired.

On the other hand, the technology of attaching and expressing a desired protein on the cell surface of a microorganism is called a cell surface display technology. This cell surface expression technology is a technique for expressing an exogenous protein on the surface using a fixed protein of a eukaryote such as bacteria or yeast as a surface expression motif (Surface Anchoring Motif), and its application range And thus the potential for industrial application using cell surface expression technology is significant. For successful cell surface expression techniques, the surface expression matrix is the most important.

1. Korean Patent Publication KR20090011215A 2. Korean Patent Publication KR20050107860A 3. Korean Patent Publication No. KR20120066555A 4. United States Published Patent US20150283229A1

1. Protein Expression and Purification 41 (2005) 378383

The present invention relates to a novel epitope protein, a recombinant vector comprising the gene encoding the same, a transformant expressing the novel epitope protein, and a method for the prevention or treatment of porcine epidemic diarrhea virus comprising the same, which can be applied to safe and stable swine diarrhea To provide a composition for use in the field.

In order to achieve the above-mentioned object, the present invention provides a porcine epidemic diarrhea virus (PEDv) epitope protein comprising any one of the amino acid sequences selected from SEQ ID NOS: 5 to 7.

According to one aspect of the present invention, there is provided a porcine epidemic diarrhea virus (PEDv) antigen comprising the epitope.

According to one aspect of the present invention, there is provided a recombinant vector comprising a gene encoding the epitope protein of claim 1.

According to one aspect of the present invention, the gene is a base sequence represented by any one of SEQ ID NOS: 1 to 3.

According to one aspect of the present invention, the recombinant vector is characterized by expressing an epitope protein on a cell surface.

According to one embodiment of the present invention, the recombinant vector is constructed by inserting a gene encoding the epitope protein between the signal sequence of the yeast fixing protein CWP2 and the CWP2 sequence.

According to one aspect of the present invention, the recombinant vector comprises a nucleotide sequence of SEQ ID NO: 9 encoding a signal sequence of yeast immobilization protein CWP2, a nucleotide sequence encoding any of the epitope proteins selected from SEQ ID NOS: 1 to 3, And the nucleotide sequence of Sequence Listing 12 encoding CWP2.

According to one aspect of the present invention, there is provided a transformant transformed with the above-mentioned recombinant vector.

According to one aspect of the present invention, the transformant is yeast.

According to one aspect of the present invention, there is provided a composition for preventing or treating swine epidemic diarrhea virus infection comprising the above-mentioned transformant, a protein extract of the transformant, or a recombinant PEDv epitope protein isolated from the transformant .

The constructed recombinant vector system of the present invention has a stabilizing effect and is effective for inducing the expression of the antigenic determinant COE region of Spike protein which is a surface protein of PEDv that neutralizes PEDv on the envelope of pre-yeast cells, Yeast is harmless to oral administration and it can reduce the disadvantages of vaccine due to the administration of existing drugs and dramatically simplify vaccine manufacturing processes such as cell disruption, antigen extraction, purification and stabilization, which could not be avoided in the course of vaccine production . In addition, whole cell of yeast cells expressing Spike protein of PED which is an extrinsic protein of the present invention can be usefully used for protein array, antibody production, bioconversion, and amelioration of foreign protein.

FIG. 1 is a schematic diagram of a recombinant vector designed to induce expression of a COE region, which is an antigen-determining region of PED virus (PEDv), in the envelope of yeast cells.
FIG. 2A shows a gene sequence structure of a recombinant sequence CWP2P designed to induce yeast surface expression based on a pYES2 yeast expression vector, except for the signal sequence of the HA tag, the Spike protein sequence of the PED virus, the Gly-Ser linker, and the CWP2P Fig. 5 is a diagram showing a schematic diagram of the introduction.
FIG. 2b shows that the recombinant sequence was synthesized with a primer designed on the amplified gene using the polymerase chain reaction method. The agarose gel electrophoresis image shows the recombinant sequence of the antigenic determinant gene of the desired PEDv and its gene . (1) M: 100 bp ladder, 1: PEDv1 gene, 2: PEDv1 gene, 2: M: 100 bp ladder, 3: PEDv2 gene, 4: PEDv2 gene synthesized by recombination sequence, : PEDv3 gene, 6: PEDv3 gene synthesized by recombination sequence, 4: M: 100 bp ladder, 7: CWP2 gene and 8: recombinant sequence synthesized CWP2 gene)
FIG. 3 is a diagram showing the comparison between the sequence of the PEDv antigen determinant 3 region (PEDv1, PEDv2, PEDv3) of the present invention and the PEDv sequence occurring before 2014 which is listed in NCBI. 3A-PEDv1, FIG. 3B-PEDv2, FIG. 3C-PEDv3.
FIG. 4 is a graph showing the relative intensity of the Induction transgenic strain relative to the non-induction transgenic strain intensity 1 as a reference.
FIG. 5 shows the results of Western blot analysis of three transformant strains (10, 11, and 15) using HRP as a primary antibody, and the protein was isolated by SDS-PAGE electrophoresis, The results show that the size of the Spike protein of PED virus is about 23 kDa (Host: Host yeast, INVSc1, 10, 11, 15: Transformants 10, 11, 15, M: Protein marker)
FIG. 6 shows the results of confirming that the antibody binding ability was maintained by Western blotting by thermally treating three kinds of transgenic strain (10, 11, 15). As shown in the drawing, the band signal of the thermally- (Host: detection result of HA antibody of yeast INVSc1 which is a non-heat-treated host, 10: detection result of HA antibody of expression 10, expression result of HA antibody, 11 : Result of HA antibody expression analysis of expressed transgenic strain No. 11, 15: Result of HA antibody expression analysis of expressed transgenic strain No. 15, A: Each transgenic strain expressing each transgenic strain was heat treated at 70 ° C for 30 minutes, blot results, and B: western blot results obtained by heat-treating the transformed strain expressing each strain at 100 ° C for 30 minutes.
FIG. 7 shows the results of immunohistochemical analysis by using a fluorescent immunoassay (Immunofluorescence Assay) to react the three primary cells (10, 11, 15) with HA primary antibodies expressing fluorescence of FITC wavelength, And it was confirmed by photographing with confocal microscope that it was induced in the cell envelope.

