KR20190014265A - Vaccine composition for preventing or treating porcine pleuropneumonia - Google Patents

Abstract

The present invention relates to a fusion protein including a fragment of ApxIA of Actinobacillus pleuropneumoniae and a fragment of ApxIIA of Actinobacillus pleuropneumoniae. In particular, among constituents A, B, C, and D of toxin ApxI, NA (1-380 amino acids) which is a partial protein of the N-terminal fragment of a structural protein of ApxI, ApxIA, is fused with F#5 (439-801 amino acids) which is a partial protein of a structural protein of ApxII toxin, ApxIIA, to thereby form a fusion protein L. In the present invention, it was found that a vaccine using the fusion protein L provides defense not only against serotype 1 of Actinobacillus pleuropneumoniae with a combination of ApxI and ApxII, but also against serotype 2 of Actinobacillus pleuropneumoniae with a combination of ApxII and ApxIII. Accordingly, the vaccine including the fusion protein L may be used as a vaccine against the above two serotypes of Actinobacillus pleuropneumoniae.

Description

[0001] Vaccine composition for preventing or treating porcine pleuropneumonia [

TECHNICAL FIELD The present invention relates to a vaccine composition for preventing or treating swine pneumonia using a fusion protein of Apx toxin of the swine pleura pneumoniae.

Actinobacillus pleuropneumoniae ( APP), a pleural pneumonia in pigs, is caused by pleural pneumonia, which generally occurs acutely and causes a sudden death of growers or finishing pigs. The main symptoms are lack of appetite , Dyspnea, vomiting, cyanosis, high fever, bleeding in nose and mouth, sudden death. It is difficult to treat because it is often done by rapid forming at the early stage of infection. It is a disease that causes enormous economic damage to swine industry due to decrease of growth rate and delays in shipment even if progressing to chronic. So far, 15 serotypes have been identified worldwide. In domestic pig farms, the highest number of pleural pneumonia due to 2nd and 5th out of 15 serotypes is present. In addition, regarding the import of breeder pigs, in Korea, there is a report on the occurrence of pleural pneumonia due to serotype 1, 3, 4, 6, 7, 10, 12 in Korea.

The pathogenic factors of the pleural effusions include lipopolysaccharides, outer membrane proteins, urease, capsular polysaccharides, adhesion factors, Apx toxin, I-IV and the like are known.

ApxI is a protein with strong hemolytic and cytotoxic activity and is a serotype of serotypes such as 1, 5, 9, 10, and 11 in the form of ApxI, Apx, ApxIII and ApxIV. Is secreted. Apx is a weakly hemolytic and moderately cytotoxic protein that is secreted by all serotypes except 10. Apx has no hemolytic properties, but is cytotoxic and is secreted in type 2, 3, 4, 6, and 8. ApxIV has a weak hemolytic character and its role is not yet known. In particular, the serotype 1 of pleuropneumonia and the serotype 2 of pleuropneumoniae are composed of different combinations of Apx toxins. Serum type 1 of pleural effusions has a combination of ApxI and ApxII, and Serotype 2 of Pleuropneumonia has a combination of ApxII and ApxIII.

In addition, each Apx toxin consists of four components ApxA, ApxB, ApxC and ApxD, and these four genes are required for the secretion and production of Apx toxin. The ApxA gene is a structural toxin protein, and the ApxC gene serves to activate the toxin. The ApxB and ApxD genes play a role in the secretion of activated toxins.

In the present invention, a vaccine capable of simultaneously defending serotype 1 of pleuropneumoniae and serotype 2 of pleuropneumoniae, which are composed of different combinations of Apx toxins, was developed.

Korean Patent Publication No. 10-2012-0054037

It is an object of the present invention to provide a fusion protein comprising a fragment of Pleuropneumoniae ApxIA protein and a fragment of Plexpornium pneumoniae ApxIIA protein.

Another object of the present invention is to provide a gene encoding the fusion protein.

Another object of the present invention is to provide a recombinant vector containing the gene.

It is another object of the present invention to provide a transformant transformed with said recombinant vector.

Another object of the present invention is to provide a vaccine composition for preventing or treating pleuropneumonia, which comprises the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant as an active ingredient.

Another object of the present invention is to provide a feed composition for preventing or ameliorating pleuropneumonia, comprising the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant as an active ingredient.

Another object of the present invention is to provide a composition for the prevention or amelioration of pleural pneumonia, comprising the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant as an active ingredient.

Another object of the present invention is to provide a method for preventing or treating pleural pneumonia, comprising the step of administering the vaccine composition, feed composition or feed additive composition to a mammal other than a human.

The inventors of the present invention have found that, in order to prepare a vaccine against Serotype 1 of Pleuropneumoniae having a combination of toxin ApxI and ApxII, the N-terminus of ApxIA, the structural protein of ApxI, among the components A, B, C and D of toxin ApxI A vaccine using fusion protein L, which is a fusion of NA (1 to 380 amino acids), a partial protein, and F # 5 (439 to 801 amino acids), a partial protein of ApxIIA, a structural protein of ApxII toxin, , Which is a combination of ApxII and ApxIII toxin, as well as Serotype 1 of Pleural Efficiency Pneumococcus, which has a combination of Pseudomonas aeruginosa and Pseudomonas aeruginosa, has been used as a vaccine for two serotypes of Pleural Pneumoniae And completed the present invention.

In one aspect, the present invention provides a fusion protein comprising a fragment of Pleuropneumoniae ApxIA protein and a fragment of Plasmodium pneumoniae ApxIIA protein.

Actinobacillus pleuropneumoniae ( APP), a serotype 1 of Pleuropneumoniae, has a combination of ApxI and ApxII, and Actinobacillus flutneumoniae pleuropneumoniae , APP) have a combination of ApxII and ApxIII. More specifically, Serotype 1 of the above-described Pleurotus aeruginosa has a combination of ApxI and ApxIIA, which are structural proteins of ApxI and ApxII, and a combination of ApxII and ApxIIIA, which are structural proteins of ApxII and ApxIII in the case of serotype 2 of Pleural Efficiency Have.

Accordingly, in the present invention, the N-terminal of ApxIA corresponding to a fragment of the ApxIA protein, which is a structural protein of ApxI, which is one of the toxins possessed by Actinobacillus pleuropneumoniae ( APP) type 1 , pleuropneumoniae , 1 ~ 380 amino acid) and F # 5 (439 ~ 801 amino acid) which is a part of ApxIIA corresponding to a fragment of ApxIIA, which is a structural protein of ApxII.

Specifically, in one embodiment of the present invention, a gene is extracted from strain 1 (APP1) of Actinobacillus fluorescens, and the gene NA and F # 5 are amplified using a primer containing GS LINKER The amplified genes were ligated through GS LINKER to produce a fused gene L linked by NA and GA constructing F # 5, which constitutes a part of ApxIA, at the N terminus of ApxIA.

Accordingly, in the present invention, the fusion protein can be linked to a fragment of Pleuropneumoniae ApxIA protein and a fragment of Pleuropneumoniae ApxIIA protein to a peptide linker.

In the present invention, the ApxIA protein fragment of Pleural Efficiency Pneumococcus has the NA of the N terminal part of ApxIA Amino acid 1 < / RTI >

In the present invention, the fragment of the pleuropneumonitus ApxIIA protein may be F # 5, and may be composed of the amino acid sequence of SEQ ID NO: 2.

In the present invention, the peptide linker may be GS LINKER, and may be composed of the amino acid sequence of SEQ ID NO: 3.

In the present invention, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 2, and the amino acid sequence of SEQ ID NO: 4 to which the amino acid of SEQ ID NO: 3 is linked.

