KR20210115533A - Virus like particle for vaccines for the prevention of porcine epidemic diarrhea and method for preparing the same - Google Patents

Abstract

The present invention relates to a virus-like particle for vaccine for preventing porcine epidemic diarrhea and a preparing method thereof, and specifically, to a chimeric porcine epidemic diarrhea virus-like particle containing pr55 (Gag) protein of human immunodeficiency virus (HIV) and spike protein of porcine epidemic diarrhea virus (PEDV), a vaccine composition including the virus-like particle, a recombinant expression vector for preparing the chimeric porcine epidemic diarrhea virus-like particle, a host cell transformed with the recombinant expression vector, and a method for preparing a virus-like particle for vaccine for preventing or treating porcine epidemic diarrhea.

Description

Virus like particle for vaccines for the prevention of porcine epidemic diarrhea and method for preparing the same

The present invention relates to virus-like particles for vaccines for the prevention of swine epidemic diarrhea and a method for producing the same.

Porcine epidemic diarrhea (PED), which causes severe diarrhea and dehydration in pigs, is one of the important viral diseases that currently cause enormous financial damage to the pig industry in Asian countries including Korea, and is mainly transmitted in winter and early spring. It is a deadly disease that infects pigs of any age and causes acute diarrhea, with mortality rates reaching 100%, especially in newborn piglets and lactating pigs. In recent years, the risk is increasing, such as showing various patterns of outbreaks in most seasons.

Such PED was first reported in the UK in 1977, and was first confirmed in Korea in 1992. Porcine epidemic diarrhea virus (PEDV), which causes PED, is an enveloped, single-stranded RNA virus of about 28 Kb belonging to Coronaviridae that mutates very rapidly. Even though regular vaccinations are being carried out, effective prevention by vaccines has not been achieved.

PEDV is a spherical particle with a diameter of 95-100 nm, and the surface has a radially arranged 18-23 nm club-shaped surface projection. PEDV is composed of 7 ORFs, and consists of 3 nonstructural proteins ORF1a, ORF1b, ORF3 and structural proteins Membrane(M), Nucleocapsid(N), Envelope(E), and Spike(S). Among them, the Spike protein is a 150-220kDa type I transmembrane protein composed of signal peptide, S1 domain, CO-26K equivalent (COE), S2 domain, transmembrane region, and intra cellular domain, and it is a type I transmembrane protein with host cell junction and virus penetration. It is involved in the induction of the formation of neutralizing antibodies from cells and serves as a major immunogen. Membrane protein, which is most abundant in the virus envelope, and has a size of 27-32 kDa, is known to be an essential element for the formation of viral particles in the corona virus. Studies have been reported that the production of particles is possible. Nucleocapsid protein is 55-58kDa in size, and it is known that through interaction with membrane protein, the protein embedded in the membrane forms a structure and acts as a signal to go out of the cell.

On the other hand, despite the fact that PEDV causes great financial damage to pig farms around the world as well as in Korea, there are few studies on the development of a distinct treatment method and vaccine. As a developed vaccine, CV777 strain, which shows low pathogenicity compared to other viruses, was used for the first time as an attenuated virus vaccine. It was used as a vaccine, and KPED-9, PED-SM98, and DR-13 are currently used as vaccine strains for PEDV in Korea. Due to the nucleotide sequence difference between vaccine strains, the preventive effect of PEDV is low, and there is a problem in that the vaccine virus is released after inoculation.

Therefore, it is possible to respond quickly to the rapidly changing PED virus, and it is very similar in shape to the actual virus, so it not only shows high antigenicity, but also has safety because it does not have the nucleic acid of the virus, and the problem of detecting a vaccine virus even after inoculation Although research on virus-like particles (VLPs) for vaccines that do not have a vaccine have been actively conducted around the world, a successful PED VLP for vaccines that can effectively respond to the swine epidemic diarrhea virus has not yet been developed.

Republic of Korea Patent Registration No. 10-1765394

Accordingly, it is an object of the present invention to provide a novel chimeric porcine epidemic diarrhea virus-like particle for the preparation of a vaccine for the prevention of porcine epidemic diarrhea disease.

Another object of the present invention is to provide a vaccine composition comprising the chimeric porcine epidemic diarrhea virus-like particles of the present invention.

Another object of the present invention is to provide a recombinant expression vector for preparing chimeric porcine epidemic diarrhea virus-like particles.

Another object of the present invention is to provide a host cell transformed with the recombinant expression vector of the present invention.

Furthermore, it is an object of the present invention to provide a method for preparing virus-like particles for vaccines for the prevention or treatment of swine epidemic diarrhea.

In order to achieve the object of the present invention as described above, the present invention is HIV (human immunodeficiency virus) pr55 (Gag) protein; and Porcine epidemic diarrhea virus (PEDV) spike protein (spike protein; S); Containing, chimeric porcine epidemic diarrhea virus-like particles are provided.

In one embodiment of the present invention, the spike protein may be composed of amino acids represented by SEQ ID NO: 1 or SEQ ID NO: 11.

In one embodiment of the present invention, the pr55 (Gag) protein of the human immunodeficiency virus (HIV) may consist of amino acids represented by SEQ ID NO: 3.

The present invention also provides a vaccine composition comprising the chimeric porcine epidemic diarrhea virus-like particles of the present invention.

In addition, the present invention, a nucleotide sequence encoding the pr55 (Gag) protein of HIV (human immunodeficiency virus); And porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus; PEDV) of the spike protein (spike protein) encoding the base sequence; containing, chimeric porcine epidemic diarrhea virus- It provides a recombinant expression vector for producing a similar particle.

In one embodiment of the present invention, the nucleotide sequence encoding the pr55 (Gag) protein of the human immunodeficiency virus (HIV) is a nucleotide sequence consisting of SEQ ID NO: 4, and the porcine epidemic diarrhea virus (PEDV) The nucleotide sequence encoding the spike protein may be a nucleotide sequence consisting of SEQ ID NO: 2 or SEQ ID NO: 12.

In one embodiment of the present invention, the recombinant expression vector is a baculovirus represented by SEQ ID NO: 5 (homologous region 3) of baculovirus represented by SEQ ID NO: 5, p6.9 promoter represented by SEQ ID NO: 6, baculo represented by SEQ ID NO: 7 The promoter of the polyhedrin-coding gene of the virus may further include a Burst sequence represented by SEQ ID NO: 8.

In one embodiment of the present invention, the recombinant expression vector is a pBm-p6.9v-Gag-EGFP-S (-19aa) vector or pBm-p6.9v-Gag-EGFP-S ( H1384R) vector.

The present invention also provides a host cell transformed with the recombinant expression vector of the present invention.

In one embodiment of the present invention, the host cells are BT1-Tn-5B1-4 cells, Hi5 cells, LD652Y cells, Sf9 cells, Sf21 cells, Kc1 cells, SL2 cells, Bm5 cells, BmN cells and mosquitoes (mosquito). It may be any one insect cell selected from the group consisting of cells.

In one embodiment of the present invention, the insect may be any one selected from the group consisting of silkworm moth (Bombyx mori), thief moth (Spodoptera frugiperda), cabbage silver pattern chestnut moth (Trichoplusia ni), and honeycomb coffeehouse (Galleria mellonella). have.

In addition, the present invention, (1) using the recombinant expression vector of the present invention to prepare a recombinant baculovirus; (2) infecting a host cell with the recombinant baculovirus; (3) culturing the host cell and obtaining the culture; And (4) provides a method for producing a virus-like particle for a vaccine for preventing or treating a swine epidemic diarrhea disease, comprising the step of obtaining a chimeric porcine epidemic diarrhea virus-like particle from the culture.

In one embodiment of the present invention, the host cells are BT1-Tn-5B1-4 cells, Hi5 cells, LD652Y cells, Sf9 cells, Sf21 cells, Kc1 cells, SL2 cells, Bm5 cells, BmN cells and mosquitoes (mosquito). It may be any one insect cell selected from the group consisting of cells.

In one embodiment of the present invention, the chimeric porcine epidemic diarrhea virus-like particles in step (4) may be released into the culture medium through budding in the plasma membrane of the host cell.

The chimeric porcine epidemic diarrhea virus-like particle of the present invention is prepared to include the pr55 (Gag) protein of HIV (human immunodeficiency virus) and the spike protein of the porcine epidemic diarrhea virus (PEDV). It has high antigenicity because it is very similar in shape to a virus, and it has safety because it does not have a nucleic acid of the virus, and a mutant of the spike protein is used so that the spike structural protein can easily move to the plasma membrane after expression. The chimeric porcine epidemic diarrhea virus-like particle is easily released from the cell membrane to the outside of the cell membrane of the host cell through the budding process by including the HIV pr55 (Gag) protein. It has the effect of conveniently and efficiently producing virus-like particles. Therefore, the chimeric porcine epidemic diarrhea virus-like particles prepared in the present invention can be usefully used in the preparation of vaccines for the prevention or treatment of diseases caused by swine epidemic diarrhea virus infection.

1 is a schematic diagram showing the cloning process for securing the M, E, N and S proteins, which are structural proteins of the PED virus.
2 is a schematic diagram illustrating a cloning process for the preparation of a recombinant vector capable of co-expressing both MENS, a structural protein of the PED virus, and a recombinant vector capable of co-expressing both MES.
3 is a schematic diagram of recombinant BmNPV capable of expressing either the M, E, N and S structural proteins of the PED virus alone, or co-expressing the structural proteins of MENS or MES.
4 is a structural schematic diagram of a PED virus virus-like particle composed of four structural proteins (MENS) (A) and a PED virus virus-like particle composed of three structural proteins (MES), orange is S protein, green is N protein in silver, M protein in blue, and E protein in light blue.
5 is a view showing the expression of each structural protein by SDS-PAGE electrophoresis (5a and 5b) and Western blot after each infecting Bm5 cells with recombinant BmNPV containing genes for each structural protein of the PED virus. The result confirmed by (5c) is shown. In this case, the Bm5 lane is a group that is not treated with anything, and BmNPV-K1 indicates recombinant BmNPV that does not contain a gene for the structural protein of the PED virus.
6 is a view showing the co-expression of structural proteins by SDS-PAGE electrophoresis (6a) and Western blot (6b) after each infection of Bm5 cells with recombinant BmNPV containing MENS structural protein and MES structural protein genes. ) is the result of the confirmation.
7 is a schematic diagram illustrating the process of co-expression of PEDV structural proteins in Bombyx moth larvae, followed by confirmation by Western blot.
8 shows the results of confirming the expression of MENS structural protein or MES structural protein in Bombyx moth larvae using anti-spike serum by Western blot, and orange indicates S protein.
9 is a schematic diagram showing a TEM (Transmission Electron Microscope) analysis process after co-expression of the structural proteins of PEDV in Bombyx moth larvae.
10 is a result of confirming by Western blot whether or not the virus-like particles (VLP) produced after infecting Bombyx moth larvae with recombinant BmNPV (rBp-MENS and rBp-MES) capable of co-expressing MENS or MES structural proteins. , and orange indicates the S protein.
Figure 11 shows a photograph of observing the produced virus-like particles (VLP) with an electron microscope after infecting the Bombyx moth larvae with recombinant BmNPV (rBp-MENS and rBp-MES), 11a is BmNPV-K1, 11b is rBp-MENS and 11c are the results of infection with each recombinant BmNPV of rBp-MES.
12 is a schematic diagram showing a process for producing a chimeric PEDV VLP using pr55 (Gag) of human immunodeficiency virus (HIV) in an embodiment of the present invention.
13 shows a schematic diagram of the S structural protein of PEDV, PEDV-S shows the wild-type S structural protein domain, and PEDV-S H1384R is the 1384th amino acid constituting the KxHxx motif of the cytoplasmic region of the PEDV S domain. It shows a schematic diagram of a mutant in which H is mutated to R, and PEDV-S-19aa shows a schematic diagram of a mutant in which 19 amino acids are deleted from the cytoplasmic region of the PEDV S domain.
14 is a recombinant viral vector pBm-p6.9v-PEDV-S, pBm-p6 for constructing recombinant BmNPV capable of single expression of wild-type S of PEDV, mutant S(-19aa) and S(H1384R). Cleavage maps of the .9v-PEDV-S (-19aa) and pBm-p6.9v-PEDV-S (H1384R) vectors are shown.
15 shows recombinant baculos prepared using pBm-p6.9v-PEDV-S, pBm-p6.9v-PEDV-S (-19aa) and pBm-p6.9v-PEDV-S (H1384R) recombinant viral vectors. A schematic diagram of the virus is shown.
Figure 16 shows the use of an anti-spike antibody, which is an anti-sera specific for S protein, after infecting Bm5 cells with recombinant BmNPV capable of single expression of wild-type S, mutant S (-19aa) and S (H1384R) of PEDV, respectively. The result of Western blotting is shown, and orange is the S protein.
FIG. 17 shows immunofluorescence and confocal to confirm the location of S protein after each infection of Bm5 cells with recombinant BmNPV capable of single expression of wild-type S, mutant S(-19aa) and S(H1384R) of PEDV. The microscopic analysis process is shown in a schematic diagram.
Figure 18 shows the wild-type S of PEDV, mutant S(-19aa) and S(H1384R), respectively, after infecting Bm5 cells with recombinant BmNPV capable of single expression, the S protein position was stained by immunofluorescence, and confocal It is a photograph showing the result of analysis under a microscope.
19 is a high expression recombinant viral vector containing both HIV-pr55 (Gag), EGFP and PEDV S (-19aa) mutant genes, pBm-p6.9v-Gag-EGFP-S (-19aa) vector and HIV-pr55 (Gag), EGFP, and PEDV S (H1384R) mutant gene is a schematic diagram showing the process of constructing a high-expression recombinant viral vector pBm-p6.9v-Gag-EGFP-S (H1384R) vector.
20 is a schematic diagram showing a recombinant baculovirus into which the HIV-pr55(Gag)-EGFP gene (a) and the HIV-pr55(Gag)-EGFP-PESV-S(-19aa) gene (b) are introduced.
Figure 21 is a recombinant baculovirus rBm-p6.9v-Gag-EGFP or rBm- into which the HIV-pr55 (Gag)-EGFP gene and the HIV-pr55 (Gag)-EGFP-PESV-S (-19aa) gene After each infection of p6.9v-Gag-EGFP-S (-19aa) into Bm5 cells, culture medium was obtained and Western blot was performed with GFP monoclonal antibody (a) and anti-p24 monoclonal antibody (b). the results are shown.
Figure 22 is a recombinant virus rBm-p6.9v-Gag-EGFP and rBm-p6.9v-Gag-EGFP-S (-19aa), respectively, after infecting Bm5 cells, the culture medium of the infected cells obtained and centrifuged After confirming the obtained chimeric virus-like particles by Western blot, (a) is an anti-GFP antibody, (b) is an anti-p24 antibody, and (c) is an anti-spike serum. .
23 shows the results of confirming the PEDV chimeric virus-like particles produced by the method of the present invention with an electron microscope, (a) is Gag-EGFP VLP, (b) shows PED-Gag-EGFP VLP.