In order to accomplish the above object, the present invention relates to a novel recombinant vector comprising a porcine swine epidemic virus (PEDv) epitope protein, a gene encoding the same, a transformant expressing the same, and a porcine epidemic diarrhea virus- &Lt; / RTI > BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the drawings.

The present invention provides a porcine epidemic diarrhea virus (PEDv) epitope protein comprising the amino acid sequence of any one of SEQ ID NOS: 5-7.

The term " porcine epidemic diarrhea virus "(PEDv) in the present invention belongs to the coronaviridae family, which has a single strand RNA as a genome, about 28 Kb in length, (180-220 kDa), a membrane protein or coat protein (27-32 kDa), and a nucleocapsid protein (55-58 kDa). It is cultured in african green monkey kidney cells (Vero cell) with similar structure to the same species, SARS coronavirus, with trypsin.

In the present invention, the term "Spike protein" is a major constituent protein of PEDv and has a biologically important function of recognizing a target cell and fusing a virus with a cellular membrane. The COE (CO-26K fragment equivalent) gene, a part of the Spike protein, can be used as a neutralization epitope.

As used herein, the term "epitope" refers to a set of amino acid residues of an antigen binding site recognized by a particular antibody, or a T cell receptor protein and / or major histocompatibility complex (MHC) Lt; / RTI > An epitope is a molecule that forms a site recognized by an antibody, T cell receptor or HLA, and refers to a primary, secondary and tertiary peptide structure, or charge.

The new porcine epidemic diarrhea virus epitope protein of the present invention comprises any one of the amino acid sequences selected from SEQ ID NOS: 5 to 7, preferably having the nucleotide sequences of SEQ ID NOS: 1 to 3, respectively. The present invention separates PEDv from PEDv-infected wild piglets that were prevalent in 2014 and reported that the COE region (amino acid 502-639, Sequence Listing 1), PEDv1 (amino acid 502-639, Sequence Listing 1), which is known as an antigenic determinant site neutralizing PEDv (Amino acid 696-779, Sequence Listing 2), PEDv3 (amino acid 696-779, amino acid 1365-1383, see Sequence Listing 3) was expressed on the cell membrane surface of the yeast, and was registered in NCBI before 2014 As a result of comparing the PEDv sequence of the present invention with the Spike protein (KF738262) of the present invention, it was found that the PEDv sequence was different from that which was prevalent in Korea before 2014 (see FIG. 3). The COE region of PEDv according to the present invention differs from that of the previous PEDv and is not only worthy of research but also has a system for expressing the antigenic determinant site of PEDv in which the sequence is changed on the surface of yeast, There is a need to increase the available range as much as possible.

According to one aspect of the present invention, there is provided a recombinant vector comprising a gene encoding the aforementioned epitope protein, wherein the gene may be a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 3.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in a natural state, and the gene has been re-introduced into the cell by an artificial means as a modification.

As used herein, the term "vector" refers to any medium for cloning and / or transfer of a base into a host cell. A vector can be a replicon that can bring about the replication of a joined fragment of another DNA fragment. Refers to any genetic unit (e.g., a plasmid, phage, cosmid, chromosome, or virus) that functions in vivo as an autologous unit of DNA replication, that is, . The term "vector" includes viral and non-viral mediators for introducing a base into a host cell in vitro, in vitro or in vivo.