In another aspect, the present invention provides a gene encoding a fusion protein comprising a fragment of Pleuropneumonitus ApxIA protein and a fragment of Pleuropneumoniae ApxIIA protein.

The above fusion proteins are as described above. The gene may be one in which one or more of the codon sequences has been modified to a codon suitable for expression of the host cell. The host cell may be E. coli, yeast or a combination thereof. The gene may encode the amino acid sequence of SEQ ID NO: 4. For example, the gene may have the nucleotide sequence of SEQ ID NO: 5.

In one embodiment of the present invention, a fusion gene L prepared by ligating NA amplified through gene amplification and F # 5 through GS LINKER was prepared and ligated to a pET-28a expression vector. Then, E. coli was transformed And the nucleotide sequence of SEQ. ID. NO: 5 was confirmed to be inserted into the expression vector through the gene base sequence.

In another embodiment, the present invention provides a recombinant vector comprising a gene encoding the fusion protein.

The above fusion proteins and genes are as described above.

As used herein, the term " recombinant " refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in a natural state, and the gene has been re-introduced into the cell by an artificial means as a modification.

The term " vector " as used herein refers to any medium for cloning and / or transfer of a base into a host cell. A vector can be a replicon that can bring about the replication of a joined fragment of another DNA fragment. Refers to any genetic unit (e.g., a plasmid, phage, cosmid, chromosome, or virus) that functions in vivo as an autologous unit of DNA replication, that is, . The term " vector " includes viral and non-viral mediators for introducing a base into a host cell in vitro, in vitro or in vivo.

The recombinant vector of the present invention may include a gene encoding a fusion protein comprising a fragment of Pleuropneumonitus ApxIA protein and a fragment of Pleuropneumoniae ApxIIA protein. More specifically, a gene encoding the amino acid sequence of SEQ ID NO: 4 is included. Or a nucleotide sequence of SEQ ID NO: 5.

In another embodiment, the present invention provides a transformant transformed with said recombinant vector.

In the present invention, the term " transformation " means that the genetic property of a living organism is changed by externally given DNA, that is, when DNA, which is a kind of nucleic acid extracted from a cell of any organism of an organism, The transformation of the genetic traits of the DNA into the cells is also referred to as transformation.

In the present invention, the term " transformant " refers to a transgenic plant or a transgenic animal produced by transformation, and includes a gene recombinant produced by inducing transformation or mutation of a specific gene using a gene recombination technique do. The transformant of the present invention can be appropriately selected and used by a person skilled in the art without limitation as long as it is a cell which can be used for transformation known in the art, and can be a transformant derived from a microorganism as a transformant other than a human.

In another aspect, the present invention provides a vaccine composition for preventing or treating pleuropneumonia, comprising the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant as an active ingredient.

In the present invention, the pleural pneumonia may be type 1 (APP1) of Actinobacillus flourneumonia and pleural type 2 (APP2) of Actinobacillus flourneumonia.

In one embodiment of the present invention, it was confirmed that the L vaccine, which is a fusion protein, has a protective effect against two serotypes of APP1 and APP2

In the present invention, the terms " fusion protein " and " transformant " are as described above.

In the present invention, the term " prophylactic " is intended to include all of the above-mentioned fusion proteins, protein extracts of the transformants or compositions containing the recombinant proteins isolated from the transformants as effective ingredients to suppress or delay pleural pneumonia Acts.

In the present invention, the term " treatment " refers to the administration of a composition comprising the fusion protein of the present invention, a protein extract of the transformant or a recombinant protein isolated from the transformant as an active ingredient, Acts.

The term " vaccine " in the present invention refers to a biological agent containing an antigen that immunizes a living body, and refers to an immunogen or an antigenic substance that causes immunity to a living body by injection or oral administration to a human or animal for the prevention of infection .

The term " immunogen " or " antigenic substance " in the present invention refers to a group consisting of a peptide, a polypeptide, a lactic acid bacterium expressing the polypeptide, a protein, a lactic acid bacterium expressing the protein, an oligonucleotide, a polynucleotide, a recombinant bacterium and a recombinant virus And is selected. As a specific example, the antigenic substance may be in the form of an inactivated whole or partial cytostatic form, or an antigenic molecule obtained by conventional protein purification, genetic engineering techniques or chemical synthesis.

The content of the antigen may be 1 to 10% by weight based on the total weight of the vaccine composition.

The vaccine composition of the present invention may further comprise at least one immunostimulant.

The term " immunostimulant " in the present invention refers to any substance that generally increases body fluids and / or cellular immune responses to an antigen. Conventional vaccines consist of non-processed preparations of dead pathogenic microorganisms so that impurities associated with the culture medium of pathogenic microorganisms may act as an immunity enhancer to enhance the immune response, but the homogeneous preparation of the purified protein subunit may serve as an antigen for vaccination When used, the immunity triggered by such an antigen is insufficient, so that it is necessary to add some foreign substances as an immunostimulating agent. The use of an immunostimulant may require a smaller dose of antigen to stimulate the immune response, thereby reducing vaccine production costs. These immune enhancers are classified according to their raw materials (minerals, bacteria, plants) and components (emulsion suspension). Specifically, there are cholera toxin (CT), aluminum hydroxide, carbopol, mineral oil or biodegradable oil.

The vaccine composition according to the present invention can be used as a stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, bacterial cell wall, (2-hydroxyethyl) -propanediamine, monophosphoryl lipid, < RTI ID = 0.0 > A, dimethyl dioctadecyl-ammonium bromide, and mixtures thereof. The second auxiliary agent may further contain at least one second auxiliary selected from the group consisting of A, dimethyl dioctadecyl-ammonium bromide, and mixtures thereof.

In addition, the vaccine composition of the present invention may comprise a veterinarily acceptable carrier. The term " veterinarily acceptable carrier " in the present invention includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, Examples of the carrier, excipient and diluent which can be contained in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the vaccine composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like in the form of oral preparations and sterilized injection solutions according to conventional methods. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. As the liquid preparation for oral administration, suspensions, solutions, emulsions, syrups and the like may be used. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and freeze-drying agents. As the non-aqueous preparation and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.

In another aspect, the present invention provides a feed composition for preventing or ameliorating pleuropneumonia, comprising the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant as an active ingredient.

In the present invention, the pleural pneumonia may be type 1 (APP1) of Actinobacillus flourneumonia and pleural type 2 (APP2) of Actinobacillus flourneumonia.

In one embodiment of the present invention, it was confirmed that the L vaccine, which is a fusion protein, has a protective effect against two serotypes of APP1 and APP2

In the present invention, the terms "fusion protein", "transformant" and "prevention" are as described above.

The feed composition of the present invention is suitably constituted by those skilled in the art in various forms of composition known in the art including the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant .

In the present invention, the feed composition may contain energy, amino acids, minerals, vitamins and water as essential nutrients to be supplied from the feed for the maintenance and growth of the individual, in addition to the feed additives.

The individual to which the feed composition of the present invention can be applied is not particularly limited, and any form can be applied. The present invention is not limited to animals such as chicken, pig, monkey, dog, cat, rabbit, guinea pig, rat, mouse, cattle, sheep, goat and the like.

The feed is used to include all kinds of feeds, functional feeds, beverages, feed additives and beverage (negative) additives.

In the feed composition, the amount of the active ingredient may be 0.00001 wt% or more, specifically 0.1 wt% or more, and 80 wt% or less, specifically 50 wt% or less, more specifically 40 wt% or less But is not limited thereto.

In another aspect, the present invention provides a composition for preventing or improving pleural fluid pneumonia, comprising the fusion protein, the protein extract of the transformant, or the recombinant protein isolated from the transformant as an active ingredient do.

In the present invention, the pleural pneumonia may be type 1 (APP1) of Actinobacillus flourneumonia and pleural type 2 (APP2) of Actinobacillus flourneumonia.

