CN113943714B

CN113943714B - Callicarpa virus strain and application thereof

Info

Publication number: CN113943714B
Application number: CN202111402965.XA
Authority: CN
Inventors: 夏振强; 王倩; 张馨月; 赵健; 付玉; 郎佳宝; 方爽爽; 金宏丽; 石晶
Original assignee: Changchun Sr Biological Technology Co ltd
Current assignee: Changchun Sr Biological Technology Co ltd
Priority date: 2021-11-24
Filing date: 2021-11-24
Publication date: 2023-09-29
Anticipated expiration: 2041-11-24
Also published as: CN113943714A

Abstract

The invention discloses a feline calicivirus strain and application thereof, and belongs to the technical field of medicines. In order to provide a feline calicivirus strain for preparing vaccine, the invention provides a feline calicivirus strain named FCV-CCSN-1 which is preserved in China general microbiological culture Collection center for 2021, 10 months and 19 days. The content of virus is more than or equal to 10 ^9.75 TCID ₅₀ And/ml, the vaccine is prepared by adding an adjuvant after BEI inactivation, the preparation method is simple, can prepare the feline calicivirus vaccine in a large amount, has short time consumption and high expression, greatly reduces the production cost, and is beneficial to mass production. The immune effect is good, the immune dose is small, and the infection of the feline calicivirus can be effectively prevented.

Description

Callicarpa virus strain and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to a feline calicivirus strain and application thereof.

Background

Infectious rhinoconjunctivitis in cats is caused by feline infectious rhinoconjunctivitis virus, also known as feline calicivirus (feline calicivirus, FCV), and is clinically characterized by rhinitis, conjunctivitis, acute oral ulcers, pneumonia, and chronic gastritis. FCV is currently thought to be worldwide and may infect all felines, as well as dogs. FCV is very common in cat flocks and foreign studies have shown that wild cats and flushant cats have a higher probability of infecting FCV than privately raised domestic cats. In addition, when the number of domestic cats is small, the prevalence is about 10%; the prevalence rate of the cat group with a large number reaches 25% -40%. FCV is mainly invasive to young cats of 6-84 days old, and is most susceptible to cats of 56-84 days old and under 1 year old, with lower day-old cats having higher mortality rates after infection. Diseased cats and recessively infected cats are the primary sources of infection for FCV. The virus can be spread to the outside along with saliva, tears and nasal secretions of the cat, pollute cages, cat beds, padding and surrounding environment, and can also be directly transmitted to susceptible cats. FCV can survive for days to weeks in dry environments at room temperature and is more viable in cold, humid environments, which greatly increases the likelihood of indirect transmission. For a population of cats with greater density, the virus can be expelled with secretions and excretions, contaminating the foodware and cages, and being transmitted indirectly or directly to the susceptible cats. The sick cat can carry toxin and expel toxin for a long time after recovery and is used as an infectious source.

At present, no specific treatment method for the infectious rhinoconjunctivitis of cats exists, the vaccine is widely used clinically for preventing the infectious rhinoconjunctivitis, common vaccines mainly comprise inactivated vaccines and attenuated live vaccines, but only the clinical morbidity and the viral discharge can be reduced, and the infection cannot be prevented. The prior inactivated vaccine has the advantages of good safety, capability of reducing clinical symptoms caused by FCV, and incapability of inducing effective mucosal immunity and cellular immune response, thereby being incapable of effectively inhibiting the replication of FCV in respiratory tract. Attenuated live vaccine can better stimulate the organism to generate protective immunity, but has the problem of virulence reversion. There is evidence that attenuated live vaccines may in some cases cause clinical symptoms and even epidemic infections.

It is considered that the outbreak of diseases and vaccine immunity failure caused by the FCV virulent strain are closely related to the gene of FCV and the antigen diversity thereof. FCV belongs to RNA viruses, RNA is often imprecise, the genome is highly adaptable, and rapid evolution is manifested by selection pressure, as opposed to relatively precise DNA replication gene information. Like many other RNA viruses, the presence of multiple hypervariable regions on the FCV capsid protein confers a rich antigen diversity, which accounts for the emergence of escape mutants at the immunodominant site of the variable region of the capsid protein gene. Some studies suggest that the variation of FCV antigen is derived from vaccine-induced immune stress. Although FCV has only one serotype, the difference between strains is relatively large due to the use of commercial vaccines and the variation of FCV, the cross protection reaction between wild strains and attenuated live vaccine F9 strains is gradually weakened, the prevention and control capability of the existing vaccine on the current epidemic strains is limited, and vaccine immunity failure occurs. Therefore, the separation of epidemic strains, the preparation of vaccines and yolk antibodies against epidemic strains, has important significance.