Preferably, the recombinant vector of the present invention may be a cell surface expression vector that expresses the epitope protein on the cell surface. To this end, CWP2, the immobilized protein of yeast, was applied to the expression technique as a surface expression host. CWP2 is composed of 92 amino acids and has the shortest sequence among the fixed proteins of yeast used as a surface expression host, so that it is easy to handle for expression and cloning. It is also known that the surface expression efficiency is high.

More preferably, the recombinant vector of the present invention can be constructed by inserting a gene encoding the epitope protein between the signal sequence of the yeast fixing protein CWP2 and the CWP2 sequence. For example, the recombinant vector may comprise a nucleotide sequence of SEQ ID NO: 9 which encodes the signal sequence of yeast immobilization protein CWP2, a nucleotide sequence encoding any of the epitope proteins selected from SEQ ID NOS: 1 to 3 and a sequence encoding yeast immobilization protein CWP2 The nucleotide sequence of SEQ ID NO: 12. In order to confirm the expression of the plasmid, an HA tag and a glycine-serine linker sequence for imparting stability of the recombination sequence may be further inserted.

FIG. 1 shows a schematic representation of a recombinant vector according to the present invention. It consists of the gene sequence structure excluding the signal sequence of CWP2P, the HA tag, the Spike protein sequence of PED virus, the glycine-serine linker, and the signal sequence of CWP2P including the GAL1 promoter from the N terminal region. The recombinant sequence consists of a total of 774 bp nucleotides and is a vector system designed to express the 23 kDa PED virus Spike protein on the surface of the yeast.

According to one aspect of the present invention, there is provided a transformant transformed with the above-mentioned recombinant vector. More preferably, the transformant may be yeast.

The term " transformed " in the present invention means that the genetic properties of an organism are changed by exogenously given DNA, that is, DNA, which is a kind of nucleic acid extracted from a cell of a certain line of an organism, Is introduced into the cell and the genetic trait is changed, which is also referred to as transformation or transformation. In the present invention, the term " transformant " refers to a transgenic plant or a transgenic animal produced by transformation, and includes a gene recombinant produced by inducing transformation or mutation of a specific gene using a gene recombination technique do.

The term "composition for the prevention or treatment of infection" of the present invention is a biological agent containing an antigen that immunizes a living body. In order to prevent infection, an immunogen Or a vaccine composition and a feed composition which are antigenic substances.

The term " prophylactic " in the present invention refers to any action that inhibits or delays the PEDV infection by administration of a transformant expressing the PEDV epitope protein of the present invention or a composition comprising the transformant as an active ingredient.

In the present invention, the term " treatment " refers to any action that improves or alleviates the symptoms of PEDV infection by administration of a transformant expressing the PEDV epitope protein of the present invention or a composition comprising the transformant as an active ingredient.

An "immunogen" or "antigenic substance" is any one selected from the group consisting of a peptide, a polypeptide, a lactic acid bacterium expressing the polypeptide, a protein, a lactic acid bacterium expressing the protein, an oligonucleotide, a polynucleotide, a recombinant bacterium and a recombinant virus . As a specific example, the antigenic substance may be in the form of an inactivated whole or partial cytostatic form, or an antigenic molecule obtained by conventional protein purification, genetic engineering techniques or chemical synthesis.

The antigenic substance in the composition may be included in an appropriate range.

The vaccine composition of the present invention may comprise a veterinarily acceptable carrier. The term "veterinarily acceptable carrier" in the present invention includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, Examples of the carrier, excipient and diluent which can be contained in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the vaccine composition of the present invention can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like in the form of oral preparations and sterilized injection solutions according to a conventional method. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. As the liquid preparation for oral administration, suspensions, solutions, emulsions, syrups and the like may be used. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, . Examples of the non-aqueous preparation and suspensions include vegetable oils such as propylene glycol, polyethylene glycol and olive oil, ethyl (meth) acrylate, ethyl An injectable ester such as an oleate, and the like can be used.

The feed composition used in the present invention may be suitably constituted by those skilled in the art in various forms of composition known in the art including the feed additive according to the present invention as an active ingredient, preferably 20% of protein, A feed composition comprising 4.5% of extract, 5.4% of fat, acid hydrolysis, 4.7% of crude fiber, 6% of ash, 0.80% of calcium and 0.62% of phosphate.