In one embodiment of the present invention, it was confirmed that the L vaccine, which is a fusion protein, has a protective effect against two serotypes of APP1 and APP2

In the present invention, the terms "fusion protein", "transformant" and "prevention" are as described above.

The term " feed additive composition " of the present invention means a substance which can be added to feed to improve productivity and improve health.

The composition for feed addition of the present invention may be prepared in various forms known in the art, and preferably includes the fusion protein, the protein extract of the transformant, or the recombinant protein isolated from the transformant as an active ingredient .

The feed additives according to the present invention can be used individually and can be used in combination with conventionally known feed additives and can be used sequentially or simultaneously with conventional feed additives. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

The composition for feed addition of the present invention is not particularly limited to an individual to which the feed composition can be applied, and any form can be applied. The present invention is not limited to animals such as chicken, pig, monkey, dog, cat, rabbit, guinea pig, rat, mouse, cattle, sheep, goat and the like.

In another aspect, the present invention provides a method for preventing or treating pleural pneumonia, comprising administering the vaccine composition, the feed composition or the composition for feed addition to an animal other than a human.

In the method of the present invention, the animal is not limited to animals such as chickens, pigs, monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, For example, the animal is a pig.

In the present invention, the administration can be administered by any means known in the art. For example, the administration can be administered directly into an individual by intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. The administration may be systemically or locally administered.

In the method of the present invention, the composition of the present invention may be administered in a therapeutically or prophylactically effective amount. The " therapeutically or prophylactically effective amount " can be appropriately selected in consideration of the severity of symptoms, sex, age, weight and the like of a person skilled in the art. The therapeutically or prophylactically effective amount may be, for example, from 1 pg to 1 g of the fusion protein, the protein extract of the transformant or the recombinant protein isolated from the transformant per kg of the subject to be administered.

The present invention relates to a fusion protein comprising a fragment of Pleuropneumoniae ApxIA protein and a fragment of Plexpornium pneumoniae ApxIIA protein, wherein the N-terminal part of ApxIA, which is a structural protein of ApxI, among the components A, B, C and D of toxin ApxI A combination of ApxI and ApxII toxin was obtained by using a fusion protein L in which a partial protein of NA (1 to 380 amino acids) and F # 5 (439 to 801 amino acids), a partial protein of ApxIIA, a structural protein of ApxII toxin, As well as the serotype 2 of pleuropneumoniae having a combination of ApxII and ApxIII toxin as well as the serotype 1 of pleural effusions having pleural effusion .

Figure 1 shows the PCR results of genes NA, F # 5, and L.
Fig. 2 shows an amino acid sequence based on the nucleotide sequence of the gene L. Fig. The red letter is the GS linker, the amino acid located before the GS linker corresponds to NA, and the amino acid located after the GS linker represents the F # 5 part.
Figure 3 shows the expression results of protein NA, F # 5, and L as a result of western blot analysis.
Fig. 4 shows the result of purifying protein L with Ni-NTA resin.

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those skilled in the art can easily carry out the present invention. The present invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

Example  One: Actino Bacillus Flour Pneumonia  Type 1 ( APP1 ) Culture and gene extraction

0.01% NAD (Nicotinamide adenine dinucleotide) was added to BHI (brain-heart infusion) medium and APP1 was cultured at 37 ° C and 200 rpm. For subsequent cloning, genes were extracted from APP1.

Example  2: APP1's  NA gene and F # 5 gene fusion and Cloning

The gene prepared in Example 1 was used as a template, and primers of Table 1 were used to amplify gene NA and F # 5. Primers for these genes are shown in Table 1. This corresponds to the GS linker, which is a bolded part.

Primer list Name Sequence Tm (GSP) BamHI NA F CCG ATGGCTAACTCTCAGCTCGA GGATCC (SEQ ID NO: 8) 58.4 GS NA R ACTACCACTTCCACCTCCACCACTACCTCCACCTCCACTTCC AGCCCCAACACCTGCGGA (SEQ ID NO: 9) 60.7 GS F # 5 F GGAAGTGGAGGTGGAGGTAGTGGTGGAGGTGGAAGTGGTAGT CAAGGTTATGATTCTCGTCA (SEQ ID NO: 10) 54 SalI F # 5 R CCG GTCGAC TTATGTAATAGAATCATTTCCATCG (SEQ ID NO: 11) 54.7 Boulder - GS linker

The amplified NA and F # 5 genes were ligated through a GS linker to produce a gene L in which NA and F # 5 were fused and confirmed by electrophoresis (FIG. 1). Figure 1 shows the PCR results of genes NA, F # 5, and L. Using T4 ligase, NA, F # 5 and their fusion gene L were ligated to the expression vector pET-28a, respectively. PET-28a, which is an expression vector, was designed to allow 6xHis tag to be attached to the N-terminal part of the protein when expressing the protein. After that, western blot and protein purification were performed.

Example  3: Transformation of an expression vector containing a fusion gene into E. coli

The vector constructed in Example 2 was transformed into the expression strain BL21 (DE3) by heat shock transformation. It was confirmed by gene sequencing that the gene was properly inserted into the expression vector. It was confirmed that the gene was composed of the nucleotide sequence of SEQ ID NO: 5, and the amino acid sequence was confirmed based on the nucleotide sequence. As a result, it was confirmed that the gene had the amino acid sequence of SEQ ID NO: (Fig. 2). Fig. 2 shows an amino acid sequence based on the nucleotide sequence of the fusion gene L. Fig. The red letter is the GS linker, the front part of the GS linker corresponds to NA, and the rear part of the GS linker represents F # 5.

Example  4: Expression of Recombinant Protein

The expression strain constructed in Example 2 was inoculated into 10 ml of LB broth containing kanamycin (50 ug / ml) and chloramphenicol (34 ug / ml) and then overnight incubated in a 37 ° C shaking incubator. The next day, the cells were inoculated 1% in 400 ml LB broth containing kanamycin (50 ug / ml) and chloramphenicol (34 ug / ml) and cultured at 37 캜 in a shaking incubator until the OD value reached 0.6. Thereafter, 1Mm of IPTG was treated and further cultured for 4 hours in a 37 DEG C shaking incubator. 1 ml of the cultured mycelial solution was recovered, the pellet was dissolved in 100 μl of PBS, and the sample prepared by boiling in 5 × sample buffer was subjected to western blotting to confirm the expression of the recombinant protein (FIG. 3). Figure 3 shows the expression results of protein NA, F # 5, and fusion protein L as a result of western blot analysis.

Example  5: Purification of recombinant proteins

400 ml of the expression strain cultured in Example 4 was washed with PBS, and then the microorganism was disrupted by ultrasonic sonication. The soluble and inclusion body compartments were separated by centrifugation at 10,000 rpm and 4 ° C for 15 minutes and the water-insoluble compartment was resuspended in binding buffer (8 M urea, 300 mM sodium chloride , 50 mM monosodium phosphate, 10 mM imidazole). The supernatant was obtained by centrifugation at 12,000 rpm at 4 ° C for 20 minutes after dissolving the non-aqueous compartment in the binding buffer. Protein purification was performed by FPLC (Fast Protein Liquid Chromatography). Ni-NTA resin was used by using the property that 6xHis attached to the protein binds to the nickel ion. After purification, the proteins removed urea and imidazole through dialysis. The purified fusion protein L was confirmed by SDS-PAGE (Fig. 4). Figure 4 shows the result of purification of the fusion protein L with Ni-NTA resin.