Disclosure of Invention

The invention aims to provide a feline calicivirus strain for preparing vaccines and preparing egg yolk antibodies.

The invention provides a strain of feline calicivirus (feline calicivirus), which is named FCV-CCSN-1 and is preserved in China general microbiological culture Collection center (China general microbiological culture Collection center) for 10 months and 19 days in 2021, wherein the preservation number is: CGMCC No.21927.

The use of the feline calicivirus strain described above for the construction of an animal model for evaluating cell metabolism, transcription and immunity after infection of cells by the feline calicivirus strain.

The present invention provides a vaccine composition comprising a vaccine acceptable carrier and a feline calicivirus strain or derivative virus thereof as defined in claim 1.

Further defined, the vaccine composition is a bivalent vaccine or a multivalent vaccine.

Further defined, the content of the strain of the feline calicivirus is more than or equal to 10 ^9.00 TCID ₅₀ /ml。

Further defined, the feline calicivirus strain is BEI inactivated.

Further defined, the vaccine composition further comprises a vaccine adjuvant.

Further defined, the vaccine adjuvant is a water-soluble adjuvant or an oily adjuvant.

Use of the feline calicivirus described above or the vaccine composition described above in the manufacture of a medicament for the prevention or treatment of respiratory infectious diseases.

Further defined, the respiratory infectious disease is feline infectious rhinoconjunctivitis.

The beneficial effects are that: the vaccine prepared by the invention prepares the yolk antibody of the FCV-CCSN-1 immunized laying hen, and the immune group has FCV neutralization titer generated 1 week after the third immunization. And with the increase of the immunization times, the titer of the neutralizing antibody is gradually increased, the titer of the neutralizing antibody is not lower than 1:16 after the five-immune is carried out, and the titer of the neutralizing antibody is not lower than 1:45 after the six-immune is carried out for 1 week. The FCV-CCSN-1 antigen can be used for successfully preparing the FCV yolk antibody, and the titer of the FCV neutralizing antibody after six-immunity is not lower than 1:45.

The use of FCV-CCSN-1 strain is two aspects: (1) The antigen is supplemented with a water-soluble adjuvant, so that the cat can be immunized, and the antigen can be used for preparing a preventive vaccine. (2) The egg yolk antibody can be prepared after chicken is immunized by being assisted with an oily adjuvant.

The cat calicivirus strain is named FCV-CCSN-1 and is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) at the year 10 and the day 19 of 2021, and the preservation addresses are: the collection number of Beijing city, the North Chen Xili No. 1, 3 is: CGMCC No.21927.

Drawings

FIG. 1 shows the results of PCR detection in example 1, wherein 1: negative control, 2: FCV-CCSN-1; m: DL 2000DNA markers;

FIG. 2 shows the result of isolated culture of FCV in example 1, wherein A: FCV-CCSN-1 infected F81 cells; b: normal F81 cells;

fig. 3 is an immunofluorescence picture of example 1, wherein a: FCV-CCSN-1 infected F81 cells; b: normal F81 cells;

FIG. 4 is a full length sequencing PCR electrophoretogram of example 2, wherein 1-2: a P1 fragment; 3-4: a P2 fragment; 5-6: a P3 fragment; m: DL 5000DNA Marker;

FIG. 5 is a representation of the FCV ORF2 sequence evolutionary tree in example 2;

FIG. 6 is an analysis of the sequence homology of FCV ORF2 in example 2;

FIG. 7 is a graph showing FCV neutralizing antibody titers after immunization of cats in example 3, wherein the abscissa represents the number of immunization weeks and the ordinate represents FCV neutralizing antibody titers;

FIG. 8 shows FCV neutralizing antibody titers in yolk in example 5, wherein the abscissa represents the number of immunization weeks and the ordinate represents FCV neutralizing antibody titers.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

And analyzing whether the scores of the vaccine group after the challenge and the control group are obviously different or not by adopting a European pharmacopoeia scoring method, and evaluating the effectiveness of the vaccine.