The present invention is characterized in that it provides a novel vaccine chimeric virus-like particle for the effective prevention or treatment of porcine epidemic diarrheal disease.

Chimeric porcine epidemic diarrhea virus-like particles provided in the present invention are the pr55 (Gag) protein of HIV (human immunodeficiency virus) and the spike protein of the porcine epidemic diarrhea virus (PEDV) (spike protein; S protein) ), which is very similar in shape to the actual PED virus, has high antigenicity, and has no virus nucleic acid, so it is safe and can be mass-produced quickly. In addition, the chimeric virus-like particles of the present invention do not cause problems such as virus release problems after vaccination and recovery of the discharged virus after vaccination, which have conventional virus vaccines, so that they can be used as vaccines with higher safety.

The present inventors used HIV (human immunodeficiency virus) pr55 (Gag) protein to develop a new PED virus-like particle with high stability and excellent preventive or therapeutic effect on PED. HIV pr55 (Gag) protein is a single protein Since only the cell membrane can be surrounded and budding, the chimeric virus-like particles of the present invention can be easily released from the host cell to the outside of the cell membrane.

In addition, the chimeric virus-like particle according to the present invention includes a spike protein of porcine epidemic diarrhea virus (PEDV), wherein the spike protein (S) is a signal peptide, S1 domain, CO-26K It is a protein composed of equivalent (COE), S2 domain, transmembrane region, and intracellular domain, is involved in conjugation with host cells and infiltration of viruses, induces the formation of neutralizing antibodies from cells, and plays a role as a major immunogen.

On the other hand, PEDV contains Membrane (M), Nucleocapsid (N) and Envelope (E) proteins as structural proteins in addition to the spike protein. I have a problem that needs to be done. However, the present inventors confirmed that it is very difficult to successfully overexpress several structural proteins of PEDV at the same time through an example.

Accordingly, the chimeric virus-like particle provided in the present invention was prepared as a virus-like particle including a spike protein, specifically, a spike mutant protein among structural proteins of PEDV.

The spike protein of PEDV is composed of a total of four domains: S1 domain, S2 domain, Transmembrane domain and cytoplasmic domain. Among them, the cytoplasmic domain plays a role in interacting with other proteins derived from viruses.

In addition, a specific motif having a sequence of KxHxx exists in the cytoplasmic domain of PEDV, which is known to act as an ER retention signal. Therefore, due to the KxHxx motif of the cytoplasmic domain, the spike protein does not move to the plasma membrane and continuously resides in the ER-Golgi intermediate compartment (ERGIC).

Taking this into consideration, the present inventors prepared a mutant of the spike protein so that the spike structural protein of PEDV, which is important for vaccine activity, can easily migrate to the plasma membrane after expression in the cell.

As a mutant of the spike protein, a mutant in which the 1384 amino acid H of the KxHxx motif was substituted with R (H1384R) and a mutant in which 19 amino acids of the cytoplasmic domain were deleted (-19aa) were prepared, respectively, encoding these mutants After the recombinant baculovirus containing the gene was prepared, the expression level in insect cells was analyzed.

As a result, it was confirmed that the mutants prepared above were expressed in insect cells, and in particular, the spike protein mutant in which 19 amino acids of the cytoplasmic domain were deleted showed the highest expression level.

Accordingly, the present inventors found that, for the production of PED virus-like particles, a spike protein, preferably a spike mutant protein of H1384R or -19aa, can be used, and more preferably, it is maintained in a host cell while maintaining high antigenicity. It was found that it was better to use a spike mutant protein (-19aa) in which 19 amino acids of the cytoplasmic domain that was overexpressed in the cytoplasmic domain were deleted.

Therefore, the spike protein of the porcine epidemic diarrhea virus (PEDV) contained in the chimeric porcine epidemic diarrhea virus-like particles provided in the present invention is SEQ ID NO: 1 or SEQ ID NO: 11 It will consist of an amino acid sequence and may include functional equivalents thereof.

Here, the amino acid sequence consisting of SEQ ID NO: 1 shows the amino acid sequence of the spike mutant (-19aa) protein in which 19 amino acids of the cytoplasmic domain are deleted, and the amino acid sequence consisting of SEQ ID NO: 11 is the 1384th amino acid H of the KxHxx motif Shows the amino acid sequence of the spike mutant (H1384R) protein in which R was substituted.

In addition, the pr55 (Gag) protein of human immunodeficiency virus (HIV) may consist of the amino acid sequence shown in SEQ ID NO: 3, and may include a functional equivalent thereto.

The "functional equivalent" is at least 70% or more, preferably 80% or more, more preferably 90% or more, more preferably the amino acid sequence of SEQ ID NO: 1, 11 or 3 as a result of the addition, substitution or deletion of amino acids. Preferably, it has a sequence homology of 95% or more, and refers to a protein having substantially the same physiological activity as the amino acid sequence of SEQ ID NO: 1, 11 or 3.

In the present invention, the "virus-like particle (VLP)" refers to a non-infectious viral subunit with or without a viral protein. For example, the virus-like particle may completely lack a DNA or RNA genome, or a virus-like particle containing a viral protein may undergo spontaneous self-assembly.

In addition, the virus-like particle may be prepared by a genetic engineering method, and may include a PEDV-derived spike protein, preferably the mutant spike protein described above, as a structural protein. Since the virus-like particle can be produced by a genetic engineering method without a separate causative agent, that is, PEDV, high productivity and economy can be realized.

The chimeric porcine epidemic diarrhea virus-like particle of the present invention contains a favorable antigenic determinant site on the surface of the PED virus, and when administered to a specific individual, can induce a specific immune response to the PED virus, and immunity to the administered individual By giving a swine epidemic diarrhea virus infection, it is possible to derive a preventive or therapeutic effect on the disease.

In addition, the present invention may provide a vaccine composition comprising the chimeric porcine epidemic diarrhea virus-like particles of the present invention.

The vaccine composition may be in a form containing the virus-like particles or a concentrate thereof, or may be used in the form of a transformed host cell itself or a dry powder form of the transformed cell.

The vaccine composition comprises stabilizers, emulsifiers, aluminum hydroxide, aluminum phosphate, pH adjusters, surfactants, liposomes, iscom adjuvants, synthetic glycopeptides, bulking agents, carboxypolymethylene, bacterial cell walls, derivatives of bacterial cell walls, bacterial vaccines, Animal poxvirus protein, subviral particle adjuvant, cholera toxin, N,N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine, monophosphoryl lipid A, dimethyl It may be characterized in that it further contains any one or more second adjuvants selected from the group consisting of dioctadecyl-ammonium bromide and mixtures thereof.

In addition, the vaccine composition may include a veterinary acceptable carrier. As used herein, the term "veterinary acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Carriers, excipients, and diluents that may be included in the vaccine composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

In addition, the vaccine composition may be formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and the like and sterile injection solutions according to conventional methods, respectively. In the case of formulation, it can be prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the lecithin-like emulsifier, for example, starch, calcium carbonate, sucrose or lactose. , gelatin, etc. can be mixed to prepare it. In addition to simple excipients, lubricants such as magnesium stearate talc can also be used. As liquid formulations for oral administration, suspensions, internal solutions, emulsions, syrups, etc. can be used. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives are used. may be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous preparations, suspensions, emulsions, and freeze-dried preparations. Non-aqueous preparations and suspensions may include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The dosage of the vaccine composition for the purpose of the present invention is 0.001 ml to 1 ml per kg body weight, preferably 0.2 ml to 0.4 ml per kg body weight.

The vaccine composition of the present invention may be administered through one or more routes of administration selected from the group consisting of intramuscular, subcutaneous, intraperitoneal, intravenous, oral, dermal, eye and brain, but is not limited thereto.

Furthermore, the present invention provides a recombinant expression vector for producing the chimeric porcine epidemic diarrhea virus-like particles of the present invention.

The recombinant expression vector of the present invention is a nucleotide sequence encoding the pr55 (Gag) protein of human immunodeficiency virus (HIV) and a nucleotide encoding a spike protein of porcine epidemic diarrhea virus (PEDV). contains sequence.

Here, the nucleotide sequence encoding the pr55 (Gag) protein of the human immunodeficiency virus (HIV) may be the nucleotide sequence consisting of SEQ ID NO: 4, and the nucleotide sequence encoding the spike protein is SEQ ID NO: 2 or the sequence It may be a nucleotide sequence consisting of number 12. In this case, the nucleotide sequence of SEQ ID NO: 2 is a nucleotide sequence encoding a spike mutant (-19aa) in which 19 amino acids of the cytoplasmic domain are deleted, and the nucleotide sequence of SEQ ID NO: 12 is the 1384th amino acid H of the KxHxx motif as R This is the base sequence encoding the substituted spike mutant (H1384R).

In addition, the recombinant expression vector of the present invention is baculovirus hr3 (homologous region 3) shown in SEQ ID NO: 5, p6.9 promoter shown in SEQ ID NO: 6, polyhedral protein of baculovirus shown in SEQ ID NO: 7 ( polyhedrin) a promoter of the coding gene, and further comprises a Burst sequence represented by SEQ ID NO: 8.

The HIV pr55 (Gag) protein-coding gene, included in the recombinant expression vector of the present invention, is intended to serve to release the chimeric virus-like particles prepared in the present invention from the host cell to the outside of the cell membrane through budding. , The gene encoding the mutant spike protein of the porcine epidemic diarrhea virus (PEDV) is to move the expressed spike protein to the plasma membrane.

The hr (homologous region) sequence refers to a region of a repeated base sequence present in the genome of baculovirus, and hr1, hr2L, hr2R, hr3, hr4L, hr4R, and hr5 exist. Most of these hr sequences are known to play an important role in viral DNA replication and proliferation and act as transcriptional promoters of viral or non-viral genes.

In the present invention, as it was confirmed that it is best to use hr3 as the hr (homologous region) sequence capable of overexpressing the target protein with the highest efficiency, hr3 was included as a component of the recombinant expression vector, and preferably the For hr3, the one consisting of the nucleotide sequence of SEQ ID NO: 5 was used.

In addition, the recombinant expression vector of the present invention may include a gene of the p6.9 promoter and the promoter of the polyhedrin-coding gene of baculovirus.