Example  6: Immunity test in mice for vaccine efficacy verification

1) Toxoid vaccination in experimental animals

30 experimental mice (BALB / c) were divided into a vaccination group and a control group. As shown in Table 2, experimental vaccine groups were divided into NA vaccine group, F # 5 vaccine group and L vaccine group, respectively. In each experimental group, these toxoid vaccines were inoculated at 25 ug / dose each, and carbopol was used as an adjuvant.

2) Confirmation of toxoid vaccine defense effect in experimental animals

17 days after the vaccination, the protective effect of the toxoid vaccine was confirmed through the inoculation of Actinobacillus fluorescens (Type 1) (APP1) and Actinobacillus fluorescens (Type 2) (APP2). The NA vaccine was assumed to have a protective effect against Actinobacillus flourneumoniae type 1 (APP1) by defending ApxIA, and the F # 5 vaccine defended ApxIIA, Type (APP2). L vaccine was vaccinated with NA and F # 5 fusion protein, and it was expected to have a protective effect against both APP1 and APP2. In order to demonstrate the effect of the vaccine predicted above, experiments were conducted as shown in Tables 2 and 3.

As shown in Table 3, it was confirmed that L vaccine had a protective effect against two serotypes of APP1 and APP2. In addition, the L vaccine was confirmed to have a 2-fold higher ER against APP1 than the NA alone vaccine.

Specifically, serotype 1 of pleural effusions has a combination of ApxIA and ApxIIA, while Serotype 2 of Pleuropneumonia has a combination of ApxIIA and ApxIIIA. When NA, a partial protein of N-terminal part of ApxIA, was used as a vaccine, the protective effect against APP serotype 1 was only 40%. However, when F # 5, a part of ApxIIA, was used as a vaccine, It was confirmed that the defense effect was 100%. In addition, in the case of the fusion vaccine L in which the NA as a part of the N terminus of ApxIA and the F # 5 as a part of ApxIIA were fused, it was confirmed that the protective effect against APP serotype 1 was 80%, which is superior to the NA vaccine.

In addition, the fusion vaccine L has a superior defense effect against the APP2 serotype, so that the fusion vaccine can be used to protect APP serotype 1 and 2.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, Of the right.