EXAMPLE 1 isolation and characterization of FCV-CCSN-1

1. Sample preparation

Nasal swabs and pharyngeal swabs from cats with natural clinical morbidity in Jilin province were collected, 500 μl PBS was added, and shaking was uniform. Centrifugation was performed at 13000r/min for 5min at 4 ℃. The cotton swab in the centrifuge tube is inverted and centrifuged at 13000r/min for 1min at 4 ℃. Discarding cotton swab, adding double antibody at 1/20 ratio, mixing, and storing at-70deg.C.

2. PCR detection

And (3) extracting sample RNA from the prepared tissue fluid by using an RNA extraction kit, wherein the method is shown in the specification. RNA was either stored at-70℃or immediately reverse transcribed into cDNA. The reverse transcription system was as follows, in a water bath at 42℃for 50min. The cDNA was stored at-20 ℃.

TABLE 1 reverse transcription system

PCR was performed using identified primers as follows: FCV-681-F: CAACCTGCGCTAACGTGCTTA; FCV-681-R: TTCCCCCAAAAACYCCAGATC. The PCR system is as follows: each sample was concentrated with 2.5. Mu.l of buffer solution concentrated with 10 times Taq enzyme, 2.5mmol/L dNTP 2. Mu.l, 0.3. Mu.l of Taq enzyme, 2. Mu.l of cDNA template, 0.5. Mu.l of upstream primer and downstream primer (F1, R1, 10. Mu. Mol/L) and 17.2. Mu.l of triple distilled water to prepare a PCR detection system. The reaction conditions are as follows: pre-denaturation at 94℃for 5min; carrying out 35 cycles at 94 ℃ for 30s,57 ℃ for 30s and 72 ℃ for 1min; finally, the temperature is 72 ℃ for 10min. As a result of detection by 1% agarose electrophoresis, the size of the nucleotide fragment to be amplified was 681bp.

The PCR amplification product appeared to band around 681bp, consistent with the expected size, see FIG. 1. The target band is cut and recovered, and is sent to Jilin Kumei biotechnology Co., ltd for sequencing, and the sequencing result is compared with NCBI website, so that the result is highly similar to the cat calicivirus gene.

3. Virus isolation culture

F81 cells (F81 cat kidney cells) were passaged to 25cm ² Cell bottle, when the cells grow into single layer, adding the treated tissue fluid into cell culture bottle, 37 deg.C, 5% CO ₂ Incubate in incubator for 1 hour. After the incubation, the culture medium was added to the cell flask to 6ml. The cell flask was placed in 5% CO at 37 ℃C ₂ In the incubator, cytopathic conditions were observed every 12 hours. After cytopathy, the virus liquid is repeatedly frozen and thawed for 2 times (generation P1), and the virus liquid is blindly transferred to generation P3. At the same time, normal cell control was set.

The treated disease was inoculated with F81 cells and serial passage to passage 3, all with typical lesions seen as shed, round, grape bunch (fig. 2A), whereas normal F81 cells were free of cytopathic effect (fig. 2B).

4. Determination of viral content

The P3-generation virus solution was serially diluted 10-fold with MEM medium, and each dilution was inoculated onto a monolayer of F81 cells, and the virus solution was 100. Mu.l/well, and 4 wells were repeated for each dilution. 37 ℃ and 5% CO ₂ Culturing in a constant temperature incubator for 2-4 days, recording cytopathic effect of each dilution, and calculating TCID according to Reed-Muench method ₅₀ 。

The virus content of the harvested P3 generation virus liquid can reach 10 ^9.75 TCID ₅₀ /ml。

5. Indirect immunofluorescence assay

The separated P3 generation virus liquid is serially diluted by 10 times and then inoculated with F81 cells, and 5 percent CO is arranged at 37 DEG C ₂ Culturing under the condition, fixing with 80% cold acetone after 3 days, staining with FCV specific monoclonal antibody as primary antibody and FITC labeled goat anti-mouse IgG as secondary antibody, and observing the result under a fluorescence microscope.