This was to include the p6.9 promoter in order to further promote the expression of the foreign target protein by the polyhedral protein-coding gene promoter, and preferably, the p6.9 promoter consists of the nucleotide sequence shown in SEQ ID NO: 6, and the baculotype The promoter of the polyhedral protein-coding gene of rovirus consists of the nucleotide sequence shown in SEQ ID NO: 7.

Furthermore, the recombinant expression vector of the present invention may further include a burst sequence, wherein the burst sequence is a sequence located between the translation initiation site and TAAG as a portion present in the polyhedrin promoter, and the baculovirus is at the end of infection. It is known that V1f-1 specifically binds to the Burst sequence and promotes transcription. Burst sequence of the present invention has a nucleotide sequence consisting of SEQ ID NO: 8.

In addition, the recombinant expression vector of the present invention may further include an Enhanced Green Fluorescent Protein (EGFP) gene as a marker for analysis of the position and expression level of the expressed HIV pr55 (Gag) and the spike structural protein, preferably the EGFP The gene sequence is shown in SEQ ID NO: 10, and the amino acid sequence of the EGFP protein is shown in SEQ ID NO: 9.

In the recombinant expression vector of the present invention, baculovirus hr3 (homologous region 3) sequence shown in SEQ ID NO: 5, p6.9 promoter sequence shown in SEQ ID NO: 6, and baculovirus shown in SEQ ID NO: 7 The promoter sequence of each protein (polyhedrin) coding gene or the burst sequence represented by SEQ ID NO: 8 can be adjusted according to the common sense of those skilled in the art in the order, number, and direction as long as it can achieve increased expression of the target protein. It can be adjusted and used.

In an embodiment of the present invention, pBm-p6.9v-Gag-EGFP-S(-19aa) vector and pBm-p6.9v having the cleavage map of FIG. 19 as a recombinant expression vector for preparing chimeric porcine epidemic diarrhea virus-like particles -Gag-EGFP-S (H1384R) was prepared, respectively.

In the present invention, the "recombinant expression vector" refers to expression of a target polypeptide capable of expressing the target polypeptide with high efficiency in an appropriate host cell when the gene encoding the target polypeptide to be expressed is operably linked. It may be used as a vector, and the recombinant vector may be expressible in a host cell.

In the present invention, "operably linked" refers to a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. The operative linkage with the recombinant vector can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation using an enzyme generally known in the art.

In addition, the present invention can provide a host cell transformed with the recombinant expression vector of the present invention.

The host cells include, but are not limited to, BT1-Tn-5B1-4 cells, Hi5 cells, LD652Y cells, Sf9 cells, Sf21 cells, Kc1 cells, SL2 cells, Bm5 cells, BmN cells and mosquito cells. It may be any one insect cell selected from the group consisting of.

In addition, the insect is not limited thereto, but may be a silkworm moth (Bombyx mori), a thief moth (Spodoptera frugiperda), a cabbage silver chestnut moth (Trichoplusia ni), or a beehive tea moth (Galleria mellonella).

Methods for introducing the recombinant expression vector of the present invention into a host cell include introducing the recombinant vector of the present invention into a method known in the art, for example, calcium phosphate co-precipitation, DEAE-Textran treatment, electroporation, redistribution, etc. It can be carried out by known methods.

In addition, the introduction of the recombinant expression vector according to the present invention into a host cell can be simultaneously introduced into the host cell bacmid (bacmid).

The "baculovirus" is a compound word of a baculovirus and a plasmid, and refers to a baculovirus shuttle vector. In the present invention, the bacmid is a bacmid of the AcNPV family, ApGOZA, AcGOZA, and BmNPV (Bombyx mori nucleopolyhedrovirus) family. 1809-1817, 2001) all genomes can be used without limitation.

In the present invention, the "transformation" refers to a change in the genetic properties of an organism by DNA given from the outside, that is, when DNA, which is a kind of nucleic acid extracted from a cell of a certain lineage of an organism, is given to a living cell of another lineage, the DNA is It is a phenomenon in which genetic traits change after entering the cell, also called transformation, transformation, or transformation.

In the present invention, when the recombinant expression vector of the present invention is introduced into a host cell, it was confirmed that HIV Gag and the mutant spike protein were simultaneously overexpressed in a host cell, preferably an insect cell, and as a result, the target product HIV Gag and It was confirmed that the mutant spike protein can be mass-produced at the same time.

Furthermore, the present invention can provide a method for preparing virus-like particles for vaccines for the prevention or treatment of porcine epidemic diarrhea, wherein the method is preferably (1) preparing a recombinant baculovirus using the recombinant expression vector of the present invention. to do; (2) infecting a host cell with the recombinant baculovirus; (3) culturing the host cell and obtaining the culture; and (4) obtaining chimeric porcine epidemic diarrhea virus-like particles from the culture.

In the present invention, "baculovirus" is not pathogenic to humans or vertebrates, and includes all entomopathogenic viruses that are pathogenic only to insects. Preferably, it may include Nucleopolyhedrovirus (NPV) and Granulovirus (GV).

Specifically, first (1) a recombinant baculovirus is prepared using the recombinant expression vector of the present invention.

The recombinant expression vector of the present invention is cotransfected into a host cell together with baculovirus whole genome (genome) DNA. Since the original baculovirus DNA fragment site present on both sides of the nucleotide sequence encoding the protein of interest in the expression vector and the region corresponding to the fragment site in the total baculovirus genomic DNA consist of the same nucleotide sequence, these Homologous recombination of the liver occurs, and finally a recombinant baculovirus is produced.

Thereafter, (2) the recombinant baculovirus is infected with a host cell, and (3) the host cell is cultured and a culture thereof is obtained.

Recombinant baculovirus is a small-scale culture after confirming whether or not the expression target protein is generated and whether the nucleotide sequence encoding the expression target protein exists on the viral genome, and then the target protein is produced through mass culture and propagation of the recombinant virus. It is produced and expressed in large quantities.

For mass production of the target protein, the recombinant baculovirus is infected with insect cells, which are host cells, and then the infected insect cells are cultured in large quantities to obtain a culture.

Thereafter, (4) obtaining chimeric porcine epidemic diarrhea virus-like particles from the culture.

According to the method of the present invention, the PED virus-like particle of the present invention is expressed in a host cell, and then the mutant spike protein moves to the plasma membrane and is released out of the cell according to the budding process in the plasma membrane by the Gag protein. The culture medium may contain a large amount of the chimeric PED virus-like particles of the present invention.

In addition, in the step of obtaining the chimeric PED virus-like particles from the culture, the supernatant of the culture containing the virus-like particles can be used as a vaccine antigen as a stock solution containing the virus-like particles itself without going through a series of processes, , host cells can be prepared as vaccine antigens through a series of processes. For example, a cell lysate prepared by disrupting the cultured host cells after not undergoing a separate purification process for virus-like particles expressed in host cells may be used as it is.

The chimeric PED virus-like particles prepared by the method of the present invention do not have to use all the structural proteins of the PED virus, have high antigenicity and do not have the nucleic acid of the virus, so a vaccine for preventing PED with excellent stability and efficacy can be useful as

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example 1>

Preparation of PEDV virus-like particles and analysis of structural protein expression

<1-1> Construction of a recombinant donor vector

<1-1-1> Preparation of donor vector containing M, E, N, and S, which are four structural proteins of PEDV, respectively

Each cDNA was cloned to secure the genes of M (membrane protein), (E) envelope protein, (N) nucleocapsid protein, and (S) spike protein, which are four structural proteins constituting the porcine epidemic diarrhea virus (PEDV). Using the plasmid as a template, the primers in Table 1 below ((PED-MF / PED-MR), (PED-EF / PED-ER), (PED-NF / PED-NR), (PED-SF / PED-SR) ), each amplified DNA was obtained through PCR using prepared (see FIG. 1).

Thereafter, the prepared pT-PEDV-M and pT-PEDV-E vectors were obtained by using restriction enzymes EcoR I and Hind III to secure the PEDV-M and PEDV-E genes, and the pT-PEDV-N vector was prepared using restriction enzymes Sal I and Pst I was used to secure the PEDV-N gene, and the pT-PEDV-S vector was obtained by using restriction enzymes Sal I and Not I to secure the PEDV-S gene, and then recombinant BmNPV production of each secured gene By cloning into pAceBac1, which is a basic vector used for

<1-1-2> Preparation of a donor vector co-expressing M, E, N, S or a donor vector co-expressing M, E, N among the four structural proteins of PEDV

To construct a vector co-expressing the four structural proteins M, E, N, and S of PEDV or a co-expression vector capable of co-expressing M, E, S, pBm- prepared in <1-1-1> The PEDV-E vector was treated with restriction enzymes I-Ceu I and BstX I to secure an expression cassette including the PEDV-E gene, and then cloned into pBm-PEDV-N vector treated with restriction enzymes I-Ceu I to pBm- PEDV-NE was fabricated. In addition, the pBm-PEDV-M vector was treated with restriction enzymes I-Ceu I and BstX I to secure an expression cassette including the PEDV-M gene, and then added to the pBm-PEDV-S vector treated with restriction enzymes I-Ceu I. By cloning, pBm-PEDV-SM was prepared. After that, an expression cassette including the PEDV-E gene was obtained from pBm-PEDV-E by treatment with restriction enzymes I-Ceu I and BstX I, and cloned into pBm-PEDV-SM vector treated with restriction enzymes I-Ceu I Thus, a pBm-PEDV-MES vector capable of co-expression of M, E and S genes was prepared (see FIG. 2 ).

In addition, the pBm-PEDV-NE vector was treated with restriction enzymes I-Ceu I and BstX I to secure the PEDV-E and PEDV-N gene expression cassettes, and then pBm-PEDV- treated with restriction enzymes I-Ceu I By cloning into the SM vector, a pBm-PEDV-MENS vector capable of co-expression of M, E, N and S was constructed (see FIG. 2 ). The structure and final cloning of all the prepared recombinant plasmids were confirmed through PCR and sequencing.

<1-2> Recombinant BmNPV production

Recombinant Bombyx mori nuclear polyhedrosis virus (BmNPV) capable of expressing M, E, N, and S, which are structural proteins of PEDV, or co-expressing four structural proteins of MENS or three structural proteins of MES. To construct a pBm-PEDV-M, pBm-PEDV-E, pBm-PEDV-N, pBm-PEDV-S, pBm-PEDV-MES or pBm-PEDV-MENS vector prepared in <1-1> Recombinant BmNPV was prepared using the BpBacmid system (Lee, 2018), respectively (see Fig. 3). After that, each recombinant BmNPV was named rBp-PEDV-M, rBp-PEDV-E, rBp-PEDV-N, rBp-PEDV-S, rBp-PEDV-MES, rBp-PEDV-MENS, and whether recombinant protein was expressed. 3 μg of each recombinant BmNPV DNA was transfected into Bm5 cells, and 3 days later, virus proliferation was confirmed through a microscope, and then mass proliferation and titer measurements of BV were used in the experiment.

<1-3> Expression analysis of PEDV virus structural protein in Bm5 cells

Among the structural proteins of PEDV that have a budding life cycle around the ER-Golgi intermediate compartment (ERGIC) membrane of the cell, the N protein (nucleocapsid protein) binds to the RNA of the PEDV and is later nucleic acid inside the virus particle. The other three structural proteins (M, E, S) all have trans membrane domain-type 1, so they are present in the ER membrane after translation. Among them, M protein (membrane protein) and E protein (envelope protein) surround and release the ER membrane by protein-protein binding between them. will exist in The M and E proteins that induce budding are considered essential elements in the production of VLPs of the severe acute respiratory syndrome virus (SARS) belonging to the genus coronavirus along with PEDV, but the necessity of the N protein is still unclear. Therefore, in order to produce VLPs of PEDV, which has not yet been reported on VLP production, recombinant BmNPV capable of co-expressing four structural proteins and recombinant BmNPV capable of co-expressing three structural proteins of MES were respectively produced to determine whether virus-like particles were formed and their efficiency. was analyzed in the following way.

In order to test the expression of each structural protein prior to the co-expression of the structural protein, each recombinant virus was inoculated to 5 M.O.I. into each Bm5 cell, and the cells were harvested 72 hours after infection to confirm the expression of the structural protein in the cell. As a result of protein electrophoresis using SDS-PAGE gel, no specific band was observed when inoculated with Bm5 cells of the non-viral group used as a control group and wild strain baculovirus.