The object to which the present invention can be applied is not particularly limited, and any form can be applied. The present invention is not limited to animals such as chicken, pig, monkey, dog, cat, rabbit, guinea pig, rat, mouse, cattle, sheep, goat and the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

1. Recombinant vector pYECWP - PED Produce

In order to efficiently induce surface expression of PED antigen in yeast ( Saccharomyces cerevisiae ) strain, CWP2, which is a fixed protein of yeast, was designed as a matrix of surface expression so that the sequence is suitable for surface expression. This recombinant plasmid contains the HA tag to confirm that the plasmid is expressed between the signal peptide of CWP2 and the rest of the gene sequence, the Spike protein sequence (PEDv1,2,3) which is the surface protein of PED virus, the stability of the recombination sequence Recombinase sequence was designed by inserting the glycine-serine linker sequence (see Table 1 and Figure 1)

Gene name Base sequence Reference Restriction enzyme site HindIII AAGCTT BamHI GGATCC EcoRI GAATTC CWP2 signal sequence ATGCAATTCTCTACTGTCGCTTCCGTTGCTTTCGTCGCTTTGGCTAACTTTGTTGCCGCT Sequence Listing 9 HA tag
TACCCATACGACGTTCCAGACTACGCT Sequence Listing 10 PEDv
Spike protein

PEDv1
(COE) GTTACTCTGCCATCATTTAATGATCATTCTTTTGTTAACATTACTGTATCTGCTTCCTTTGGTGGTCATAGTGGTGCCAACCTTATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGACAATTCACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTAAATCACAGGACAGTAATTGCCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCCACCAGCCTTTTGGCTAGTGCCTGTATCATAGATCTTTTTGGTTACCCTGAGTTTAGTAGTGGTGTTAAGTTTACGTCCCTTTACTTTCAACTCACAAAGGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTGTCACGGACGTT Sequence Listing 1
(Fig. 3A) PEDv2 TCTGTTACGCCATGTTCTTTTTCAGAGCAGGCTGCATATGTTGATGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAGCTCCACTTTTAACAGTACTAGGGAGTTGCCTGGTTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGTTGGTGTATAGTAACATAGGTGTTTGTAAATCTGGCAGTATTGGCTACGTCCCATCTCAGTCTGGCCAAGTCAAGATTGCACCCACGGTTACT Sequence Listing 2
(Figure 3b) PEDv3
(PEDv2 + C-terminus) TCTGTTACGCCATGTTCTTTTTCAGAGCAGGCTGCATATGTTGATGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAGCTCCACTTTTAACAGTACTAGGGAGTTGCCTGGTTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGTTGGTGTATAGTAACATAGGTGTTTGTAAATCTGGCAGTATTGGCTACGTCCCATCTCAGTCTGGCCAAGTCAAGATTGCACCCACGGTTACTTTCTCAGGTTGTTGTAGGGGTCCTAGACTTCAACCTTACGAAGTTTTTGAAAAGGTC Sequence Listing 3
(Figure 3c) Whole sequence See Sequence Listing 4 Sequence Listing 4 Glycine-serine linker Gt; Sequence Listing 11 CWP2 gene
GAATCCGCTGCCGCCATTTCTCAAATCACTGACGGTCAAATCCAAGCTACTACCACTGCTACCACCGAAGCTACCACCACTGCTGCCCCATCTTCCACCGTTGAAACTGTTTCTCCATCCAGCACCGAAACTATCTCTCAACAAACTGAAAATGGTGCTGCTAAGGCCGCTGTCGGTATGGGTGCCGGTGCTCTAGCTGCTGCTGCTATGTTGTTATAA Sequence Listing 12

Production of this recombinant sequence was carried out by separating the PED domain including CWP2 signal peptide, HA tag, and PEDv Spike protein sequence and the CWP2 domain including glycine-serine linker and CWP2 gene sequence excluding the signal peptide sequence.

The PEDv domain was constructed by amplifying the Spike protein sequence in the genomic plasmid of PEDv and synthesizing the signal peptide sequence and HA tag sequence of CWP2 using primers. The total number of primers used was 11, which is shown in Table 2 below.

Primer name The base sequence (5'-3 ') Sequence List PEDV1-F GTTACTCTGCCATCATTTAATGATCATTCTTTTG 13 PEDV1-R GGATCCAACGTCCGTGACACCTTCAAG 14 PEDV2-F TCTGTTACGCCATGTTCTTTTTCAGAGCAG 15 PEDV2-R GGATCCAGTAACCGTGGGTGCAATCTTGAC 16 PEDV3-R1 CCTACAACAACCTGAGAAAGTAACCGTGGGTG 17 PEDV3-R2 TCGTAAGGTTGAAGTCTAGGACCCCTACAACAACC 18 PEDV3-R3 GGATCCGACCTTTTCAAAAACTTCGTAAGGTTGA 10 HA-F1 CCATACGACGTTCCAGACTACGCTGTTACTCTGCC 20 SS-HA-F TGGCTAACTTTGTTGCCGCTTACCCATACGACGTT 21 SS-F1 CGCTTCCGTTGCTTTCGTCGCTTTGGCTAACTTTG 22 SS-F2 AAGCTTATGCAATTCTCTACTGTCGCTTCCGTTGC 23

The CWP2 domain contains yeast ( Saccharomyces Using the genomic DNA was in the Cerevisiae) amplifying a gene other than the rest of the signal peptide sequence of the Primer CWP2 glycine-serine was produced by synthesizing the linker sequence. Table 4 shows the total number of primers used.