&Lt; 110 > KBNP, Inc. <120> Vaccine composition for preventing or treating porcine          pleuropneumonia <130> DP20170125 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 380 <212> PRT <213> Actinobacillus pleuropneumoniae <220> <221> PEPTIDE <222> (1) <223> NA <400> 1 Met Ala Asn Ser Gln Leu Asp Arg Val Lys Gly Leu Ile Asp Ser Leu   1 5 10 15 Asn Gln His Thr Lys Ser Ala Ala Lys Ser Gly Ala Gly Ala Leu Lys              20 25 30 Asn Gly Leu Gly Gln Val Lys Gln Ala Gly Gln Lys Leu Ile Leu Tyr          35 40 45 Ile Pro Lys Asp Tyr Gln Ala Ser Thr Gly Ser Ser Leu Asn Asp Leu      50 55 60 Val Lys Ala Ala Glu Ala Leu Gly Ile Glu Val His Arg Ser Glu Lys  65 70 75 80 Asn Gly Thr Ala Leu Ala Lys Glu Leu Phe Gly Thr Thr Glu Lys Leu                  85 90 95 Leu Gly Phe Ser Glu Arg Gly Ile Ala Leu Phe Ala Pro Gln Phe Asp             100 105 110 Lys Leu Leu Asn Lys Asn Gln Lys Leu Ser Lys Ser Leu Gly Gly Ser         115 120 125 Ser Glu Ala Leu Gly Gln Arg Leu Asn Lys Thr Gln Thr Ala Leu Ser     130 135 140 Ala Leu Gln Ser Phe Leu Gly Thr Ala Ile Ala Gly Met Asp Leu Asp 145 150 155 160 Ser Leu Leu Arg Arg Arg Asn Gly Glu Asp Val Ser Gly Ser Glu                 165 170 175 Leu Ala Lys Ala Gly Val Asp Leu Ala Ala Gln Leu Val Asp Asn Ile             180 185 190 Ala Ser Ala Thr Gly Thr Val Asp Ala Phe Ala Glu Gln Leu Gly Lys         195 200 205 Leu Gly Asn Ala Leu Ser Asn Thr Arg Leu Ser Gly Leu Ala Ser Lys     210 215 220 Leu Asn Asn Leu Pro Asp Leu Ser Leu Ala Gly Pro Gly Phe Asp Ala 225 230 235 240 Val Ser Gly Ile Leu Ser Val Ser Ser Ala Ser Phe Ile Leu Ser Asn                 245 250 255 Lys Asp Ala Asp Ala Gly Thr Lys Ala Ala Ala Gly Ile Glu Ile Ser             260 265 270 Thr Lys Ile Leu Gly Asn Ile Gly Lys Ala Val Ser Gln Tyr Ile Ile         275 280 285 Ala Gln Arg Val Ala Ala Gly Leu Ser Thr Ala Ala Thr Gly Gly     290 295 300 Leu Ile Gly Ser Val Val Ala Leu Ala Ile Ser Pro Leu Ser Phe Leu 305 310 315 320 Asn Val Ala Asp Lys Phe Glu Arg Ala Lys Gln Leu Glu Gln Tyr Ser                 325 330 335 Glu Arg Phe Lys Lys Phe Gly Tyr Glu Gly Asp Ser Leu Leu Ala Ser             340 345 350 Phe Tyr Arg Glu Thr Gly Ala Ile Glu Ala Ala Leu Thr Thr Ile Asn         355 360 365 Ser Val Leu Ser Ala Ala Ser Ala Gly Val Gly Ala     370 375 380 <210> 2 <211> 363 <212> PRT <213> Actinobacillus pleuropneumoniae <220> <221> PEPTIDE <222> (1) <223> F # 5 <400> 2 Gln Gly Tyr Asp Ser Arg His Leu Ala Asp Leu Gln Asp Asn Met Lys   1 5 10 15 Phe Leu Ile Asn Leu Asn Lys Glu Leu Gln Ala Glu Arg Val Val Ala              20 25 30 Ile Thr Gln Gln Arg Trp Asp Asn Gln Ile Gly Asp Leu Ala Ala Ile          35 40 45 Ser Arg Arg Thr Asp Lys Ile Ser Ser Gly Lys Ala Tyr Val Asp Ala      50 55 60 Phe Glu Glu Gly Gln His Gln Ser Tyr Asp Ser Ser Val Gln Leu Asp  65 70 75 80 Asn Lys Asn Gly Ile Ile Asn Ile Ser Asn Thr Asn Arg Lys Thr Gln                  85 90 95 Ser Val Leu Phe Arg Thr Pro Leu Leu Thr Pro Gly Glu Glu Asn Arg             100 105 110 Glu Arg Ile Gln Glu Gly Lys Asn Ser Tyr Ile Thr Lys Leu His Ile         115 120 125 Gln Arg Val Asp Ser Trp Thr Val Thr Asp Gly Asp Ser Ser Ser Ser     130 135 140 Val Asp Phe Thr Asn Val Val Gln Arg Ile Ala Val Lys Phe Asp Asp 145 150 155 160 Ala Gly Asn Ile Ile Glu Ser Lys Asp Thr Lys Ile Ile Ala Asn Leu                 165 170 175 Gly Ala Gly Asn Asp Asn Val Phe Val Gly Ser Ser Thr Thr Val Ile             180 185 190 Asp Gly Gly Asp Gly His Asp Arg Val His Tyr Ser Arg Gly Glu Tyr         195 200 205 Gly Ala Leu Val Ile Asp Ala Thr Ala Glu Thr Glu Lys Gly Ser Tyr     210 215 220 Ser Val Lys Arg Tyr Val Gly Asp Ser Lys Ala Leu His Glu Thr Ile 225 230 235 240 Ala Thr His Gln Thr Asn Val Gly Asn Arg Glu Glu Lys Ile Glu Tyr                 245 250 255 Arg Arg Glu Asp Asp Arg Phe His Thr Gly Tyr Thr Val Thr Asp Ser             260 265 270 Leu Lys Ser Val Glu Glu Ile Ile Gly Ser Gln Phe Asn Asp Ile Phe         275 280 285 Lys Gly Ser Gln Phe Asp Asp Val Phe His Gly Gly Asn Gly Val Asp     290 295 300 Thr Ile Asp Gly Asn Asp Gly Asp Asp His Leu Phe Gly Gly Ala Gly 305 310 315 320 Asp Asp Val Ile Asp Gly Gly Asn Gly Asn Asn Phe Leu Val Gly Gly                 325 330 335 Thr Gly Asn Asp Ile Ile Ser Gly Gly Lys Asp Asn Asp Ile Tyr Val             340 345 350 His Lys Thr Gly Asp Gly Asn Asp Ser Ile Thr         355 360 <210> 3 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> GS LINKER <400> 3 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Ser Gly Ser   1 5 10 <210> 4 <211> 757 <212> PRT <213> Artificial Sequence <220> <223> fusion protein L <400> 4 Met Ala Asn Ser Gln Leu Asp Arg Val Lys Gly Leu Ile Asp Ser Leu   1 5 10 15 Asn Gln His Ile Lys Ser Ala Ala Lys Ser Gly Ala Gly Ala Leu Lys              20 25 30 Asn Gly Leu Gly Glu Gln Val Lys Gln Ala Gly Gln Glu Leu Ile Leu Tyr          35 40 45 Ile Pro Lys Asp Tyr Gln Ala Ser Thr Gly Ser Ser Leu Asn Asp Leu      50 55 60 Val Lys Ala Ala Glu Ala Leu Gly Ile Glu Val His Arg Ser Glu Lys  65 70 75 80 Asn Gly Thr Ala Leu Ala Lys Glu Leu Phe Gly Thr Thr Glu Lys Leu                  85 90 95 Leu Gly Phe Ser Glu Arg Gly Ile Ala Leu Phe Ala Pro Gln Phe Asp             100 105 110 Lys Leu Leu Asn Lys Asn Gln Lys Leu Ser Lys Ser Leu Gly Gly Ser         115 120 125 Ser Glu Ala Leu Gly Gln Arg Leu Asn Lys Thr Gln Thr Ala Leu Ser     130 135 140 Ala Leu Gln Ser Phe Leu Gly Thr Ala Ile Ala Gly Met Asp Leu Asp 145 150 155 160 Ser Leu Leu Arg Arg Arg Asn Gly Glu Asp Val Ser Gly Ser Glu                 165 170 175 Leu Ala Lys Ala Gly Val Asp Leu Ala Ala Gln Leu Val Asp Asn Ile             180 185 190 Ala Ser Ala Thr Gly Thr Val Asp Ala Phe Ala Glu Gln Leu Gly Lys         195 200 205 Leu Gly Asn Ala Leu Ser Asn Thr Arg Leu Ser Gly Leu Ala Ser Lys     210 215 220 Leu Asn Asn Leu Pro Asp Leu Ser Leu Ala Gly Pro Gly Phe Asp Ala 225 230 235 240 Val Ser Gly Ile Leu Ser Val Ser Ser Ala Ser Phe Ile Leu Ser Asn                 245 250 255 Lys Asp Ala Asp Ala Gly Thr Lys Ala Ala Ala Gly Ile Glu Ile Ser             260 265 270 Thr Lys Ile Leu Gly Asn Ile Gly Lys Ala Val Ser Gln Tyr Ile Ile         275 280 285 Ala Gln Arg Val Ala Ala Gly Leu Ser Thr Ala Ala Thr Gly Gly     290 295 300 Leu Ile Gly Ser Val Val Ala Leu Ala Ile Ser Pro Leu Ser Phe Leu 305 310 315 320 Asn Val Ala Asp Lys Phe Glu Arg Ala Lys Gln Leu Glu Gln Tyr Ser                 325 330 335 Glu Arg Phe Lys Lys Phe Gly Tyr Glu Gly Asp Ser Leu Leu Ala Ser             340 345 350 Phe Tyr Arg Glu Thr Gly Ala Ile Glu Ala Ala Leu Thr Thr Ile Asn         355 360 365 Ser Val Leu Ser Ala Ala Ser Aly Gly Val Gly Ala Gly Ser Gly Gly     370 375 380 Gly Gly Ser Gly Gly Gly Gly Ser Gly Ser Gln Gly Tyr Asp Ser Arg 385 390 395 400 His Leu Ala Asp Leu Gln Asp Asn Met Lys Phe Leu Ile Asn Leu Asn                 405 410 415 Lys Glu Leu Gln Ala Glu Arg Val Val Ala Ile Thr Gln Gln Arg Trp             420 425 430 Asp Asn Gln Ile Gly Asp Leu Ala Ala Ile Ser Arg Arg Thr Asp Lys         435 440 445 Ile Ser Ser Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly GInt His     450 455 460 Gln Ser Tyr Asp Ser Ser Val Gln Leu Asp Asn Lys Asn Gly Ile Ile 465 470 475 480 Asn Ile Ser Asn Thr Asn Arg Lys Thr Gln Ser Val Leu Phe Arg Thr                 485 490 495 Pro Leu Leu Thr Pro Gly Glu Glu Asn Arg Glu Arg Ile Gln Glu Gly             500 505 510 Lys Asn Ser Tyr Ile Thr Lys Leu His Ile Gln Arg Val Asp Ser Trp         515 520 525 Thr Val Thr Asp Gly Asp Ala Ser Ser Ser Val Asp Phe Thr Asn Val     530 535 540 Val Gln Arg Ile Ala Val Lys Phe Asp Asp Ala Gly Asn Ile Ile Glu 545 550 555 560 Ser Lys Asp Thr Lys Ile Ile Ala Asn Leu Gly Ala