On the other hand, in contrast to this, in the group inoculated with the rBp-PEDV-M virus, a specific band was observed around 18 kDa, which is lower than the intrinsic molecular weight of 25.3 kDa. In the case of rBp-PEDV-N, an N protein of 48.9 kDa having a normal molecular weight was identified. On the other hand, in the case of rBp-PEDV-E, a specific band could not be confirmed near the expected size of 8.8 kDa, but in the case of rBp-PEDV-S, a specific band was confirmed near the expected normal size of 151 kDa. (See Fig. 5a). In addition, as a result of performing western blotting using anti-PED serum, which is a specific antisera, no specific band was observed in the experimental group inoculated with the non-inoculated Bm5 cells and wild strain baculovirus used as a control group ( 5c), in the case of rBp-PEDV-M, a specific and strong band was observed around 18 kDa, which was observed on SDS-PAGE, and a weak band was observed around 25.3 kDa of a normal molecular weight size (see FIG. 5c). In addition, in the case of rBp-PEDV-E, a specific band below 15 kDa based on the marker was weakly confirmed, and in the case of rBp-PEDV-S, a specific and strong band of a normal molecular weight was confirmed (see Fig. 5c).

Furthermore, in order to test whether the PEDV structural protein was co-expressed, the present inventors ^{inoculated 1×10 6} Bm5 cells with the virus at an MOI of 5, respectively, and harvested the cells 72, 84, and 96 hours after infection to express the intracellular structural protein. It was checked whether As a result of protein electrophoresis using 12% SDS-PAGE gel, when all M, E, N, and S were co-expressed, bands of all structural proteins were confirmed at 72 hours of infection, but the expression level was low, and the expression level was low at 84 and 96 hours of infection. S protein (spike protein) was not identified (see FIGS. 6a and 6b). In addition, in the case of co-expression of M, E, and S, the expression of all structural proteins was confirmed at 72 hours after infection, but the expression level was very low compared to the single expression of the structural proteins, and the highest expression was achieved depending on the structural proteins. It was found that the efficiency of forming virus-like particles was low because the visible times were different (see FIGS. 6a and 6b).

<1-4> Expression of PEDV virus structural protein and VLP production in Bombyx moth larvae

Through the results of Example <1-3>, when the expression of the PEDV structural protein was confirmed, in the case of the N or S protein, it was at a level that could be confirmed from the SDS-PAGE result, but in the case of the M protein and the E protein, the molecular weight was unclear. It was confirmed that the expression was expressed or showed a very weak level of expression. Therefore, it could be confirmed that VLP production in the Bm5 cell line was impossible or very low.

Therefore, the present inventors are able to produce a higher level of protein compared to the cell line, and the efficiency of the post-translational modification process is more excellent to induce the expression of structural proteins in silkworm larvae known to have active protein-protein interactions and to determine whether VLP production is possible. The following experiments were performed.

That is, rBp-PEDV-MES and rBp-PEDV-MENS recombinant viruses were injected into fifth instar silkworm larvae, and blood lymph was collected 96 hours after sufficient infection occurred and concentrated 10 times using 20% PEG solution, Western blotting was performed on a 10% SDS-PAGE gel using anti-spike anti-sera.

As a result, as shown in FIG. 8, no specific band was identified in the experimental group inoculated with wild strain baculovirus (BmNPV-K1) used as a control group, but rBp-PEDV-MES and rBp-PEDV-MENS were inoculated, respectively. In the experimental group, a specific band corresponding to the S protein was identified. In addition, the amount of the confirmed S protein was different depending on the number of co-expression of the structural protein. Furthermore, it was judged that it was difficult to determine whether the VLP was formed only by confirming the expression of the S protein, and thus, whether the VLP was formed was observed with an electron microscope.

To this end, after infection with the virus, the obtained blood lymph was subjected to simple purification and concentration through ultracentrifugation on a 25% sucrose cushion (see Fig. 9), and to re-test the presence or absence of S protein in the concentrate. As a result of performing Western blotting using anti-spike antiserum on a 10% SDS-PAGE gel, it was possible to reconfirm the specific band for the S protein only in the rBp-PEDV-MES-infected concentrate (see FIG. 10 ). Negative staining was performed on both the rBp-PEDV-MES sample for which the presence of S protein was confirmed and the rBp-PEDV-MENS sample for which the presence was not confirmed, and then, the generation of VLP was observed through an energy filtering transmission electron microscope. did.

As a result, no specific VLP was observed in the BmNPV-K1 inoculated sample used as a control (see Fig. 11a), and in the rBp-MES inoculated sample, a VLP having a size of about 150 nm, the actual size of PEDV, was confirmed. On the other hand, in the rBp-PEDV-MENS sample in which the S protein was not confirmed, a VLP having a size of about 150 nm was observed, but it was observed that it was at a very low level compared to rBp-PEDV-MES (Fig. 11b). Reference).

Through these results, the present inventors were able to confirm that VLP formation is possible through the co-expression of PEDV structural protein. However, it was confirmed that the structural protein and VLP production were relatively small. I knew there were difficulties.

<Example 2>

Preparation of Chimeric PEDV-Like Particles (VLPs)

In the case of enveloped viruses, in general, in order to form a structure of the virus, unlike non-enveloped viruses, several structural proteins must be successfully expressed simultaneously. PEDV also contains E protein and M protein, which are known to be essential for structure formation, and plays a role in membrane fusion and penetration with host cells. Stable overexpression of at least three structural proteins is required for VLP formation. However, as shown in the results of Example 1, as a result of analysis of the expression of MENS and MES structural proteins following rBp-MENS and rBp-MES inoculation, it was found that the expression efficiency of these proteins was very low, making it difficult to produce VLPs. In fact, to date, successful production of VLPs has not been reported for enveloped viruses.

Therefore, the present inventors performed the following experiment to prepare a chimeric VLP containing only the spike (S) protein, which is a major immune target among structural proteins, for successful production of PEDV-VLP for vaccine.

For the production of a chimeric VLP, first, a VLP form is made using the structural protein of the outer membrane virus, which has been reported to be easy to form a virus as a single structural protein, and the protein important for immunity in the target virus to be produced is added to the VLP. to be included. To this end, using the pr55 (Gag) protein of Human Immunodeficiency Virus (HIV) so that only a single protein can surround and bud the cell membrane, a platform for easy production of an outer membrane-type VLP that is difficult to produce was constructed ( 12), an experiment was performed to prepare a chimeric PEDV-VLP for a vaccine showing a high yield only with the main antigenic protein of the pathogenic virus without the expression of various structural proteins such as M, E, and N proteins of PEDV.

<2-1> Analysis of PEDV-S structural protein and mutant preparation of S structural protein

For the production of the chimeric PEDV-VLP, first, the S protein (spike protein) of PEDV, which is located in the ER-Golgi intermediate compartment (ERGIC) membrane and has a budging characteristic, is budded in the plasma membrane of the cell. In order to successfully localize the pr55 (Gag) VLP of HIV with HIV, an analysis of the PEDV S protein was first performed. The S structural protein consists of a total of 4,161 bp of bases and is known to have a molecular weight of about 151 kDa when translated. Each domain has a different role in infection with the host. The S1 domain and S2 domain are involved in binding and penetration with the receptor of the host cell, and the transmembrane domain and cytoplasmic domain are membrane protein, envelope protein, and It plays a role to exist on the surface of virus particles by nucleocapsid protein. In the case of the transmembrane domain, as type 1, the N-term region of the protein protrudes outward based on the cell membrane and the C-term region exists inside the cell membrane to penetrate the cell membrane, and thus exist inside the cell membrane region. The domain plays a role in interacting with other proteins derived from the virus. In addition, a specific motif having a sequence of KxHxx exists in the cytoplasmic domain of PEDV, which acts as an ER retention signal.

Therefore, due to the KxHxx motif of the cytoplasmic domain, the spike protein cannot move to the plasma membrane, but continuously resides in ERGIC. On the other hand, in order to change the protein to the plasma membrane after expression of the S protein, a mutant was prepared in which the 1384 amino acid H constituting the KxHxx motif was mutated to R in monkey-derived Vero cells, and 19 amino acids of the cytoplasmic domain were deleted. After preparing the mutant, the position after expression of these proteins in insect cells was confirmed and used to construct a chimeric VLP.

To construct PEDV-S (H1384R) in which the 1384 amino acid H of the Spike protein was point mutated to R and PEDV-S (-19aa) fragment in which 19 amino acids of the cytoplasmic domain were deleted, PEDV-S-EcoRI-F ( 5'-CCCGGGATGAAGTCTTTAACCTACTTC -3') and PEDV S-H1384R-SalI (5'- GTCGACTCACTGCACGCGGACCTTTTC -3') to obtain a point mutant PEDV-S(H1384R) product, PEDV-S-EcoRI-F ( 5'-GGATCCATGAAGTCTTTAACCTACTTC -3') and PEDV S-19aaR-SalI (5'-GTCGACTCAACCTGAGAAACAAGCACAGCA -3') were used for PCR to obtain a PEDV-S (-19aa) product. After cloning into the pMD20-T vector, it was reconfirmed whether the target point mutation and the target site were deleted through nucleotide sequence analysis.

<2-2> Construction of recombinant donor vector and production of recombinant BmNPV

In order to construct a recombinant BmNPV capable of expressing the mutant (S(-19aa), S(H1384R)) of the S structural protein prepared in <2-1> above, pBm-p6.9v-PEDV-S, Recombinant BmNPV was constructed using the pBm-p6.9v-PEDV-S (-19aa), pBm-p6.9v-PEDV-S (H1384R) vectors and the BmBacmid-Δpcc system, respectively (see FIG. 14 ). Here, the p6.9v refers to the p6.9 gene promoter of baculovirus. Each of the prepared recombinant BmNPV was named rBm-p6.9v-PEDV-S, rBm-p6.9v-PEDV-S (-19aa), rBm-p6.9v-PEDV-S (H1384R) (see FIG. 15 ). ), 3 μg of recombinant BmNPV DNA was transfected into Bm5 cells to test the protein expression by each recombinant BmNPV, and virus proliferation was confirmed 3 days later through a microscope. was used for

<2-3> Expression analysis of mutant spike structural protein

In order to analyze the expression level of the spike (S) structural protein by the recombinant BmNPV prepared in Example <2-2>, rBm-p6.9v-PEDV-S, rBm-p6. 9v-PEDV-S (-19aa) and rBm-p6.9v-PEDV-S (H1384R) viruses were inoculated, and collected on the 4th day of infection. carried out.

As a result, no specific band was observed in the virus-non-inoculated Bm5 cells and BmBacmid-inoculated groups used as controls, but in PEDV-S, PEDV-S (-19aa) and S (H1384R), the S protein was located in a region around 150 kDa. A specific band corresponding to the was identified, and the expression level was found to be different. Specifically, in the case of PEDV-S, it was found to show the lowest expression level. Therefore, it was found that S(-19aa) and S(H1384R) mutants can be used for chimeric VLP production, and in particular, it was confirmed that the S(-19aa) mutant showed the highest expression level, and S(-19aa) It was found that using the mutant for chimeric VLP construction is most effective (see FIG. 16 ).

In addition, immunofluorescence staining was performed to confirm whether the S protein was successfully transferred to the plasma membrane after expression with a high expression level. To this end, Bm5 cells were inoculated with rBm-p6.9v-PEDV-S, rBm-p6.9v-PEDV-S (-19aa) and rBm-p6.9v-PEDV-S (H1384R) viruses, respectively, at an MOI of 5, respectively. The cells were collected on the 4th day of infection, washed twice with PBS, dripped onto a slide glass, and left for 10 minutes until the cells subside, and then the cells were immobilized using 99% cold methanol. After that, for specific fluorescence staining of the spike protein, the Goat anti- antibody, which reacts specifically to the S1 domain of the spike protein, is treated, and the wavelength of 488 nm is modified and emitted to 510 nm so that it can be seen as green fluorescence. Rabbit IgG H&L (Alexa Fluor® 488) was treated and reacted specifically to the S1-antibody that specifically reacted to the spike protein. Thereafter, the DAPI solution was stained for differentiation between the nucleus and the cytoplasm and observed using a confocal microscope (see FIG. 17).

As a result, as shown in FIG. 18 , no fluorescence could be observed in cells infected with only the control group, BmBacmid, so it was found that non-specific binding due to baculovirus infection did not occur, including the gene of wild-type S protein. For cells infected with rBm-p6.9v-PEDV-S, weak fluorescence was observed around the plasma membrane. In addition, cells infected with rBm-p6.9v-PEDV-S(-19aa) and rBm-p6.9v-PEDV-S(H1384R) could also observe distinct fluorescence around the plasma membrane, especially rBm-p6.9v-PEDV As fluorescence by -S(-19aa) was confirmed to be strongest in the plasma membrane, it was found that a large number of spike proteins migrated to the plasma membrane after translation. On the other hand, the small amount of the spike protein induced by rBm-p6.9v-PEDV-S was observed in the plasma membrane, indicating that most of the protein was present in the ERGIC and a small amount moved to the plasma membrane by the ER retention signal of the original spike protein.