Primer name The base sequence (5'-3 ') Sequence List CWP2-F GAATCCGCTGCCGCCATTTCTCAA 24 CWP2-R GAATTCTTATAACAACATAGCAGCAGCAGCTAGAG 25 GSL-CWP-F GTTCTGGTGGTGGTGGTTCTGAATCCGCTGCCGCC 26 GSL-F Gt; 27

After the two domains were prepared, they were introduced into T-Vector to confirm their base sequences. Subsequently, the CWP2 domain was subcloned into a yeast expression vector pYES2 Vector using GAL1 as a promoter using restriction enzyme BamHI / EcoRI Site (Table 1) , And the vector was subcloned into the PEDv domain using the restriction enzyme HindIII / BamHI Site (Table 1) to complete the recombinant vector pYECWP-PED1 (FIG. 2). In addition, the PEDv3 region, which synthesized the C-terminus sequence of PEDv2 and PEDv2 as well as the PEDv1 antigenic determinant sequence, constructed a recombinant vector group similar to that of PEDv1 and studied the antibody production ability against PEDv to construct a preventive system for PED to be.

2. PEDv Spike Yeast surface expression of protein

In order to express the prepared recombinant vector pYECWP-PED1 on yeast, EasyComp. Transformation kit was used to transform yeast (INVSc1) and cultured in SC-URA agar medium supplemented with 2% glucose for 48 hours at 37 ° C. Forty of the cultured transformants were randomly selected and galactose was used as an inducer to express the PEDv Spike protein on the surface of the yeast.

The conditions were as follows: The transformed strain Colony was inoculated into the SC-URA liquid medium supplemented with 2% glucose and incubated overnight at 30 ° C with shaking at 200 rpm. The absorbance of the cultured medium was measured at OD 600nm, The SC-URA liquid medium supplemented with 1% raffinose was calculated to have an absorbance of 0.4 and inoculated. The surface expression was induced by shaking at 200 rpm for 20 hours at 30 ° C.

3. Expression-induced recombinant yeast in yeast envelope 40 states Confirmation of expression

Dot blot method was used to verify the expression of Spike protein of PED virus, which is an exogenous protein of 40 recombinant yeast-induced surface expression induced by the above conditions.

A 5x lysis buffer was added to the concentrated solution which was 20 times concentrated, and the cells were treated at 100 ° C for 10 minutes to dissolve the cells. As a sample, Yeast (INVSc1) hosted in PVDF Membrane as Dot and 40 yeast Of the non-induction sample and the induction sample were loaded by 20ul each. Then, 5% Skim Milk was added to 1X PBS-T (tween20) buffer solution and blocked overnight at 4 ° C. After washing with 1X PBS-T (tween20) buffer solution, Horseradish peroxidase (HRP) Was reacted with HA primary antibody at room temperature for 3 hours. After washing with 1X PBS-T (tween20) buffer solution, ECL solution was used for color development to confirm antibody detection results (FIG. 4). As a result, three kinds of recombinant yeasts (10, 11, 15) with the strongest signal were selected.

4. Expression of 3 recombinant yeasts (10, 11, 15) and protein size

Three recombinant yeasts selected in the above were loaded with two sets of SDS-PAGE gels in the same manner to confirm the presence of Spike protein of PED virus. One set was confirmed to react with HA antibody by Western blot, Was verified to be a 23 kDa size of PED Spike protein by confirming the protein size by performing coumarin blue staining (FIG. 5).

5. Stability after thermal treatment of three recombinant yeast strains (10, 11, 15)

The recombinant yeast of the present invention should be used as a feed additive after the recombinant yeast is thermally treated and killed as a preventive system of PED to examine the ability to produce antibodies against PEDv. To investigate the possibility, three recombinant yeast strains of the present invention were treated with HA tag antibody by Western blotting at 70 ° C and 100 ° C for 30 minutes, respectively. As a result, the bacteria were killed by heat treatment, (Fig. 6). &Lt; / RTI >

6. Identification of surface expression by observation of cells by fluorescent immunoassay of three recombinant yeast strains (10, 11, and 15 transformants)

Cells of the three recombinant yeasts expressed were reacted with HA primary fluorescent antibody labeled with FITC on an epentool tube using fluorescence immunoassay to confirm whether they bind to the PED spike protein exposed on the surface of the recombinant yeast The fluorescence signal of the FITC wavelength was confirmed by photographing with a confocal microscope (FIG. 7).