Gly Asn Asp Asn                 565 570 575 Val Phe Val Gly Ser Ser Thr Thr Val Ile Asp Gly Gly Asp Gly His             580 585 590 Asp Arg Val His Tyr Ser Arg Gly Glu Tyr Gly Ala Leu Val Ile Asp         595 600 605 Ala Thr Ala Glu Thr Glu Lys Gly Ser Tyr Ser Val Lys Arg Tyr Val     610 615 620 Gly Asp Ser Lys Ala Leu His Glu Thr Ile Ala Thr His Gln Thr Asn 625 630 635 640 Val Gly Asn Arg Glu Glu Lys Ile Glu Tyr Arg Arg Glu Asp Asp Arg                 645 650 655 Phe His Thr Gly Tyr Thr Val Thr Asp Ser Leu Lys Ser Val Glu Glu             660 665 670 Ile Ile Gly Ser Gln Phe Asn Asp Ile Phe Lys Gly Ser Gln Phe Asp         675 680 685 Asp Val Phe His Gly Gly Asn Gly Val Asp Thr Ile Asp Gly Asn Asp     690 695 700 Gly Asp Asp His Leu Phe Gly Gly Ala Gly Asp Asp Val Ile Asp Gly 705 710 715 720 Gly Asn Gly Asn Asn Phe Leu Val Gly Gly Thr Gly Asn Asp Ile Ile                 725 730 735 Ser Gly Gly Lys Asp Asn Asp Ile Tyr Val His Lys Thr Gly Asp Gly             740 745 750 Asn Asp Ser Ile Thr         755 <210> 5 <211> 2274 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of fusion protein L <400> 5 atggctaact ctcagctcga tagagtcaaa ggattgattg attcacttaa tcaacatata 60 aaaagtgcag ctaaatcagg tgccggcgca ttaaaaaatg gtttgggaca ggtgaagcaa 120 gcagggcagg aattaatttt atatattccg aaagattatc aagctagtac cggctcaagt 180 cttaatgatt tagtgaaagc ggcggaggct ttagggatcg aagtacatcg ctcggaaaaa 240 aacggtaccg cactagcgaa agaattattc ggtacaacgg aaaaactatt aggtttctcg 300 gaacgaggca tcgcattatt tgcacctcag tttgataagt tactgaataa gaaccaaaaa 360 ttaagtaaat cgctcggcgg ttcatcggaa gcattaggac aacgtttaaa taaaacgcaa 420 acggcacttt cagccttaca aagtttctta ggtacggcta ttgcgggtat ggatcttgat 480 agcctgcttc gtcgccgtag aaacggtgag gacgtcagtg gttcggaatt agctaaagcg 540 ggtgtggatc tagccgctca gttagtggat aacattgcaa gtgcaacggg tacggtggat 600 gcgtttgccg aacaattagg taaattgggc aatgccttat ctaacactcg cttaagcggt 660 ttagcaagta agttaaataa ccttccagat ttaagccttg caggacctgg gtttgatgcc 720 gtatcaggta tcttatctgt tgtttcggct tcattcattt taagtaataa agatgccgat 780 gcaggtacaa aagcggcggc aggtattgaa atctcaacta aaatcttagg caatatcggt 840 aaagcggttt ctcaatatat tattgcgcaa cgtgtggcgg caggcttatc cacaactgcg 900 gcaaccggtg gtttaatcgg ttcggtcgta gcattagcga ttagcccgct ttcgttctta 960 aatgttgcgg ataagtttga acgtgcgaaa cagcttgaac aatattcgga gcgctttaaa 1020 aagttcggtt atgaaggtga tagtttatta gcttcattct accgtgaaac cggtgcgatt 1080 gaagcggcat taaccacgat taacagtgtg ttaagtgcgg cttccgcagg tgttggggct 1140 ggaagtggag gtggaggtag tggtggaggt ggaagtggta gtcaaggtta tgattctcgt 1200 catttagctg atttacaaga caatatgaag tttcttatca atttaaataa agaacttcag 1260 gctgaacgcg tagtagctat tacccaacaa agatgggata accaaattgg agacctagcg 1320 gcaattagcc gtagaacgga taaaatttcc agtggaaaag cttatgtgga tgcttttgag 1380 gaggggcaac accagtccta cgattcatcc gtacagctag ataacaaaaa cggtattatt 1440 aatattagta atacaaatag aaagacacaa agtgttttat tcagaactcc attactaact 1500 ccaggtgaag agaatcggga acgtattcag gaaggtaaaa attcttatat tacaaaatta 1560 catatacaaa gagttgacag ttggactgta acagatggtg atgctagctc aagcgtagat 1620 ttcactaatg tagtacaacg aatcgctgtg aaatttgatg atgcaggtaa cattatagaa 1680 tctaaagata ctaaaattat cgcaaattta ggtgctggta acgataatgt atttgttggg 1740 tcaagtacta ccgttattga tggcggggac ggacatgatc gagttcacta cagtagagga 1800 gaatatggcg cattagttat tgatgctaca gccgagacag aaaaaggctc atattcagta 1860 aaacgctatg tcggagacag taaagcatta catgaaacaa ttgccaccca ccaaacaaat 1920 gttggtaatc gtgaagaaaa aattgaatat cgtcgtgaag atgatcgttt tcatactggt 1980 tatactgtga cggactcact caaatcagtt gaagagatca ttggttcaca atttaatgat 2040 attttcaaag gaagccaatt tgatgatgtg ttccatggtg gtaatggtgt agacactatt 2100 gatggtaacg atggtgacga tcatttattt ggtggcgcag gcgatgatgt tatcgatgga 2160 ggaaacggta acaatttcct tgttggagga accggtaatg atattatctc gggaggtaaa 2220 gataatgata tttatgtcca taaaacaggc gatggaaatg attctattac ataa 2274 <210> 6 <211> 1022 <212> PRT <213> Actinobacillus pleuropneumoniae <220> <221> PEPTIDE <222> (1) <223> ApxIA <400> 6 Met Ala Asn Ser Gln Leu Asp Arg Val Lys Gly Leu Ile Asp Ser Leu   1 5 10 15 Asn Gln His Thr Lys Ser Ala Ala Lys Ser Gly Ala Gly Ala Leu Lys              20 25 30 Asn Gly Leu Gly Gln Val Lys Gln Ala Gly Gln Lys Leu Ile Leu Tyr          35 40 45 Ile Pro Lys Asp Tyr Gln Ala Ser Thr Gly Ser Ser Leu Asn Asp Leu      50 55 60 Val Lys Ala Ala Glu Ala Leu Gly Ile Glu Val His Arg Ser Glu Lys  65 70 75 80 Asn Gly Thr Ala Leu Ala Lys Glu Leu Phe Gly Thr Thr Glu Lys Leu                  85 90 95 Leu Gly Phe Ser Glu Arg Gly Ile Ala Leu Phe Ala Pro Gln Phe Asp             100 105 110 Lys Leu Leu Asn Lys Asn Gln Lys Leu Ser Lys Ser Leu Gly Gly Ser         115 120 125 Ser Glu Ala Leu Gly Gln Arg Leu Asn Lys Thr Gln Thr Ala Leu Ser     130 135 140 Ala Leu Gln Ser Phe Leu Gly Thr Ala Ile Ala Gly Met Asp Leu Asp 145 150 155 160 Ser Leu Leu Arg Arg Arg Asn Gly Glu Asp Val Ser Gly Ser Glu                 165 170 175 Leu Ala Lys Ala Gly Val Asp Leu Ala Ala Gln Leu Val Asp Asn Ile             180 185 190 Ala Ser Ala Thr Gly Thr Val Asp Ala Phe Ala Glu Gln Leu Gly Lys         195 200 205 Leu Gly Asn Ala Leu Ser Asn Thr Arg Leu Ser Gly Leu Ala Ser Lys     210 215 220 Leu Asn Asn Leu Pro Asp Leu Ser Leu Ala Gly Pro Gly Phe Asp Ala 225 230 235 240 Val Ser Gly Ile Leu Ser Val Ser Ser Ala Ser Phe Ile Leu Ser Asn                 245 250 255 Lys Asp Ala Asp Ala Gly Thr Lys Ala Ala Ala Gly Ile Glu Ile Ser             260 265 270 Thr Lys Ile Leu Gly Asn Ile Gly Lys Ala Val Ser Gln Tyr Ile Ile         275 280 285 Ala Gln Arg Val Ala Ala Gly Leu Ser Thr Ala Ala Thr Gly Gly     290 295 300 Leu Ile Gly Ser Val Val Ala Leu Ala Ile Ser Pro Leu Ser Phe Leu 305 310 315 320 Asn Val Ala Asp Lys Phe Glu Arg Ala Lys Gln Leu Glu Gln Tyr Ser                 325 330 335 Glu Arg Phe Lys Lys Phe Gly Tyr Glu Gly Asp Ser Leu Leu Ala Ser             340 345 350 Phe Tyr Arg Glu Thr Gly Ala Ile Glu Ala Ala Leu Thr Thr Ile Asn         355 360 365 Ser Val Aly Ala Ala Aly Aly Aly Aly Thr Gly     370 375 380 Ser Leu Val Gly Ala Le Val Ser Ala Ile Thr Gly 385 390 395 400 Ile Ile Ser Gly Ile Leu Asp Ala Ser Lys Gln Ala Ile Phe Glu Arg                 405 410 415 Val Ala Thr Lys Leu Ala Asn Lys Ile Asp Glu Trp Glu Lys Lys His             420 425 430 Gly Lys Asn Tyr Phe Glu Asn Gly Tyr Asp Ala Arg His Ser Ala Phe         435 440 445 Leu Glu Asp Thr Phe Glu Leu Leu Ser Gln Tyr Asn Lys Glu Tyr Ser     450 455 460 Val Glu Arg Val Val Ala Ile Thr Gln Gln Arg Trp Asp Val Asn Ile 465 470 475 480 Gly Glu Leu Ala Gly Ile Thr Arg Lys Gly Ala Asp Ala Lys Ser Gly                 485 490 495 Lys Ala Tyr Val Asp Phe Phe Glu Glu Gly Lys Leu Leu Glu Lys Asp             500 505 510 Pro Asp Arg Phe Asp Lys Lys Val Phe Asp Pro Leu Glu Gly Lys Ile         515 520 525 Asp Leu Ser Ser Ile Asn Lys Thr Thr Leu Leu Lys Phe Ile Thr Pro     530 535 540 Val Phe Thr Ala Gly Glu Glu Ile Arg Glu Arg Lys Gln Thr Gly Lys 545 550 555 560 Tyr Glu Tyr Met Thr Glu Leu Phe Val Lys Gly Lys Glu Lys Trp Val                 565 570 575 Val Thr Gly Val Gln Ser His Asn Ale Ile Tyr Asp Tyr Thr Asn Leu             580 585 590 Ile Gln Leu Ala Ile Asp Lys Lys Gly Glu Lys Arg Gln Val Thr Ile         595 600 605 Glu Ser His Leu Gly Glu Lys Asn Asp Arg Ile Tyr Leu Ser Ser Gly     610 615 620 Ser Ser Ile Val Tyr Ala Gly Asn Gly His Asp Val Ala Tyr Tyr Asp 625 630 635 640 Lys Thr Asp Thr Gly Tyr Leu Thr Phe Asp Gly Gln Ser Ala Gln Lys                 645 650 655 Ala Gly Glu Tyr Ile Val Thr Lys Glu Leu Lys Ala Asp Val Lys Val             660 665 670 Leu Lys Glu Val Val Lys Thr Gln Asp Ile Ser Val Gly Lys Arg Ser         675 680 685 Glu Lys Leu Glu Tyr Arg Asp Tyr Glu Leu Ser