Therefore, the form that can contain the largest amount of S protein on the surface of HIV-pr55 (Gag) VLP is to use the PEDV-S (-19aa) mutant in which 19 amino acids are removed from the cytoplasmic domain of the S protein. found to be the most suitable.

<Example 3>

Preparation of chimeric virus-like particles having the spike (S) structural protein of PEDV

<3-1> Construction of a recombinant donor vector

In order to fuse the HIV-pr55 (Gag) gene with the EGFP gene, the HIV-1-Gag-F and HIV-1-Gag-R primers listed in Table 1 above and the HIV-pr55 (Gag) synthesized after codon optimization for silkworms After PCR was performed using the gene, the PCR product was cloned into the pMD20-T vector to prepare a pT-Gag plasmid into which the HIV-pr55 (Gag) gene was introduced. Thereafter, pr55(Gag) was introduced into the pBluescriptII vector using restriction enzymes EcoRI and BamHI to construct a recombinant pBlue-Gag-EGFP plasmid. Thereafter, the EGFP gene was cloned by treatment with restriction enzymes BamHI and Sac II to prepare a pBlue-Gag-EGFP plasmid having a Gag-EGFP fusion gene. Then, the Gag-EGFP gene was cloned into an overexpression vector, pBm-p6.9v, by treatment with restriction enzymes EcoRI and Pst I to construct a pBm-6.9v-Gag-EGFP vector (see FIG. 19a ).

Then, in order to simultaneously express Gag-EGFP and spike (-19aa), which is a mutant of the S protein, pBm-p6.9v-PEDV-S (-19aa) prepared in Example 2 was treated with restriction enzyme I-Ceu I. . In addition, pBm-6.9v-Gag-EGFP was treated with restriction enzymes I-Ceu I and BstX I to obtain a Gag-EGFP expression cassette, which was cloned into pBm-p6.9v-PEDV-S (-19aa) treated with the restriction enzymes. Thus, a recombinant viral vector of pBm-p6.9v-Gag-EGFP-S(-19aa) was prepared (see FIG. 19b).

<3-2> Recombinant BmNPV production

pBm-p6.9v-Gag-EGFP-S(-19aa) virus recombinant vector prepared in <3-1> and a control pBm-p6 that does not contain the gene for S protein in <3-1>. Each recombinant BmNPV was prepared using the 9v-Gag-EGFP virus recombinant vector using the BmBacmid-Δpcc system, which was rBm-p6.9v-Gag-EGFP (control) and rBm-p6.9v-Gag-EGFP-S, respectively. (-19aa) (see FIG. 20). Then, in order to check whether the protein was expressed by each recombinant BmNPV, 3 μg of recombinant BmNPV DNA was transfected into Bm5 cells, and virus proliferation was confirmed 3 days later through a microscope.

<3-3> Confirmation of production of chimeric virus-like particles of the present invention

The present inventors, for the production of chimeric virus-like particles having the S structural protein of PEDV, the recombinant BmNPV rBm-p6.9v-Gag-EGFP (control) and rBm-p6.9v prepared in <3-2> -Gag-EGFP-S (-19aa) was infected to 5 MOI into Bm5 cells, and 72 hours later, it was observed with a fluorescence microscope to confirm the normal expression and localization of Gag-EGFP.

As a result, it was confirmed that both of the Bm5 cells infected with the two viruses expressed EGFP in the plasma membrane, and thus Gag-EGFP was not only expressed normally, but also migrated to the plasma membrane after expression.

Thereafter, the culture medium of the virus-infected cells was collected and Western blotting was performed using an SDS-PAGE gel to confirm the production and budding of normal VLPs from each virus-infected insect cell.

As a result, as shown in FIG. 21, no specific band was observed when only BmBacmid was inoculated in the results using Anti-GFP, but rBm-p6.9v-Gag-EGFP and rBm-p6.9v-Gag-EGFP- In the medium of S(-19aa) recombinant virus-infected cells, an EGFP band was identified. In addition, the precursor form of Gag protein undergoes self-cleavage through the maturation process after VLP budding. As a result of this analysis, a band was confirmed around 27 kDa, the intrinsic molecular weight of EGFP, and even at 82 kDa, the molecular weight of the uncleaved form. A specific band was identified (see FIG. 21a ).

In addition, as a result of analysis using the antibody anti-p24 specific for the pr55 (Gag) protein, a band around 82 kDa was also confirmed, confirming that the Gag-EGFP fusion protein was expressed in insect cells, At about 55 kDa, the pr55 (Gag) protein remaining after EGFP was cleaved was identified, and a protein under which additional cleavage was occurring was also identified (see FIG. 21b ). Therefore, as a specific band for Gag-EGFP was observed in the culture medium of cells inoculated with the two recombinant baculoviruses, it could be seen that Gag-EGFP was released in the form of VLP into the culture medium through budding after normal expression.

Furthermore, in order to confirm the formation of Gag-EGFP and Gag-EGFP-spike chimeric VLPs, the present inventors put recombinant BmNPV rBm-p6.9v-Gag-EGFP and rBm-p6.9v-Gag in ^{5×10 6 Bm5 cells.} -EGFP-S (-19aa) was inoculated to 5 MOI, and the culture medium was collected 96 hours after infection, then cells and suspended matter were removed by centrifugation, and additional impurities were removed using a 0.2 um syringe filter, Ultracentrifugation was performed on a 20% sucrose cushion at 144,000 × g for 3 hours. Thereafter, the precipitate was resuspended in PBS, followed by 12% SDS-PAGE electrophoresis and Western blotting. In the analysis using Anti-GFP, Gag-EGFP in the uncleaved form was observed in both the experimental groups inoculated with each of the two viruses, and EGFP cleaved around 27 kDa was also confirmed (see FIG. 22a ). Gag-EGFP was also confirmed in the result using Anti-p24, and p24 having a molecular weight of 24 kDa was also observed through the maturation of VLP (see FIG. 22b).

In addition, in western analysis using S protein-specific antisera, S protein corresponding to about 151 kDa was detected in the rBm-p6.9v-Gag-EGFP-S(-19aa) virus inoculated group, so Gag VLP obtained by ultracentrifugation It was confirmed that the S structural protein of PEDV was present together (see Fig. 22c).

Furthermore, negative staining was performed for morphological analysis of the VLPs prepared in the present invention precipitated through ultracentrifugation and observed with an energy-filtering transmission electron microscope. By confirming that the production was clearly confirmed (see FIG. 23a ), and that the chimeric VLP confirmed to have the S protein also had a normal form, the present inventors found that PEDV, which was not previously developed by the method of the present invention, as described above. It was confirmed that it is possible to produce a virus-like particle (VLP) for a vaccine (see FIG. 23b).