The present invention has been described above with reference to preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Chungbuk National University <120> Epitope protein of PEDV, Recombinant vector contaning genes encoding them, Transformant expressing thereof, and Composition for preventing or treating PED <160> 27 <170> Kopatentin 2.0 <210> 1 <211> 420 <212> DNA <213> porcine epidemic diarrhea virus, PEDv1 (COE) <400> 1 gttactctgc catcatttaa tgatcattct tttgttaaca ttactgtatc tgcttccttt 60 ggtggtcata gtggtgccaa ccttattgca tctgacacta ctatcaatgg gtttagttct 120 ttctgtgttg acactagaca attcaccatt tcactgtttt ataacgttac aaacagttat 180 ggttatgtgt ctaaatcaca ggacagtaat tgccctttca ccttgcaatc tgttaatgat 240 tacctgtctt ttagcaaatt ttgtgtttcc accagccttt tggctagtgc ctgtatcata 300 gatctttttg gttaccctga gtttagtagt ggtgttaagt ttacgtccct ttactttcaa 360 ctcacaaagg gtgagttgat tactggcacg cctaaaccac ttgaaggtgt cacggacgtt 420 420 <210> 2 <211> 252 <212> DNA <213> porcine epidemic diarrhea virus, PEDv2 <400> 2 tctgttacgc catgttcttt ttcagagcag gctgcatatg ttgatgatga tatagtgggt 60 gttatttcta gtttgtctag ctccactttt aacagtacta gggagttgcc tggtttcttc 120 taccattcta atgatggctc taattgtaca gagcctgtgt tggtgtatag taacataggt 180 gtttgtaaat ctggcagtat tggctacgtc ccatctcagt ctggccaagt caagattgca 240 cccacggtta ct 252 <210> 3 <211> 309 <212> DNA <213> porcine epidemic diarrhea virus, PEDv3 <400> 3 tctgttacgc catgttcttt ttcagagcag gctgcatatg ttgatgatga tatagtgggt 60 gttatttcta gtttgtctag ctccactttt aacagtacta gggagttgcc tggtttcttc 120 taccattcta atgatggctc taattgtaca gagcctgtgt tggtgtatag taacataggt 180 gtttgtaaat ctggcagtat tggctacgtc ccatctcagt ctggccaagt caagattgca 240 cccacggtta ctttctcagg ttgttgtagg ggtcctagac ttcaacctta cgaagttttt 300 gaaaaggtc 309 <210> 4 <211> 4161 <212> DNA <213> porcine epidemic diarrhea virus, spike protein <400> 4 atgaagtctt taacctactt ctggttgttc ttaccagtac tttcaacact tagcctacca 60 caagatgtca ccaggtgctc agctaacact aattttaggc ggttcttttc aaaatttaat 120 gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga aaaccagggt 180 gtcaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt tcatggtatc 240 tttgttagcc atattagagg tggtcatggc tttgagattg gcatttcgca agagcctttt 300 gactctagtg gttaccagct ttatttacat aaggctacta acggtaacac taatgctact 360 gcgcgactgc gcatttgcca gtttcctagc attaaaacat tgggccccac tgctaataat 420 gatgttacaa caggtcgtaa ttgcctattt aacaaagcca tcccagctca tatgagtgaa 480 catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc tgacaagatc 540 tattattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta caacagtgga 600 ggttgtgcta tgcaatatgt ttacgaaccc acctattaca tgcttaatgt tactagtgct 660 ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720 gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780 cttttgtcca atgattccac tttggtgcat ggtaaggtgg tttccaacca accattgttg 840 gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt ctcctttaat 900 caaacgatcg atggcgtttg taatggagct gctgtgcagc gtgcaccaga ggctctgagg 960 tttaacatta atgacacctc tgtcattctt gctgaaggct caattgtact tcatactgct 1020 ttaggaacaa atttttcttt tgtttgcagt aattcctcaa atcctcactt agctaccttc 1080 gccatacctc tgggtgctac ccaagtacct tattattgtt ttcttaaagt ggatacttac 1140 aactccactg tttataaatt tttggctgtt ttacctccta ccgtcaggga aattgtcatc 1200 accaagtatg gtgatgttta tgtcaatggg tttggatact tgcatctcgg tttgttggat 1260 gctgtcacaa ttaatttcac tggtcatggc actgacgatg atgtttctgg tttttggacc 1320 atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaaccgc cattcagcgt 1380 attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc ttttgacctt 1440 gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca gccaatttct 1500 tttgttactc tgccatcatt taatgatcat tcttttgtta acattactgt atctgcttcc 1560 tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa tgggtttagt 1620 tctttctgtg ttgacactag acaatttacc atttcactgt tttataacgt tacaaacagt 1680 tatggttatg tgtctaaatc acaggacagt aattgccctt tcaccttgca atctgttaat 1740 gattacctgt cttttagcaa attttgtgtt tccaccagcc ttttggctag tgcctgtacc 1800 atagatcttt ttggttaccc tgagtttggt agtggtgtta agtttacgtc cctttacttt 1860 caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg tgtcacggac 1920 gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt taaaggtgag 1980 ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattacac atctgattct 2040 ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100 tctttttcag agcaggctgc atatgttgat gatgatatag tgggtgttat ttctagtttg 2160 tctagctcca cttttaacag tactagggag ttgcctggtt tcttctacca ttctaatgat 2220 ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg taaatctggc 2280 agtattggct acgtcccatc tcagtctggc caagtcaaga ttgcacccac ggttactggg 2340 aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt acagctttac 2400 aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc tcgttgtaaa 2460 caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt acaactcagc 2520 gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga ggctctacag 2580 ttagctacca ttagttcgtt taatggtgat ggatataatt ttactaatgt gctgggtgtt 2640 tctgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtcttttat tgaagacctg 2700 ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760 tctaatggtc gttctgtggc agatctagtc tgtgcacagt attactctgg tgtcatggta 2820 ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct catcggtggt 2880 atggtgctag gaggttttac ttctgcagcg gcattgcctt ttagctatgc tgttcaagct 2940 agactcaatt atcttgctct acagacggat gttctacagc ggaaccagca attgcttgct 3000 gagtctttta actctgctat tggtaatata acttcagcct ttgagagtgt taaagaggct 3060 attagtcaaa cttccaaggg tttgaacact gtggctcatg cgcttactaa ggttcaagag 3120 