Pro Phe Glu Leu Gly     690 695 700 Asn Gly Ile Arg Ala Lys Asp Glu Leu His Ser Val Glu Glu Ile Ile 705 710 715 720 Gly Ser Asn Arg Lys Asp Lys Phe Phe Gly Ser Arg Phe Thr Asp Ile                 725 730 735 Phe His Gly Ala Lys Gly Asp Asp Glu Ile Tyr Gly Asn Asp Gly His             740 745 750 Asp Ile Leu Tyr Gly Asp Asp Gly Asn Asp Val Ile His Gly Gly Asp         755 760 765 Gly Asn Asp His Leu Val Gly Gly Asn Gly Asn Asp Arg Leu Ile Gly     770 775 780 Gly Lys Gly Asn Asn Phe Leu Asn Gly Gly Asp Gly Asp Asp Glu Leu 785 790 795 800 Gln Val Phe Glu Gly Gln Tyr Asn Val Leu Leu Gly Gly Ala Gly Asn                 805 810 815 Asp Ile Leu Tyr Gly Ser Asp Gly Thr Asn Leu Phe Asp Gly Gly Val             820 825 830 Gly Asn Asp Lys Ile Tyr Gly Gly Leu Gly Lys Asp Ile Tyr Arg Tyr         835 840 845 Ser Lys Glu Tyr Gly Arg His Ile Ile Glu Lys Gly Gly Asp Asp     850 855 860 Asp Thr Leu Leu Leu Ser Asp Leu Ser Phe Lys Asp Val Gly Phe Ile 865 870 875 880 Arg Ile Gly Asp Asp Leu Leu Val Asn Lys Arg Ile Gly Gly Thr Leu                 885 890 895 Tyr Tyr His Glu Asp Tyr Asn Gly Asn Ala Leu Thr Ile Lys Asp Trp             900 905 910 Phe Lys Glu Gly Lys Glu Gly Gln Asn Asn Lys Ile Glu Lys Ile Val         915 920 925 Asp Lys Asp Gly Ala Tyr Val Leu Ser Gln Tyr Leu Thr Glu Leu Thr     930 935 940 Ala Pro Gly Arg Gly Ile Asn Tyr Phe Asn Gly Leu Glu Glu Lys Leu 945 950 955 960 Tyr Tyr Gly Glu Gly Tyr Asn Ala Leu Pro Gln Leu Arg Lys Asp Ile                 965 970 975 Glu Gln Ile Ile Ser Ser Thr Gly Ala Leu Thr Gly Glu His Gly Gln             980 985 990 Val Leu Val Gly Ala Gly Gly Pro Leu Aly Tyr Ser Asn Ser Pro Asn         995 1000 1005 Ser Ile Pro Asn Ala Phe Ser Asn Tyr Leu Thr Gln Ser Ala    1010 1015 1020 <210> 7 <211> 956 <212> PRT <213> Actinobacillus pleuropneumoniae <220> <221> PEPTIDE <222> (1) <223> ApxIIA <400> 7 Met Ser Lys Ile Thr Leu Ser Ser Leu Lys Ser Ser Leu Gln Gln Gly   1 5 10 15 Leu Lys Asn Gly Lys Asn Lys Leu Asn Gln Ala Gly Thr Thr Leu Lys              20 25 30 Asn Gly Leu Thr Gln Thr Gly His Ser Leu Gln Asn Gly Ala Lys Lys          35 40 45 Leu Ile Leu Tyr Ile Pro Gln Gly Tyr Asp Ser Gly Gln Gly Asn Gly      50 55 60 Val Gln Asp Leu Val Lys Ala Asn Asp Leu Gly Ile Glu Val Trp  65 70 75 80 Arg Glu Glu Arg Ser Asn Leu Asp Ile Ala Lys Thr Ser Phe Asp Thr                  85 90 95 Thr Gln Lys Ile Leu Gly Phe Thr Asp Arg Gly Ile Val Leu Phe Ala             100 105 110 Pro Gln Leu Asp Asn Leu Leu Lys Lys Asn Pro Lys Ile Gly Asn Thr         115 120 125 Leu Gly Ser Ala Ser Ser Ser Ser Gln Asn Ile Gly Lys Ala Asn Thr     130 135 140 Val Leu Gly Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ser Gly Val 145 150 155 160 Asn Leu Asn Glu Leu Leu Gln Asn Lys Asp Pro Asn Gln Leu Glu Leu                 165 170 175 Ala Lys Ala Gly Leu Glu Leu Thr Asn Glu Leu Val Gly Asn Ile Ala             180 185 190 Ser Ser Val Gln Thr Val Asp Ala Phe Ala Glu Gln Ile Ser Lys Leu         195 200 205 Gly Ser His Leu Gln Asn Val Lys Gly Leu Gly Gly Leu Ser Asn Lys     210 215 220 Leu Gln Asn Leu Pro Asp Leu Gly Lys Ala Ser Leu Gly Leu Asp Ile 225 230 235 240 Ile Ser Gly Leu Leu Ser Gly Ala Ser Ala Gly Leu Ile Leu Ala Asp                 245 250 255 Lys Glu Ala Ser Thr Glu Lys Lys Ala Ala Ala Gly Val Glu Phe Ala             260 265 270 Asn Gln Ile Ile Gly Asn Val Thr Lys Ala Val Ser Ser Tyr Ile Leu         275 280 285 Ala Gln Arg Val Ala Ser Gly Leu Ser Ser Thr Gly Pro Ala     290 295 300 Leu Ile Ala Ser Thr Val Ala Leu Ala Val Ser Pro Leu Ser Phe Leu 305 310 315 320 Asn Val Ala Asp Lys Phe Lys Gln Ala Asp Leu Ile Lys Ser Tyr Ser                 325 330 335 Glu Arg Phe Gln Lys Leu Gly Tyr Asp Gly Asp Arg Leu Leu Ala Asp             340 345 350 Phe His Arg Glu Thr Gly Thr Ile Asp Ala Ser Val Thr Thr Ile Asn         355 360 365 Thr Ala Leu Ala Ala Ile Ser Gly     370 375 380 Ser Leu Val Gly Ala Pro Val Ala Leu Leu Val Ala Gly Val Thr Gly 385 390 395 400 Leu Ile Thr Thr Ile Leu Glu Tyr Ser Lys Gln Ala Met Phe Glu His                 405 410 415 Val Ala Asn Lys Val His Asp Arg Ile Val Glu Trp Glu Lys Lys His             420 425 430 Asn Lys Asn Tyr Phe Glu Gln Gly Tyr Asp Ser Arg His Leu Ala Asp         435 440 445 Leu Gln Asp Asn Met Lys Phe Leu Ile Asn Leu Asn Lys Glu Leu Gln     450 455 460 Ala Glu Arg Val Val Ala Ile Thr Gln Gln Arg Trp Asp Asn Gln Ile 465 470 475 480 Gly Asp Leu Ala Ala Ile Ser Arg Arg Thr Asp Lys Ile Ser Ser Gly                 485 490 495 Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Gln His Gln Ser Tyr Asp             500 505 510 Ser Ser Val Gln Leu Asp Asn Lys Asn Gly Ile Ile Asn Ile Ser Asn         515 520 525 Thr Asn Arg Lys Thr Gln Ser Val Leu Phe Arg Thr Pro Leu Leu Thr     530 535 540 Pro Gly Glu Glu Asn Arg Glu Arg Ile Gln Glu Gly Lys Asn Ser Tyr 545 550 555 560 Ile Thr Lys Leu His Ile Gln Arg Val Asp Ser Trp Thr Val Thr Asp                 565 570 575 Gly Asp Ala Ser Ser Ser Val Asp Phe Thr Asn Val Val Gln Arg Ile             580 585 590 Ala Val Lys Phe Asp Asp Ala Gly Asn Ile Ile Glu Ser Lys Asp Thr         595 600 605 Lys Ile Ile Ala Asn Leu Gly Ala Gly Asn Asp Asn Val Phe Val Gly     610 615 620 Ser Ser Thr Thr Val Ile Asp Gly Gly Asp Gly His Asp Arg Val His 625 630 635 640 Tyr Ser Arg Gly Glu Tyr Gly Ala Leu Val Ile Asp Ala Thr Ala Glu                 645 650 655 Thr Glu Lys Gly Ser Tyr Ser Val Lys Arg Tyr Val Gly Asp Ser Lys             660 665 670 Ala Leu His Glu Thr Ile Ala Thr His Gln Thr Asn Val Gly Asn Arg         675 680 685 Glu Glu Lys Ile Glu Tyr Arg Arg Glu Asp Asp Arg Phe His Thr Gly     690 695 700 Tyr Thr Val Thr Asp Ser Leu Lys Ser Val Glu Glu Ile Ile Gly Ser 705 710 715 720 Gln Phe Asn Asp Ile Phe Lys Gly Ser Gln Phe Asp Asp Val Phe His                 725 730 735 Gly Gly Asn Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asp Asp His             740 745 750 Leu Phe Gly Gly Asp Gly Asp Asp Val Ile Asp Gly Gly Asn Gly Asn         755 760 765 Asn Phe Leu Val Gly Gly Thr Gly Asn Asp Ile Ser Ser Gly Gly Lys     770 775 780 Asp Asn Asp Ile Tyr Val His Lys Thr Gly Asp Gly Asn Asp Ser Ile 785 790 795 800 Thr Asp Ser Gly Gly Gln Asp Lys Leu Ala Phe Ser Asp Val Asn Leu                 805 810 815 Lys Asp Leu Thr Phe Lys Lys Val Asp Ser Ser Leu Glu Ile Ile Asn             820 825 830 Gln Lys Gly Glu Lys Val Arg Ile Gly Asn Trp Phe Leu Glu Asp Asp         835 840 845 Leu Ala Ser Thr Val Ala Asn Tyr Lys Ala Thr Asn Asp Arg Lys Ile     850 855 860 Glu Glu Ile Ile Gly Lys Gly Gly Glu Glu Ile Thr Ser Glu Gln Val 865 870 875 880 Asp Lys Leu Ile Lys Glu Gly Asn Asn Gln Ile Ser Ala Glu Ala Leu                 885 890 895 Ser Lys Val Val Asn Asp Tyr Asn Thr Ser Lys Asp Arg Gln Asn Val             900 905 910 Ser Asn Ser Leu Ala Lys Leu Ile Ser Ser Val Gly Ser Phe Thr Ser         915 920 925 Ser Ser Asp Phe Arg Asn Asn Leu Gly Thr Tyr Val Ser Ser Ile     930 935 940 Asp Val Ser Asn Asn Ile Gln Leu Ala Arg Ala Ala 945 950 955 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BamHI NA Forward primer <400> 8 ccgggatcca tggctaactc tcagctcga 29 <210> 9 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> GS NA Reverse primer <400> 9 actaccactt ccacctccac cactacctcc acctccactt ccagccccaa cacctgcgga 60                                                                           60 <210> 10 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> GS F # 5 Forward primer <400> 10 ggaagtggag gtggaggtag tggtggaggt ggaagtggta gtcaaggtta tgattctcgt 60 ca 62 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> SalI F # 5 Reverse primer <400> 11 ccggtcgact tatgtaatag aatcatttcc atcg 34