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Chungbuk National University <120> Virus like particle for vaccines for the prevention of porcine epidemic diarrhea and method for preparing the same <130> NPDC84135 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 1367 <212> PRT <213> Artificial Sequence <220> <223> spike mutant protein sequence (-19aa) <400> 1 Met Lys Ser Leu Thr Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Ser Ala Asn Thr Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ile Gly Glu Asn Gln Gly Val Asn Ser Thr 50 55 60 Trp Tyr Cys Ala Gly Gln His Pro Thr Ala Ser Gly Val His Gly Ile 65 70 75 80 Phe Val Ser His Ile Arg Gly Gly His Gly Phe Glu Ile Gly Ile Ser 85 90 95 Gln Glu Pro Phe Asp Ser Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala 100 105 110 Thr Asn Gly Asn Thr Asn Ala Thr Ala Arg Leu Arg Ile Cys Gln Phe 115 120 125 Pro Ser Ile Lys Thr Leu Gly Pro Thr Ala Asn Asn Asp Val Thr Thr 130 135 140 Gly Arg Asn Cys Leu Phe Asn Lys Ala Ile Pro Ala His Met Ser Glu 145 150 155 160 His Ser Val Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe 165 170 175 Ser Asp Lys Ile Tyr Tyr Phe Tyr Phe Lys Asn Asp Trp Ser Arg Val 180 185 190 Ala Thr Lys Cys Tyr Asn Ser Gly Gly Cys Ala Met Gln Tyr Val Tyr 195 200 205 Glu Pro Thr Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly 210 215 220 Ile Ser Tyr Gln Pro Cys Thr Ala Asn Cys Ile Gly Tyr Ala Ala Asn 225 230 235 240 Val Phe Ala Thr Glu Pro Asn Gly His Ile Pro Glu Gly Phe Ser Phe 245 250 255 Asn Asn Trp Phe Leu Leu Ser Asn Asp Ser Thr Leu Val His Gly Lys 260 265 270 Val Val Ser Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro 275 280 285 Lys Ile Tyr Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Ile Asp 290 295 300 Gly Val Cys Asn Gly Ala Ala Val Gln Arg Ala Pro Glu Ala Leu Arg 305 310 315 320 Phe Asn Ile Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val 325 330 335 Leu His Thr Ala Leu Gly Thr Asn Phe Ser Phe Val Cys Ser Asn Ser 340 345 350 Ser Asn Pro His Leu Ala Thr Phe Ala Ile Pro Leu Gly Ala Thr Gln 355 360 365 Val Pro Tyr Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Thr Val 370 375 380 Tyr Lys Phe Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile 385 390 395 400 Thr Lys Tyr Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu 405 410 415 Gly Leu Leu Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp 420 425 430 Asp Asp Val Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp 435 440 445 Ala Leu Ile Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys 450 455 460 Asp Asp Pro Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu 465 470 475 480 Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu 485 490 495 Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe 500 505 510 Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn 515 520 525 Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val 530 535 540 Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser 545 550 555 560 Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu 565 570 575 Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr 580 585 590 Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu 595 600 605 Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys 610 615 620 Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp 625 630 635 640 Val Ser Phe Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly 645 650 655 Phe Lys Gly Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala 660 665 670 Gly Val Tyr Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn 675 680 685 Val Thr Ser Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu 690 695 700 Gln Ala Ala Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu 705 710 715 720 Ser Ser Ser Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr 725 730 735 His Ser Asn Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser 740 745 750 Asn Ile Gly Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln 755 760 765 Ser Gly Gln Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile 770 775 780 Pro Thr Asn Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr 785 790 795 800 Asn Thr Pro Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn 805 810 815 Ser Arg Cys Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr 820 825 830 Ile Glu Ser Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val 835 840 845 Asn Ser Met Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile 850 855 860 Ser Ser Phe Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val 865 870 875 880 Ser Val Tyr Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe 885 890 895 Ile Glu Asp Leu Leu Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr 900 905 910 Val Asp Glu Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp 915 920 925 Leu Val Cys Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val 930 935 940 Val Asp Ala Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly 945 950 955 960 Met Val Leu Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr 965 970 975 Ala Val Gln Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu 980 985 990 Gln Arg Asn Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly 995 1000 1005 Asn Ile Thr Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln Thr 1010 1015 1020 Ser Lys Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val Gln Glu 1025 1030 1035 1040 Val Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr Val Gln Leu 1045 1050 1055 Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp Asp Ile Tyr Ser 1060 1065 1070 Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val Asp Arg Leu Ile Thr 1075 1080 1085 Gly Arg Leu Ser Ala Leu Asn Ala Phe Val Ala Gln Thr Leu Thr Lys 1090 1095 1100 Tyr Thr Glu Val Gln Ala Ser Arg Lys Leu Ala Gln Gln Lys Val Asn 1105 1110 1115 1120 Glu Cys Val Lys Ser Gln Ser Gln Arg Tyr Gly Phe Cys Gly Gly Asp 1125 1130 1135 Gly Glu His Ile Phe Ser Leu Val Gln Ala Ala Pro Gln Gly Leu Leu 1140 1145 1150 Phe Leu His Thr Val Leu Val Pro Ser Asp Phe Val Asp Val Ile Ala 1155 1160 1165 Ile Ala Gly Leu Cys Val Asn Asp Glu Ile Ala Leu Thr Leu Arg Glu 1170 1175 1180 Pro Gly Leu Val Leu Phe Thr His Glu Leu Gln Asn His Thr Ala Thr 1185 1190 1195 1200 Glu Tyr Phe Val Ser Ser Arg Arg Met Phe Glu Pro Arg Lys Pro Thr 1205 1210 1215 Val Ser Asp Phe Val Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn 1220 1225 1230 Leu Thr Arg Asp Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val 1235 1240 1245 Asn Lys Thr Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr Gly 1250 1255 1260 Pro Ser Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn Leu Thr 1265 1270 1275 1280 Gly Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu Arg Asn Thr 1285 1290 1295 Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn Asn Thr Leu Val 1300 1305 1310 Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr Ile Lys Trp Pro Trp 1315 1320 1325 Trp Val Trp Leu Ile Ile Phe Ile Val Leu Ile Phe Val Val Ser Leu 1330 1335 1340 Leu Val Phe Cys Cys Ile Ser Thr Gly Cys Cys Gly Cys Cys Gly Cys 1345 1350 1355 1360 Cys Cys Ala Cys Phe Ser Gly 1365 <210> 2 <211> 4104 <212> DNA <213> Artificial Sequence <220> <223> spike mutant DNA sequence (-19aa) <400> 2 atgaagtctt taacctactt ctggttgttc ttaccagtac tttcaacact tagcctacca 60 caagatgtca ccaggtgctc agctaacact aattttaggc ggttcttttc aaaatttaat 120 gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga aaaccagggt 180 gtcaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt tcatggtatc 240 tttgttagcc atattagagg tggtcatggc tttgagattg gcatttcgca agagcctttt 300 gactctagtg gttaccagct ttatttacat aaggctacta acggtaacac taatgctact 360 gcgcgactgc gcatttgcca gtttcctagc attaaaacat tgggccccac tgctaataat 420 gatgttacaa caggtcgtaa ttgcctattt aacaaagcca tcccagctca tatgagtgaa 480 catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc tgacaagatc 540 tattattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta caacagtgga 600 ggttgtgcta tgcaatatgt ttacgaaccc acctattaca tgcttaatgt tactagtgct 660 ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720 gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780 cttttgtcca atgattccac tttggtgcat ggtaaggtgg tttccaacca accattgttg 840 gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt ctcctttaat 900 caaacgatcg atggcgtttg taatggagct gctgtgcagc gtgcaccaga ggctctgagg 960 tttaacatta atgacacctc tgtcattctt gctgaaggct caattgtact tcatactgct 1020 ttaggaacaa atttttcttt tgtttgcagt aattcctcaa atcctcactt agctaccttc 1080 gccatacctc tgggtgctac ccaagtacct tattattgtt ttcttaaagt ggatacttac 1140 aactccactg tttataaatt tttggctgtt ttacctccta ccgtcaggga aattgtcatc 1200 accaagtatg gtgatgttta tgtcaatggg tttggatact tgcatctcgg tttgttggat 1260 gctgtcacaa ttaatttcac tggtcatggc actgacgatg atgtttctgg tttttggacc 1320 atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaaccgc cattcagcgt 1380 attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc ttttgacctt 1440 gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca gccaatttct 1500 tttgttactc tgccatcatt taatgatcat tcttttgtta acattactgt atctgcttcc 1560 tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa tgggtttagt 1620 tctttctgtg ttgacactag acaatttacc atttcactgt tttataacgt tacaaacagt 1680 tatggttatg tgtctaaatc acaggacagt aattgccctt tcaccttgca atctgttaat 1740 gattacctgt cttttagcaa attttgtgtt tccaccagcc ttttggctag tgcctgtacc 1800 atagatcttt ttggttaccc tgagtttggt agtggtgtta agtttacgtc cctttacttt 1860 caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg tgtcacggac 1920 gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt taaaggtgag 1980 ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattacac atctgattct 2040 ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100 tctttttcag agcaggctgc atatgttgat gatgatatag tgggtgttat ttctagtttg 2160 tctagctcca cttttaacag tactagggag ttgcctggtt tcttctacca ttctaatgat 2220 ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg taaatctggc 2280 agtattggct acgtcccatc tcagtctggc caagtcaaga ttgcacccac ggttactggg 2340 aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt acagctttac 2400 aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc tcgttgtaaa 2460 caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt acaactcagc 2520 gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga ggctctacag 2580 ttagctacca ttagttcgtt taatggtgat ggatataatt tactaatgt gctgggtgtt 2640 tctgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtcttttat tgaagacctg 2700 ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760 tctaatggtc gttctgtggc agatctagtc tgtgcacagt attactctgg tgtcatggta 2820 ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct catcggtggt 2880 atggtgctag gaggttttac ttctgcagcg gcattgcctt ttagctatgc tgttcaagct 2940 agactcaatt atcttgctct acagacggat gttctacagc ggaaccagca attgcttgct 3000 gagtctttta actctgctat tggtaatata acttcagcct ttgagagtgt taaagaggct 3060 attagtcaaa cttccaaggg tttgaacact gtggctcatg cgcttactaa ggttcaagag 3120 gttgttaact cgcagggtgc agctttgact caacttaccg tacagctgca acacaacttc 3180 caagccattt ctagttctat tgatgacatt tactctcgac tggacattct ttcagccgat 3240 gttcaggttg accgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300 accctcacta agtatactga ggttcaggct agcaggaagt tagcacagca aaaggttaat 3360 gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatt 3420 ttctctctgg tacaggcagc acctcagggc ctgctgtttt tacatacagt acttgtaccg 3480 agtgattttg tagatgttat tgccatcgct ggcttatgcg ttaacgatga aattgccttg 3540 actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaaatca tactgcgacg 3600 gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt tagtgatttt 3660 gttcaaattg agagttgtgt ggtcacctat gtcaatttga ctagagacca actaccagat 3720 gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc ttctctgccc 3780 aatagaactg gtccaagtct tcctttagat gtttttaatg ccacttatct taatctcact 3840 ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac agaggagctc 3900 caaagtctta tatataatat caacaacaca ctagttgacc ttgagtggct caaccgagtt 3960 gagacatata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt tctcatcttt 4020 gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg ctgcggctgc 4080 tgctgtgctt gtttctcagg ttga 4104 <210> 3 <211> 509 <212> PRT <213> Artificial Sequence <220> <223> HIV pr55 (Gag) protein sequence <400> 3 Met Gly Ala Arg Ala Ser Val Leu Ser Gly Gly Glu Leu Asp Arg Trp 1 5 10 15 Glu Lys Ile Arg Leu Arg Pro Gly Gly Lys Lys Lys Tyr Lys Leu Lys 20 25 30 His Ile Val Trp Ala Ser Arg Glu Leu Glu Arg Phe Ala Val Asn Pro 35 40 45 Gly Leu Leu Glu Thr Ser Glu Gly Cys Arg Gln Ile Leu Gly Gln Leu 50 55 60 Gln Pro Ser Leu Gln Thr Gly Ser Glu Glu Leu Arg Ser Leu Tyr Asn 65 70 75 80 Thr Val Ala Thr Leu Tyr Cys Val His Gln Arg Ile Glu Ile Lys Asp 85 90 95 Thr Lys Glu Ala Leu Asp Lys Ile Glu Glu Glu Gln Asn Lys Ser Lys 100 105 110 Lys Lys Ala Gln Gln Ala Ala Ala Asp Thr Gly His Ser Asn Gln Val 115 120 125 Ser Gln Asn Tyr Pro Ile Val Gln Asn Ile Gln Gly Gln Met Val His 130 135 140 Gln Ala Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Val Glu 145 150 155 160 Glu Lys Ala Phe Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu Ser 165 170 175 Glu Gly Ala Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly 180 185 190 Gly His Gln Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu Glu 195 200 205 Ala Ala Glu Trp Asp Arg Val His Pro Val His Ala Gly Pro Ile Ala 210 215 220 Pro Gly Gln Met Arg Glu Pro Arg Gly Ser Asp Ile Ala Gly Thr Thr 225 230 235 240 Ser Thr Leu Gln Glu Gln Ile Gly Trp Met Thr Asn Asn Pro Pro Ile 245 250 255 Pro Val Gly Glu Ile Tyr Lys Arg Trp Ile Ile Leu Gly Leu Asn Lys 260 265 270 Ile Val Arg Met Tyr Ser Pro Thr Ser Ile Leu Asp Ile Arg Gln Gly 275 280 285 Pro Lys Glu Pro Phe Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr Leu 290 295 300 Arg Ala Glu Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu Thr 305 310 315 320 Leu Leu Val Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Lys Ala 325 330 335 Leu Gly Pro Ala Ala Thr Leu Glu Glu Met Met Thr Ala Cys Gln Gly 340 345 350 Val Gly Gly Pro Gly His Lys Ala Arg Val Leu Ala Glu Ala Met Ser 355 360 365 Gln Val Thr Asn Ser Ala Thr Ile Met Met Gln Arg Gly Asn Phe Arg 370 375 380 Asn Gln Arg Lys Ile Val Lys Cys Phe Asn Cys Gly Lys Glu Gly His 385 390 395 400 Thr Ala Arg Asn Cys Arg Ala Pro Arg Lys Lys Gly Cys Trp Lys Cys 405 410 415 Gly Lys Glu Gly His Gln Met Lys Asp Cys Thr Glu Arg Gln Ala Asn 420 425 430 Phe Leu Gly Lys Ile Trp Pro Ser Tyr Lys Gly Arg Pro Gly Asn Phe 435 440 445 Leu Gln Ser Arg Pro Glu Pro Thr Ala Pro Pro Glu Glu Ser Phe Arg 450 455 460 Ser Gly Val Glu Thr Thr Thr Pro Pro Gln Lys Gln Glu Pro Ile Asp 465 470 475 480 Lys Glu Leu Tyr Pro Leu Thr Ser Leu Arg Ser Leu Phe Gly Asn Asp 485 490 495 Pro Ser Ser Gln Asn Arg Asn Gly Asp Pro Leu Val Leu 500 505 <210> 4 <211> 1529 <212> DNA <213> Artificial Sequence <220> <223> HIV pr55 (Gag) DNA sequence <400> 4 atgggagctc gtgcatctgt actgtcaggt ggtgagttag accgatggga aaaaatccgt 60 ttacgtcctg gaggaaagaa aaaatacaaa ttaaagcata tagtatgggc ttcgcgtgaa 120 ttagagagat tcgcagtcaa cccaggtctg cttgagactt ccgaaggatg ccgtcaaatc 180 ctgggtcaac tacaaccctc gcttcaaacc ggttccgagg aactacgatc actatataat 240 actgtcgcta cattatattg cgtacatcaa cgaattgaga ttaaagatac caaagaggcg 300 ctagacaaga ttgaagaaga acaaaacaag tctaaaaaga aagcacaaca ggctgccgca 360 gatacgggtc actcgaacca ggtgagtcaa aactacccta tagtacagaa tatacaaggt 420 cagatggttc accaagccat atcacctagg acattaaatg cttgggtaaa agtagtcgag 480 gagaaggcct tctcacctga agtaattccg atgttttctg ctctaagcga aggtgcgaca 540 ccgcaagact tgaacaccat gctaaatacg gtcggtggtc accaagctgc tatgcagatg 600 ttgaaggaaa caatcaacga agaggctgct gaatgggacc gtgtgcaccc tgtgcatgct 660 ggtccaattg cacctggcca gatgaagagaa cctcgtggta gcgacatagc cggtacaaca 720 agtacacttc aggagcaaat aggctggatg acaaacaacc ctcctatacc tgttggtgaa 780 atctataaaa gatggataat cctcggattg aacaaaatag tccgaatgta ttctccaaca 840 agtatcttgg atataaggca aggtccgaaa gaacctttcc gtgattatgt agatagattt 900 tataaaactc tgcgagcaga acaggctagt caagaggtta aaaattggat gaccgaaaca 960 ctactagtac aaaatgcgaa cccagattgt aaaacaatcc tgaaagcact aggaccggct 1020 gccactctgg aggaaatgat gacggcttgt caaggtgttg gtggtcctgg tcacaaagct 1080 cgtgtgcttg ctgaagcgat gtcacaagta acaaactctg ctacgattat gatgcagcgt 1140 ggaaacttcc gaaatcaacg aaaaatcgta aaatgtttca attgtggaaa ggaaggtcac 1200 actgctcgaa actgtcgagc tcctcgcaag aaaggatgct ggaagtgtgg taaggaaggt 1260 caccagatga aagattgtac tgagagacaa gcaaatttcc ttggtaagat ttggccttcg 