The harvested P3 generation virus liquid is inoculated with F81 cells and cultured for 3 days for indirect immunofluorescence detection. The results showed that virus-infected F81 cells exhibited high intensity green fluorescence (FIG. 3A), while control cells did not have visible fluorescence (FIG. 3B), indicating that feline calicivirus, designated FCV-CCSN-1 strain, had been isolated.

EXAMPLE 2 full Length genome sequencing analysis

1. Gene amplification

The extracted viral RNA was reverse transcribed into cDNA, and the full-length gene was divided into 3 segments by using the primers of Table 2 (see "isolation and identification of feline calicivirus strain 1 and genetic evolution analysis of ORF2 sequence thereof", animal husbandry and veterinary medicine, 2021, vol. 53, 2 nd, pages 92-96) as a template, and subjected to segment PCR amplification. The PCR reaction used a 25. Mu.l reaction system: prime STAR Max DNA Polymerase 12.5.5. Mu.l, 3. Mu.l template, 1. Mu.l each of the upstream and downstream primers (10. Mu. Mol/L), ddH ₂ O7.5. Mu.l. The above reagents were thoroughly mixed and amplified under the following conditions: pre-denaturation at 98℃for 1min; denaturation at 98℃for 10s, renaturation at 55℃for 15s, extension at 72℃for 25s,35 cyclesA ring; finally, the extension is carried out at 72 ℃ for 7min. The result of electrophoresis of the amplified products is shown in FIG. 4.

TABLE 2 full-length sequencing primers

2. Ligation transformation

Each segment of gene is respectively connected with a vector, and the specific steps are as follows: mu.l of the gel recovery product was gently mixed with 1. Mu.l of pEASY-Blunt cloning vector, reacted at 25℃for 15min and then placed on ice. The Trans1-T1 phase resistance competent cells are taken out from a refrigerator at the temperature of-70 ℃, the connection product is added when melting, the ice bath is carried out for 30min after flicking and mixing, and the heat shock is carried out at the temperature of 42 ℃ for 1min and the ice bath is carried out for 3min. Mu.l of the non-resistant LB liquid medium was aseptically added, and the mixture was shaken at a constant temperature of 200rpm at 37℃for 1 hour. Centrifuging at 4000rpm for 2min, retaining 100 μl supernatant, suspending thallus, and coating on LB-Amp ⁺ Culturing in an inverted manner for 12-14 h in an incubator at 37 ℃ on an agar plate.

After visible colonies on agar plates, each plate was aseptically picked up colonies on 2mL LB-Amp ⁺ Culturing in liquid culture medium at 37 deg.c and 200rpm for 10-12 hr.

3. PCR identification and sequencing

PCR was performed using 1. Mu.l of the bacterial liquid as a template and the universal primer M13F/R of pEASY-Blunt vector. And (3) carrying out agarose gel electrophoresis identification on the PCR product, and taking plasmids with positive PCR identification for sequencing. And splicing the sequencing result by DNAStar-Seqman to obtain the genome sequence of the FCV-CCSN-1 strain (the specific sequence is shown as SEQ ID NO: 1).

4. Sequence analysis

The FCV chinese strain sequences were downloaded from GenBank, see table 3. The downloaded reference sequence was analyzed with the ORF2 sequence of FCV-CCSN-1 strain. The MEGA 4 software was used for the drawing of the evolutionary tree and DNAStar-MegAlign software was used for the homology alignment. The results of the evolutionary tree are shown in FIG. 5, wherein the FCV-CCSN-1 strain is in the same branch as the strain isolated in recent years. The homology analysis result (FIG. 6) shows that the FCV-CCSN-1 strain has the highest homology with GX01-13 strain of 82.8%, the lowest homology with SH strain of 72.9%, and the homology with the other strains of 73.4% -78.1%. The isolated FCV strain is shown to have low homology with published strain sequences.