gttgttaact cgcagggtgc agctttgact caacttaccg tacagctgca acacaacttc 3180 caagccattt ctagttctat tgatgacatt tactctcgac tggacattct ttcagccgat 3240 gttcaggttg accgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300 accctcacta agtatactga ggttcaggct agcaggaagt tagcacagca aaaggttaat 3360 gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatt 3420 ttctctctgg tacaggcagc acctcagggc ctgctgtttt tacatacagt acttgtaccg 3480 agtgattttg tagatgttat tgccatcgct ggcttatgcg ttaacgatga aattgccttg 3540 actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaaatca tactgcgacg 3600 gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt tagtgatttt 3660 gttcaaattg agagttgtgt ggtcacctat gtcaatttga ctagagacca actaccagat 3720 gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc ttctctgccc 3780 aatagaactg gtccaagtct tcctttagat gtttttaatg ccacttatct taatctcact 3840 ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac agaggagctc 3900 caaagtctta tatataatat caacaacaca ctagttgacc ttgagtggct caaccgagtt 3960 gagacatata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt tctcatcttt 4020 gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg ctgcggctgc 4080 tgctgtgctt gtttctcagg ttgttgtagg ggtcctagac ttcaacctta cgaagttttt 4140 gaaaaggtcc acgtgcagtg a 4161 <210> 5 <211> 140 <212> PRT <213> PEDv1 aminoacid sequence <400> 5 Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe Val Asn Ile Thr Val 1 5 10 15 Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn Leu Ile Ala Ser Asp 20 25 30 Thr Ile Asn Gly Phe Ser Ser Phe Cys Val Asp Thr Arg Gln Phe 35 40 45 Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser Tyr Gly Tyr Val Ser 50 55 60 Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu Gln Ser Val Asn Asp 65 70 75 80 Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr Ser Leu Leu Ala Ser 85 90 95 Ala Cys Ile Ile Asp Leu Phe Gly Tyr Pro Glu Phe Ser Ser Gly Val 100 105 110 Lys Phe Thr Ser Leu Tyr Phe Gln Leu Thr Lys Gly Glu Leu Ile Thr 115 120 125 Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp Val 130 135 140 <210> 6 <211> 84 <212> PRT <213> PEDv2 aminoacid sequence <400> 6 Ser Val Thr Pro Cys Ser Phe Ser Glu Gln Ala Ala Tyr Val Asp Asp 1 5 10 15 Asp Ile Val Gly Val Ile Ser Ser Leu Ser Ser Ser Thr Phe Asn Ser 20 25 30 Thr Arg Glu Leu Pro Gly Phe Phe Tyr His Ser Asn Asp Gly Ser Asn 35 40 45 Cys Thr Glu Pro Val Leu Val Tyr Ser Asn Ile Gly Val Cys Lys Ser 50 55 60 Gly Ser Ile Gly Tyr Val Ser Ser Gln Ser Gly Gln Val Lys Ile Ala 65 70 75 80 Pro Thr Val Thr <210> 7 <211> 103 <212> PRT <213> PEDv3 aminoacid sequence <400> 7 Ser Val Thr Pro Cys Ser Phe Ser Glu Gln Ala Ala Tyr Val Asp Asp 1 5 10 15 Asp Ile Val Gly Val Ile Ser Ser Leu Ser Ser Ser Thr Phe Asn Ser 20 25 30 Thr Arg Glu Leu Pro Gly Phe Phe Tyr His Ser Asn Asp Gly Ser Asn 35 40 45 Cys Thr Glu Pro Val Leu Val Tyr Ser Asn Ile Gly Val Cys Lys Ser 50 55 60 Gly Ser Ile Gly Tyr Val Ser Ser Gln Ser Gly Gln Val Lys Ile Ala 65 70 75 80 Pro Thr Val Thr Phe Ser Gly Cys Cys Arg Gly Pro Arg Leu Gln Pro 85 90 95 Tyr Glu Val Phe Glu Lys Val 100 <210> 8 <211> 4 <212> PRT <213> porcine epidemic diarrhea virus, spike protein <400> 8 Pro Glu Asp Val One <210> 9 <211> 60 <212> DNA <213> Saccharomyces cerevisiae <400> 9 atgcaattct ctactgtcgc ttccgttgct ttcgtcgctt tggctaactt tgttgccgct 60 60 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HA tag <400> 10 tacccatacg acgttccaga ctacgct 27 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Glycine-Serine linker <400> 11 ggtggtggtg gttctggtgg tggtggttct 30 <210> 12 <211> 219 <212> DNA <213> Saccharomyces cerevisiae <400> 12 gaatccgctg ccgccatttc tcaaatcact gacggtcaaa tccaagctac taccactgct 60 accaccgaag ctaccaccac tgctgcccca tcttccaccg ttgaaactgt ttctccatcc 120 agcaccgaaa ctatctctca acaaactgaa aatggtgctg ctaaggccgc tgtcggtatg 180 ggtgccggtg ctctagctgc tgctgctatg ttgttataa 219 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV1-F <400> 13 gttactctgc catcatttaa tgatcattct tttg 34 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV1-R <400> 14 ggatccaacg tccgtgacac cttcaag 27 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV2-F <400> 15 tctgttacgc catgttcttt ttcagagcag 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV2-R <400> 16 ggatccagta accgtgggtg caatcttgac 30 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV3-R1 <400> 17 cctacaacaa cctgagaaag taaccgtggg tg 32 <210> 18 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV3-R2 <400> 18 tcgtaaggtt gaagtctagg acccctacaa caacc 35 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer, PEDV3-R3 <400> 19 ggatccgacc ttttcaaaaa cttcgtaagg ttga 34 <210> 20 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, HA-F1 <400> 20 ccatacgacg ttccagacta cgctgttact ctgcc 35 <210> 21 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, SS-HA-F <400> 21 tggctaactt tgttgccgct tacccatacg acgtt 35 <210> 22 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, SS-F1 <400> 22 cgcttccgtt gctttcgtcg ctttggctaa ctttg 35 <210> 23 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, SS-F2 <400> 23 aagcttatgc aattctctac tgtcgcttcc gttgc 35 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer, CWP2-F <400> 24 gaatccgctg ccgccatttc tcaa 24 <210> 25 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, CWP2-R <400> 25 gaattcttat aacaacatag cagcagcagc tagag 35 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer, GSL-CWP-F <400> 26 gttctggtgg tggtggttct gaatccgctg ccgcc 35 <210> 27 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer, GSL-F <400> 27 ggatccggtg gtggtggttc tggtggtggt g 31