1320 tataagggta gacctggtaa cttcctacaa tcaagacctg aacctacagc tcctcctgaa 1380 gaatcattcc gaagtggagt ggaaactacc actcctcctc aaaagcaaga gccaattgat 1440 aaagagttat atcctctaac ttcattaagg tctcttttcg gtaacgaccc tagttcgcaa 1500 aacagaaacg gggatccact agttctaga 1529 <210> 5 <211> 1703 <212> DNA <213> Artificial Sequence <220> <223> Baculovirus homologous region 3 DNA sequence <400> 5 aatattagac aacaaagatt tattttattc atgccactac tcggttccgt ttttcaagct 60 gaccagttgt catgcggaaa atgacgtcat tattaatgct ttaaacgagt tacgcaacaa 120 cgttaaagtg gacgctgatt gcgaatcggc caaagaccta tcgcacgttt taaacgcgta 180 cgcttatgtg ggcaatggga tcggttgtag atccgcgtac gacggagatg cgatagtggt 240 aaaaaaagaa gccgtgccca gccacgtgta cgccaacctg aacacgcaat ccaacgacgg 300 cgtcaaatac aatcgttggt tgcacgttaa aaacgaccaa tacatggcgt gtcctgaaga 360 attgtacgat aacgacgaat ttaaatgtaa cgtagaatcg gataaattat attatttgga 420 taatttacaa gaagatcca ttgtataaac attttatgtc gaaaacaaat gacatcagct 480 tatgattcat acttaatcgt gcgttacaag tagaattcta cttgtaaagc gagtttaatt 540 tgaaaaacaa attagtcatt attaaacatg ttaacaatcg tgtataaaaa tgacatcagt 600 ttaatgatga catcatctct tgattatgtt ttacacgtag aattctactc gtaaagccgg 660 ttcagttttg aaaaacaaat gacatcatct ttcgattgtg ttttacacgt agaattctac 720 tcgtaaagcc agttcagttt tgaaaaacaa atgacatcat ttttttaaat tcagttttga 780 aaaacaaatg acatcatctc ttgatcatgt tttacacgta gaattctact cgtaaagcga 840 gttcagtttt gaaaaacaaa tgacatcatt cagttttgaa aaacaaatga catcatcttt 900 cgattgtgtt ttacacgtag aattctactc gtaaagccag ttcagttttg aaaaacaaat 960 gacatcatct tttgattgtg ttttacacgt agaattctac tcgtaaagcc agttcaattt 1020 tgaaaaacaa atgacatcat cttagaggta gacccgtcgc caagacgggt ctgctcatat 1080 gtcgttttgt atttgtcatt gcctcttttc acgacgctgt ctggagcatg ggtatatggc 1140 gtagaccctt ttcatacgtc gttttgtatt tgtcattgac gtgatcgtta attgcttttt 1200 tggtatattg gaaattgtgt taaataaaat gactatattt tttattgaaa attattttat 1260 ttaaaatttt aaataattcc tacaaacatt gaaaacactg taggtatctt ggcacatgca 1320 aacaacgcac ggcctatcgt cgaacaccgc cattacatta tattagcctc tcatacaatc 1380 gttgaacaat tttaataaat aatctttaca agtatcgttt gaaggcctca taaacaattt 1440 atatgattta atatcaatat actttttcaa tctagcctcg aatgggctgt tcacaaatta 1500 cgcttcttcc acaataattg cgtcgtagca aattgccaaa tacttgacgc aactaataac 1560 gtctgaatgg gtttcatctt gagcacacct ccatcatcaa aatcataaaa cgatctattt 1620 gtggggcaaa gctgctgtac cgtataaatc gtataatacg acgcggagaa attaatttct 1680 ggcagggacg taatattgga tcc 1703 <210> 6 <211> 325 <212> DNA <213> Artificial Sequence <220> <223> 6.9 promoter DNA sequence <400> 6 aaattccgtt ttgcgacgat tcagagtttt tgaacaggct gctcaaacac atagatccgt 60 acccgctcag tcggatgtat tacaatgcgg ccaataccat gttttacacg accatggaaa 120 actatgccgt gtccaattgc aagttcaaca ttgaggatta caataacata tttaaggtga 180 tggaaaatat taggaaacac agcaacaaaa atttaaacga ccaagacgag ttaaacatat 240 atttgggagt tcaatcgtcg aatgcaaagc gtaaaaaata ttaataaggt aaaaactaca 300 gctacataaa ttacacaatt taaac 325 <210> 7 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Baculovirus polyhedrin coding DNA promoter sequence <400> 7 caaataaata agtattttac tgttttcgta acagttttgt aataaaaaaa cctataaata 60 60 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Burst DNA sequence <400> 8 ctgttttcgt aacagttttg taataaaaaa acctataaat 40 <210> 9 <211> 239 <212> PRT <213> Artificial Sequence <220> <223> EGFP amino acid sequence <400> 9 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu 1 5 10 15 Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly 20 25 30 Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile 35 40 45 Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr 50 55 60 Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys 65 70 75 80 Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu 85 90 95 Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu 100 105 110 Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly 115 120 125 Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr 130 135 140 Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn 145 150 155 160 Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser 165 170 175 Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly 180 185 190 Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu 195 200 205 Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe 210 215 220 Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys 225 230 235 <210> 10 <211> 720 <212> DNA <213> Artificial Sequence <220> <223> EGFP DNA sequence <400> 10 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720 720 <210> 11 <211> 1386 <212> PRT <213> Artificial Sequence <220> <223> spike mutant protein sequence (H1384R) <400> 11 Met Lys Ser Leu Thr Tyr Phe Trp Leu Phe Leu Pro Val Leu Ser Thr 1 5 10 15 Leu Ser Leu Pro Gln Asp Val Thr Arg Cys Ser Ala Asn Thr Asn Phe 20 25 30 Arg Arg Phe Phe Ser Lys Phe Asn Val Gln Ala Pro Ala Val Val Val 35 40 45 Leu Gly Gly Tyr Leu Pro Ile Gly Glu Asn Gln Gly Val Asn Ser Thr 50 55 60 Trp Tyr Cys Ala Gly Gln His Pro Thr Ala Ser Gly Val His Gly Ile 65 70 75 80 Phe Val Ser His Ile Arg Gly Gly His Gly Phe Glu Ile Gly Ile Ser 85 90 95 Gln Glu Pro Phe Asp Ser Ser Gly Tyr Gln Leu Tyr Leu His Lys Ala 100 105 110 Thr Asn Gly Asn Thr Asn Ala Thr Ala Arg Leu Arg Ile Cys Gln Phe 115 120 125 Pro Ser Ile Lys Thr Leu Gly Pro Thr Ala Asn Asn Asp Val Thr Thr 130 135 140 Gly Arg Asn Cys Leu Phe Asn Lys Ala Ile Pro Ala His Met Ser Glu 145 150 155 160 His Ser Val Val Gly Ile Thr Trp Asp Asn Asp Arg Val Thr Val Phe 165 170 175 Ser Asp Lys Ile Tyr Tyr Phe Tyr Phe Lys Asn Asp Trp Ser Arg Val 180 185 190 Ala Thr Lys Cys Tyr Asn Ser Gly Gly Cys Ala Met Gln Tyr Val Tyr 195 200 205 Glu Pro Thr Tyr Tyr Met Leu Asn Val Thr Ser Ala Gly Glu Asp Gly 210 215 220 Ile Ser Tyr Gln Pro Cys Thr Ala Asn Cys Ile Gly Tyr Ala Ala Asn 225 230 235 240 Val Phe Ala Thr Glu Pro Asn Gly His Ile Pro Glu Gly Phe Ser Phe 245 250 255 Asn Asn Trp Phe Leu Leu Ser Asn Asp Ser Thr Leu Val His Gly Lys 260 265 270 Val Val Ser Asn Gln Pro Leu Leu Val Asn Cys Leu Leu Ala Ile Pro 275 280 285 Lys Ile Tyr Gly Leu Gly Gln Phe Phe Ser Phe Asn Gln Thr Ile Asp 290 295 300 Gly Val Cys Asn Gly Ala Ala Val Gln Arg Ala Pro Glu Ala Leu Arg 305 310 315 320 Phe Asn Ile Asn Asp Thr Ser Val Ile Leu Ala Glu Gly Ser Ile Val 325 330 335 Leu His Thr Ala Leu Gly Thr Asn Phe Ser Phe Val Cys Ser Asn Ser 340 345 350 Ser Asn Pro His Leu Ala Thr Phe Ala Ile Pro Leu Gly Ala Thr Gln 355 360 365 Val Pro Tyr Tyr Cys Phe Leu Lys Val Asp Thr Tyr Asn Ser Thr Val 370 375 380 Tyr Lys Phe Leu Ala Val Leu Pro Pro Thr Val Arg Glu Ile Val Ile 385 390 395 400 Thr Lys Tyr Gly Asp Val Tyr Val Asn Gly Phe Gly Tyr Leu His Leu 405 410 415 Gly Leu Leu Asp Ala Val Thr Ile Asn Phe Thr Gly His Gly Thr Asp 420 425 430 Asp Asp Val Ser Gly Phe Trp Thr Ile Ala Ser Thr Asn Phe Val Asp 435 440 445 Ala Leu Ile Glu Val Gln Gly Thr Ala Ile Gln Arg Ile Leu Tyr Cys 450 455 460 Asp Asp Pro Val Ser Gln Leu Lys Cys Ser Gln Val Ala Phe Asp Leu 465 470 475 480 Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His Glu 485 490 495 Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe 500 505 510 Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly His Ser Gly Ala Asn 515 520 525 Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val 530 535 540 Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn Ser 545 550 555 560 Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu 565 570 575 Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr 580 585 590 Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu 595 600 605 Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys 610 615 620 Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr Asp 625 630 635 640 Val Ser Phe Met Thr Leu Asp Val Cys Thr Lys Tyr Thr Ile Tyr Gly 645 650 655 Phe Lys Gly Glu Gly Ile Ile Thr Leu Thr Asn Ser Ser Phe Leu Ala 660 665 670 Gly Val Tyr Tyr Thr Ser Asp Ser Gly Gln Leu Leu Ala Phe Lys Asn 675 680 685 Val Thr Ser Gly Ala Val Tyr Ser Val Thr Pro Cys Ser Phe Ser Glu 690 695 700 Gln Ala Ala Tyr Val Asp Asp Asp Ile Val Gly Val Ile Ser Ser Leu 705 710 715 720 Ser Ser Ser Thr Phe Asn Ser Thr Arg Glu Leu Pro Gly Phe Phe Tyr 725 730 735 His Ser Asn Asp Gly Ser Asn Cys Thr Glu Pro Val Leu Val Tyr Ser 740 745 750 Asn Ile Gly Val Cys Lys Ser Gly Ser Ile Gly Tyr Val Pro Ser Gln 755 760 765 Ser Gly Gln Val Lys Ile Ala Pro Thr Val Thr Gly Asn Ile Ser Ile 770 775 780 Pro Thr Asn Phe Ser Met Ser Ile Arg Thr Glu Tyr Leu Gln Leu Tyr 785 790 795 800 Asn Thr Pro Val Ser Val Asp Cys Ala Thr Tyr Val Cys Asn Gly Asn 805 810 815 Ser Arg Cys Lys Gln Leu Leu Thr Gln Tyr Thr Ala Ala Cys Lys Thr 820 825 830 Ile Glu Ser Ala Leu Gln Leu Ser Ala Arg Leu Glu Ser Val Glu Val 835 840 845 Asn Ser Met Leu Thr Ile Ser Glu Glu Ala Leu Gln Leu Ala Thr Ile 850 855 860 Ser Ser Phe Asn Gly Asp Gly Tyr Asn Phe Thr Asn Val Leu Gly Val 865 870 875 880 Ser Val Tyr Asp Pro Ala Ser Gly Arg Val Val Gln Lys Arg Ser Phe 885 890 895 Ile Glu Asp Leu Leu Phe Asn Lys Val Val Thr Asn Gly Leu Gly Thr 900 905 910 Val Asp Glu Asp Tyr Lys Arg Cys Ser Asn Gly Arg Ser Val Ala Asp 915 920 925 Leu Val Cys Ala Gln Tyr Tyr Ser Gly Val Met Val Leu Pro Gly Val 930 935 940 Val Asp Ala Glu Lys Leu His Met Tyr Ser Ala Ser Leu Ile Gly Gly 945 950 955 960 Met Val Leu Gly Gly Phe Thr Ser Ala Ala Ala Leu Pro Phe Ser Tyr 965 970 975 Ala Val Gln Ala Arg Leu Asn Tyr Leu Ala Leu Gln Thr Asp Val Leu 980 985 990 Gln Arg Asn Gln Gln Leu Leu Ala Glu Ser Phe Asn Ser Ala Ile Gly 995 1000 1005 Asn Ile Thr Ser Ala Phe Glu Ser Val Lys Glu Ala Ile Ser Gln Thr 1010 1015 1020 Ser Lys Gly Leu Asn Thr Val Ala His Ala Leu Thr Lys Val Gln Glu 1025 1030 1035 1040 Val Val Asn Ser Gln Gly Ala Ala Leu Thr Gln Leu Thr Val Gln Leu 1045 1050 1055 Gln His Asn Phe Gln Ala Ile Ser Ser Ser Ile Asp Asp Ile Tyr Ser 1060 1065 1070 Arg Leu Asp Ile Leu Ser Ala Asp Val Gln Val Asp Arg Leu Ile Thr 1075 1080 1085 Gly Arg Leu Ser Ala Leu Asn Ala Phe Val Ala Gln Thr Leu Thr Lys 1090 1095 1100 Tyr Thr Glu Val Gln Ala Ser Arg Lys Leu Ala Gln Gln Lys Val Asn 1105 1110 1115 1120 Glu Cys Val Lys Ser Gln Ser Gln Arg Tyr Gly Phe Cys Gly Gly Asp 1125 1130 1135 Gly Glu His Ile Phe Ser Leu Val Gln Ala Ala Pro Gln Gly Leu Leu 1140 1145 1150 Phe Leu His Thr Val Leu Val Pro Ser Asp Phe Val Asp Val Ile Ala 1155 1160 1165 Ile Ala Gly Leu Cys Val Asn Asp Glu Ile Ala Leu Thr Leu Arg Glu 1170 1175 1180 Pro Gly Leu Val Leu Phe Thr His Glu Leu Gln Asn His Thr Ala Thr 1185 1190 1195 1200 Glu Tyr Phe Val Ser Ser Arg Arg Met Phe Glu Pro Arg Lys Pro Thr 1205 1210 1215 Val Ser Asp Phe Val Gln Ile Glu Ser Cys Val Val Thr Tyr Val Asn 1220 1225 1230 Leu Thr Arg Asp Gln Leu Pro Asp Val Ile Pro Asp Tyr Ile Asp Val 1235 1240 1245 Asn Lys Thr Leu Asp Glu Ile Leu Ala Ser Leu Pro Asn Arg Thr Gly 1250 1255 1260 Pro Ser Leu Pro Leu Asp Val Phe Asn Ala Thr Tyr Leu Asn Leu Thr 1265 1270 1275 1280 Gly Glu Ile Ala Asp Leu Glu Gln Arg Ser Glu Ser Leu Arg Asn Thr 1285 1290 1295 Thr Glu Glu Leu Gln Ser Leu Ile Tyr Asn Ile Asn Asn Thr Leu Val 1300 1305 1310 Asp Leu Glu Trp Leu Asn Arg Val Glu Thr Tyr Ile Lys Trp Pro Trp 1315 1320 1325 Trp Val Trp Leu Ile Ile Phe Ile Val Leu Ile Phe Val Val Ser Leu 1330 1335 1340 Leu Val Phe Cys Cys Ile Ser Thr Gly Cys Cys Gly Cys Cys Gly Cys 1345 1350 1355 1360 Cys Cys Ala Cys Phe Ser Gly Cys Cys Arg Gly Pro Arg Leu Gln Pro 1365 1370 1375 Tyr Glu Val Phe Glu Lys Val Arg Val Gln 1380 1385 <210> 12 <211> 4161 <212> DNA <213> Artificial Sequence <220> <223> spike mutant DNA sequence (H1384R) <400> 12 atgaagtctt taacctactt ctggttgttc ttaccagtac tttcaacact tagcctacca 60 caagatgtca ccaggtgctc agctaacact aattttaggc ggttcttttc aaaatttaat 120 gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga aaaccagggt 180 gtcaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt tcatggtatc 240 tttgttagcc atattagagg tggtcatggc tttgagattg gcatttcgca agagcctttt 300 gactctagtg gttaccagct ttatttacat aaggctacta acggtaacac taatgctact 360 gcgcgactgc gcatttgcca gtttcctagc attaaaacat tgggccccac tgctaataat 420 gatgttacaa caggtcgtaa ttgcctattt aacaaagcca tcccagctca tatgagtgaa 480 catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc tgacaagatc 540 tattattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta caacagtgga 600 ggttgtgcta tgcaatatgt ttacgaaccc acctattaca tgcttaatgt tactagtgct 660 ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720 gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780 cttttgtcca atgattccac tttggtgcat ggtaaggtgg tttccaacca accattgttg 840 gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt ctcctttaat 900 caaacgatcg atggcgtttg taatggagct gctgtgcagc gtgcaccaga ggctctgagg 960 tttaacatta atgacacctc tgtcattctt gctgaaggct caattgtact tcatactgct 1020 ttaggaacaa atttttcttt tgtttgcagt aattcctcaa atcctcactt agctaccttc 1080 gccatacctc tgggtgctac ccaagtacct tattattgtt ttcttaaagt ggatacttac 1140 aactccactg tttataaatt tttggctgtt ttacctccta ccgtcaggga aattgtcatc 1200 accaagtatg gtgatgttta tgtcaatggg tttggatact tgcatctcgg tttgttggat 1260 gctgtcacaa ttaatttcac tggtcatggc actgacgatg atgtttctgg tttttggacc 1320 atagcatcga ctaattttgt tgatgcactc atcgaagttc aaggaaccgc cattcagcgt 1380 attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc ttttgacctt 1440 gacgatggtt tttaccctat ttcttctaga aaccttctga gtcatgaaca gccaatttct 1500 tttgttactc tgccatcatt taatgatcat tcttttgtta acattactgt atctgcttcc 1560 tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa tgggtttagt 1620 tctttctgtg ttgacactag acaatttacc atttcactgt tttataacgt tacaaacagt 1680 tatggttatg tgtctaaatc acaggacagt aattgccctt tcaccttgca atctgttaat 1740 gattacctgt cttttagcaa attttgtgtt tccaccagcc ttttggctag tgcctgtacc 1800 atagatcttt ttggttaccc tgagtttggt agtggtgtta agtttacgtc cctttacttt 1860 caattcacaa agggtgagtt gattactggc acgcctaaac cacttgaagg tgtcacggac 1920 gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt taaaggtgag 1980 ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattacac atctgattct 2040 ggacagttgt tagcctttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100 tctttttcag agcaggctgc atatgttgat gatgatatag tgggtgttat ttctagtttg 2160 tctagctcca cttttaacag tactagggag ttgcctggtt tcttctacca ttctaatgat 2220 ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg taaatctggc 2280 agtattggct acgtcccatc tcagtctggc caagtcaaga ttgcacccac ggttactggg 2340 aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt acagctttac 2400 aacacgcctg ttagtgttga ttgtgccaca tatgtttgta atggtaactc tcgttgtaaa 2460 caattactca cccagtacac tgcagcatgt aagaccatag agtcagcatt acaactcagc 2520 gctaggcttg agtctgttga agttaactct atgcttacta tttctgaaga ggctctacag 2580 ttagctacca ttagttcgtt taatggtgat ggatataatt tactaatgt gctgggtgtt 2640 tctgtgtatg atcctgcaag tggcagggtg gtacaaaaaa ggtcttttat tgaagacctg 2700 ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760 tctaatggtc gttctgtggc agatctagtc tgtgcacagt attactctgg tgtcatggta 2820 ctacctggtg ttgttgacgc tgagaagctt cacatgtata gtgcgtctct catcggtggt 2880 atggtgctag gaggttttac ttctgcagcg gcattgcctt ttagctatgc tgttcaagct 2940 agactcaatt atcttgctct acagacggat gttctacagc ggaaccagca attgcttgct 3000 gagtctttta actctgctat tggtaatata acttcagcct ttgagagtgt taaagaggct 3060 attagtcaaa cttccaaggg tttgaacact gtggctcatg cgcttactaa ggttcaagag 3120 gttgttaact cgcagggtgc agctttgact caacttaccg tacagctgca acacaacttc 3180 caagccattt ctagttctat tgatgacatt tactctcgac tggacattct ttcagccgat 3240 gttcaggttg accgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300 accctcacta agtatactga ggttcaggct agcaggaagt tagcacagca aaaggttaat 3360 gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatt 3420 ttctctctgg tacaggcagc acctcagggc ctgctgtttt tacatacagt acttgtaccg 3480 agtgattttg tagatgttat tgccatcgct ggcttatgcg ttaacgatga aattgccttg 3540 actctacgtg agcctggctt agtcttgttt acgcatgaac ttcaaaatca tactgcgacg 3600 gaatattttg tttcatcgcg acgtatgttt gaacctagaa aacctaccgt tagtgatttt 3660 gttcaaattg agagttgtgt ggtcacctat gtcaatttga ctagagacca actaccagat 3720 gtaatcccag attacatcga tgttaacaaa acacttgatg agattttagc ttctctgccc 3780 aatagaactg gtccaagtct tcctttagat gtttttaatg ccacttatct taatctcact 3840 ggtgaaattg cagatttaga gcagcgttca gagtctctcc gtaatactac agaggagctc 3900 caaagtctta tatataatat caacaacaca ctagttgacc ttgagtggct caaccgagtt 3960 gagacatata tcaagtggcc gtggtgggtt tggttgatta ttttcattgt tctcatcttt 4020 gttgtgtcat tactagtgtt ctgctgcatt tccacgggtt gttgtggatg ctgcggctgc 4080 tgctgtgctt gtttctcagg ttgttgtagg ggtcctagac ttcaacctta cgaagttttt 4140 gaaaaggtcc gcgtgcagtg a 4161