TABLE 3 sequences for homology analysis

EXAMPLE 3 safety and immunogenicity evaluation of FCV-CCSN-1 inactivated vaccine

1. Preparation of inactivated vaccine

Diluting antigen with MEM culture solution to virus content of 10 ^9.00 TCID ₅₀ Per ml, 0.002mol/LBEI was added and after inactivation at 30℃for 24 hours, sodium thiosulfate was added to neutralize BEI at a final concentration of 0.002 mol/L.

Taking inactivated antigen, diluting and inoculating F81 cells with 10 times of dilution to form good monolayer for 25cm ² In the bottle, each inactivated sample is inoculated with 2 bottles, each bottle is inoculated with 1ml, 9ml of cell maintenance solution is supplemented, the bottle is cultured at 37 ℃, the bottle is continuously cultured for 3 days and then is transferred for 1 generation, and meanwhile, normal cell control and virus control are set. And judging that the virus control shows cytopathy and the inactivated virus liquid and the normal cell control are qualified after the cytopathy is not seen.

And adding the Montanide Gel 02PR adjuvant into the antigen which is qualified in the inactivation test according to the proportion of 7:1, uniformly mixing to prepare the vaccine, and preserving at the temperature of 2-6 ℃.

2. Safety evaluation

5 healthy and susceptible cats (FCV neutralizing antibody titer is not higher than 1:4) of 8-12 weeks of age are used, each cat is subcutaneously injected with 2ml of vaccine, and the daily observation is carried out for 14 days, and the mental, appetite, body temperature and fecal properties are recorded daily.

After the vaccine is inoculated on the cat in one overdose, the cat is continuously observed for 14 days, no local and systemic adverse reaction caused by the vaccine exists in the cat, and the anatomic and histological examination is carried out on the partially immunized kittens, so that no macroscopic pathological change exists.

3. Immunogenicity evaluation

The inactivated vaccine is subcutaneously injected into 5 healthy cats (FCV neutralizing antibody titer is not higher than 1:4) of 8-12 weeks old, each of which is 0.5ml, and the other 5 cats are inoculated with 0.5ml of MEM culture solution subcutaneously at the neck of the other cat to serve as control cats. Two immunizations were performed at 21 day intervals. 21 days after the boost, serum was collected and isolated, and FCV neutralizing antibody titers were determined.

FCV neutralizing antibody titer determination: diluting serum to be detected by 2 times ratio, and mixing with 100TCID of equal volume ₅₀ FCV-CCSN-1 mixture, at 37℃for 1h. The serum-virus mixture was transferred to a monolayer of F81 cells, incubated at 37℃for 4 days, and the lesion condition of each well was determined to determine the serum neutralizing antibody titer.

After the prepared vaccine is immunized on a cat, the titer of the FCV neutralizing antibody is shown in figure 7, the titer of the antibody of a blank control group after immunization is not higher than 1:2, and the vaccine immunization group can stimulate the organism to generate the titer of the FCV neutralizing antibody after first immunization; after the boosting, the antibody titer is increased, and after 3 weeks after the boosting, the FCV neutralizing antibody titer is not lower than 1:32, which shows that the FCV-CCSN-1 strain has good immunogenicity.

4. Toxicity attack protection experiment

10 healthy cats (FCV neutralizing antibody titers are not higher than 1:4) of 8-12 weeks of age are selected and randomly divided into 2 groups, namely an immune group and a control group, and 5 animals are selected from each group. The inactivated vaccine prepared by subcutaneous injection of the immune group is 0.5 ml/animal, and the MEM culture solution is injected subcutaneously into the neck of the control group by 0.5 ml/animal. The immunization was boosted once every 21 days. 21 days after boost, each cat was vaccinated with the feline infectious rhinoconjunctivitis virus CC3 strain (diluted to a viral titer of 10 ^8.5 TCID ₅₀ Per ml) 0.5ml. All test cats were scored according to the scoring criteria of table 3, and data were counted until 14 days after challenge for 14 days, and total score was calculated for 14 days. If the scores of the vaccine group and the control group are significantly different (P is less than 0.05), the protection of the vaccine group is judged; if the difference is not significant (P > 0.05), the vaccine group is judged not to be protective.