Claims

A porcine epidemic diarrhea virus (PEDv) epitope protein consisting of any one of the amino acid sequences selected from the group consisting of SEQ ID NOS: 5 to 7.

A porcine epidemic diarrhea virus (PEDv) antigen comprising the epitope of claim 1.

A recombinant vector comprising a gene encoding the epitope protein of claim 1.

The method of claim 3,
Wherein the gene is a base sequence represented by any one of SEQ ID NOS: 1 to 3.

The method of claim 3,
Wherein the recombinant vector expresses an epitope protein on a cell surface.

The method of claim 3,
Wherein the recombinant vector is constructed by inserting a gene encoding the epitope protein between the signal sequence of the yeast fixing protein CWP2 and the CWP2 sequence.

The method according to claim 6,
The recombinant vector comprises a nucleotide sequence of SEQ ID NO: 9 encoding the signal sequence of yeast immobilization protein CWP2, a nucleotide sequence encoding any of the epitope proteins selected from SEQ ID NOS: 1 to 3, and a nucleotide sequence encoding yeast surface protein CWP2 Wherein the recombinant vector comprises a base sequence.

A transformant transformed with the recombinant vector of any one of claims 3 to 7.

9. The method of claim 8,
Wherein the transformant is yeast.

A composition for preventing or treating swine epidemic diarrhea virus infection comprising the transformant of claim 8, a protein extract of the transformant, or a recombinant PEDv epitope protein isolated from the transformant.