Claims (13)

A fusion protein comprising a fragment of Pleuropneumoniae ApxIA protein and a fragment of Plasmodium pneumoniae ApxIIA protein. The fusion protein according to claim 1, wherein the fragments of the Pleuropneumoniae ApxIA protein and the fragments of the Pleuropneumoniae ApxIIA protein are linked by a peptide linker. 2. The fusion protein of claim 1, wherein the fragment of Pleuropneumoniae ApxIA protein comprises the amino acid sequence of SEQ ID NO: 1. 2. The fusion protein of claim 1, wherein the fragment of Pleuropneumoniae ApxIIA protein comprises the amino acid sequence of SEQ ID NO: 2. 2. The fusion protein of claim 1, wherein the peptide linker comprises the amino acid sequence of SEQ ID NO: 3. 2. The fusion protein of claim 1, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 4. 7. A gene encoding the fusion protein of any one of claims 1 to 6. A recombinant vector comprising the gene of claim 7. A transformant transformed with the recombinant vector of claim 8. A vaccine composition for preventing or treating pleuropneumonia, comprising the fusion protein of claim 1, the protein extract of the transformant of claim 9, or the recombinant protein isolated from the transformant as an active ingredient. 9. A feed composition for preventing or improving pleuropneumonia, comprising the fusion protein of claim 1, the protein extract of the transformant of claim 9, or the recombinant protein isolated from the transformant as an active ingredient. A composition for preventing or improving pleural fluid pneumonia comprising the fusion protein of claim 1, a protein extract of the transformant of claim 9 or a recombinant protein isolated from the transformant as an active ingredient. 12. A method for preventing or treating pleural pneumonia, comprising administering the composition of any one of claims 10 to 12 to a mammal other than a human.

Images