TABLE 3 health status and clinical symptom scoring System

The scoring results of the immune post-challenge on animals in each group show (Table 4) that the scores of the vaccine group and the control group are obviously different (P is less than 0.0001), namely the vaccine group is protected, namely the FCV inactivated vaccine can protect the organism from virus attack after immunization, effectively relieve the post-challenge symptoms, reduce the score after challenge and shorten the course of disease.

TABLE 4 scoring details after challenge

EXAMPLE 4 evaluation of protection against challenge after immunization of FCV bivalent inactivated vaccine

1. Preparation of inactivated vaccine

The FCV-CCSN-1 strain separated in the patent and the original preserved strain FCV CC3 strain of the company are diluted by MEM culture solution to the virus content of 10 ^9.00 TCID ₅₀ Per ml, BEI was neutralized by adding sodium thiosulfate at a final concentration of 0.002mol/L after inactivation at 30℃for 24 hours. The post-inactivation assay was identical to the antigen inactivation assay of example 3.

After mixing the antigens which are qualified in the inactivation test in equal proportion, adding Montanide Gel 02PR adjuvant according to the proportion of 7:1, uniformly mixing to prepare the FCV bivalent inactivated vaccine, and preserving at 2-6 ℃.

2. Toxicity attack protection experiment

10 healthy cats (FCV neutralizing antibody titers are not higher than 1:4) of 8-12 weeks of age are selected and randomly divided into 2 groups, namely an immune group and a control group, and 5 animals are selected from each group. FCV bivalent inactivated vaccine prepared by subcutaneous injection in the immune group, 0.5 ml/dose, and MEM culture solution 0.5 ml/dose in the neck of the control group. The immunization was boosted once every 21 days. 21 days after boost, each cat was vaccinated with the feline infectious rhinoconjunctivitis virus CC3 strain (diluted to a viral titer of 10 ^8.5 TCID ₅₀ Per ml) 0.5ml. The day 14 was observed, and the scoring and decision criteria were the same as in "example 3".

The scoring results of the immune post-challenge on animals in each group show (Table 5) that the scores of the vaccine group and the control group are obviously different (P is less than 0.0001), namely the vaccine group is protected, namely the FCV bivalent inactivated vaccine can protect the organism from virus attack after being immunized, effectively relieve the post-challenge symptoms, reduce the score after the challenge and shorten the course of disease. Lays a foundation for the follow-up FCV bivalent vaccine and multivalent vaccine.

TABLE 5 scoring details after challenge

EXAMPLE 5 evaluation of the production Effect of FCV-CCSN-1 egg yolk antibody

1. Vaccine preparation

The FCV-CCSN-1 antigen is mixed with an adjuvant (Freund's complete adjuvant or Freund's incomplete adjuvant) 1:1 (v: v), and the mixture is emulsified by an emulsifier until the liquid drops into water and does not break. And filling the emulsified vaccine into a vaccine bottle for standby.

2. Immunization

20 healthy sea-blue white laying hens with the age of 90-110 days are selected and randomly divided into two groups, wherein one group is an immune group and the other group is a blank control group. The immunization group was used for primary immunization with a vaccine prepared by Freund's complete adjuvant emulsification, and the immunization group was used for booster immunization with a vaccine prepared by Freund's incomplete adjuvant emulsification. Immunization was performed using a continuous syringe, leg intramuscular injection, 1.0 ml/min. Boosting was performed once a week.

3. Antibody titer determination

After the third immunization, the eggs of the immunized group and the control group were collected weekly, yolk was separated, and FCV neutralizing antibody titer was measured after 10-fold dilution with 50mM acetic acid-sodium acetate buffer.

And (3) preparing the yolk antibody by using FCV-CCSN-1 immunized laying hens. At 1 week after the third immunization, FCV neutralization titers were generated in both immunized groups. And with the increase of the immunization times, the titer of the neutralizing antibody is gradually increased, the titer of the neutralizing antibody is not lower than 1:16 after the five-immune is carried out, and the titer of the neutralizing antibody is not lower than 1:45 after the six-immune is carried out for 1 week. The FCV-CCSN-1 antigen can be used for successfully preparing the FCV yolk antibody, and the titer of the FCV neutralizing antibody after six-immunity is not lower than 1:45.