Claims (14)

pr55 (Gag) protein of human immunodeficiency virus (HIV); and
Swine epidemic diarrhea virus (Porcine epidemic diarrhea virus; PEDV) of the spike protein (spike protein; S); Containing,
Chimeric swine epidemic diarrhea virus-like particles. According to claim 1,
The spike protein is a chimeric porcine epidemic diarrhea virus-like particle, characterized in that it consists of an amino acid represented by SEQ ID NO: 1 or SEQ ID NO: 11. According to claim 1,
The pr55 (Gag) protein of the human immunodeficiency virus (HIV) is a chimeric swine epidemic diarrhea virus-like particle, characterized in that it consists of the amino acid represented by SEQ ID NO: 3. A vaccine composition comprising the chimeric porcine epidemic diarrhea virus-like particles of any one of claims 1 to 3. a nucleotide sequence encoding the pr55 (Gag) protein of human immunodeficiency virus (HIV); and
A nucleotide sequence encoding a spike protein of porcine epidemic diarrhea virus (PEDV); including,
Recombinant expression vector for production of chimeric porcine epidemic diarrhea virus-like particles. 6. The method of claim 5,
The nucleotide sequence encoding the pr55 (Gag) protein of the HIV (human immunodeficiency virus) is a nucleotide sequence consisting of SEQ ID NO: 4,
The base sequence encoding the spike protein of the porcine epidemic diarrhea virus (PEDV) is a nucleotide sequence consisting of SEQ ID NO: 2 or SEQ ID NO: 12, characterized in that the chimeric swine epidemic diarrhea virus - Recombinant expression vector for the production of pseudoparticles. 6. The method of claim 5,
The recombinant expression vector encodes baculovirus hr3 (homologous region 3) represented by SEQ ID NO: 5, p6.9 promoter represented by SEQ ID NO: 6, and polyhedrin protein of baculovirus represented by SEQ ID NO: 7 The gene promoter, characterized in that it further comprises a Burst sequence represented by SEQ ID NO: 8, chimeric porcine epidemic diarrhea virus-recombinant expression vector for preparing particles. 8. The method of claim 7,
The recombinant expression vector is a pBm-p6.9v-Gag-EGFP-S (-19aa) vector or a pBm-p6.9v-Gag-EGFP-S (H1384R) vector having the cleavage map of FIG. Recombinant expression vector for production of chimeric porcine epidemic diarrhea virus-like particles. A host cell transformed with the recombinant expression vector of claim 5 . 10. The method of claim 9,
The host cell is any one selected from the group consisting of BT1-Tn-5B1-4 cells, Hi5 cells, LD652Y cells, Sf9 cells, Sf21 cells, Kc1 cells, SL2 cells, Bm5 cells, BmN cells and mosquito cells. Host cells, characterized in that the insect cells of. 11. The method of claim 10,
The insect is a host cell, characterized in that any one selected from the group consisting of Bombyx mori, Spodoptera frugiperda, Trichoplusia ni and Galleria mellonella. (1) preparing a recombinant baculovirus using the recombinant expression vector of claim 5;
(2) infecting a host cell with the recombinant baculovirus;
(3) culturing the host cell and obtaining the culture; and
(4) comprising the step of obtaining chimeric porcine epidemic diarrhea virus-like particles from the culture,
A method for producing virus-like particles for vaccines for the prevention or treatment of swine epidemic diarrhea. 13. The method of claim 12,
The host cell is any one selected from the group consisting of BT1-Tn-5B1-4 cells, Hi5 cells, LD652Y cells, Sf9 cells, Sf21 cells, Kc1 cells, SL2 cells, Bm5 cells, BmN cells and mosquito cells. A method for producing virus-like particles for vaccines for the prevention or treatment of swine epidemic diarrhea, characterized in that the insect cells of the. 13. The method of claim 12,
In the step (4), the chimeric porcine epidemic diarrhea virus-like particles are released into the culture medium through budding in the plasma membrane of the host cell. A method for producing particles.

Images