SEQUENCE LISTING

<110> vincristinox biotechnology Co., ltd

<120> a strain of feline calicivirus and use thereof

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 7699

<212> DNA

<213> feline calicivirus

<400> 1

gagacaatgt ctcaaactct gagcttagtg cttaaaactc acaatgttag aaaagacttt 60

gtgtactccg tcaagcgaac gcttgctcgg aggcgctatc ttcagtattc tttaaacaag 120

ctttctcgcc aaattcggct agaagcttgc ccctcatgtg ctagttatga cgtttgtcct 180

aactgcactt ccggtaacat tcctgatgat ggatcgtcaa ttaactcgat cccttcatgg 240

gaagaagttg ccaaaacttc tacttattct cttctgttgt ctgaagacac atctgatgaa 300

ctctgtcctg acgacttggt taatgttgct gctcacatcc gcaaagcgtt gtccacccag 360

tctcaccccg ctaacggaga gatgtgcaaa gaacagctca cctcactgtt ggtaatggct 420

gaagcaatgc taccgcaacg atctaggtcc tcgctcccac ttcaccagca ataccacact 480

gcgcgaattg agtggagaga gaagttcttt cacaaaccaa tggacttcct ccttgagaag 540

attggtgtgt ctaaagacat ccttcaggtt actgctattt ggaaaattat cctagagaaa 600

gcatgttact gtaaatctta tggtgagcag tggttcaatg tggcaaaaca aaaactaagg 660

gaagtcaaaa attttgaggg aaacacgtta aaaccactaa ttggaggctt tattgatggt 720

ctacgtttta tgactgttga taaccctaac cccctaggat tcctaccaag gttaattggc 780

atggttaagc cactaaattt ggccatgatt attgacaatc atgagaattc tctctctggg 840

tgggtcataa ctctcactgc catcatggag ttatataaca taactgaatg taccattgac 900

gtaatcacct cagtggtaac ttccttttac gacaagatca ctaatgctac caaattttac 960

agtggtgtaa aggccctatt cactggtttt aggaccgagg atgtatccaa ctctttctgg 1020

tacatggcag cagcaatttt atgctactta atcactgggt tgattccaaa caacggcagg 1080

ttttcaaaaa taaaggcttg cttatctggt gccacaaccc tggtgagtgg tataattgct 1140

actcaaaaac ttgcagctat gttcgcaaca tggaacaccg aatccattgt gaacgagctg 1200

tcagcgagga ctgttgccct gtcagaactg aataacccta caaccacctc ggacactgat 1260

tcagtggaaa ggctattgga attggctaag atcttgcatg aagaaatcaa agttcatacc 1320

ttaaacccaa taatgcaatc atacaaccca attcttagaa atttgatgtc cacactcgat 1380

ggtgtcatca cctcatgtaa taaaaggaaa gccatagcta ggaaaagacc tgttccagtt 1440

tgttacatcc tcactggccc cccaggctgc gggaaaacaa cagcggctca agccctagca 1500

aagaagcttt ctgaccagga accatccaca atcaaccttg atgtggatca tcatgacact 1560

tacactggaa acgaggtgtg cataattgat gaatttgatt cttctgacaa agttgactac 1620

gcaaattttg taattggcat ggtaaattct gctcctatgg ttctaaactg tgatatgctt 1680

gaaaacaagg gtaagctctt cacttctaaa tacattataa tgacatctaa ttctgaaacc 1740

cctgtgaaac ctagttccag acgcgctggt gctttctacc gacgagtgac tataattgat 1800

gtcacgaacc cactggtgga atctcacaag cgtgctagac ctggaacatc tgtccctcgc 1860

agttgttaca agaaaaactt ttctcatcta tctcttgcta agcgtggagc tgaatgttgg 1920

tgtaaggact atgtcttgga tcctaagggc cttcaacacc aatccattaa ggcccccaac 1980

cccacttttc ttaatattga ttccttagct caaactatga aacaggaatt tgctgttaaa 2040

aacatggcat ttgaagcgga aaacggaagc tctgaacatc ggtatggatt tgtatgtcaa 2100

caggctgagg ttgaaacagt tcgcaggttg ctcaatgctg ttagagccag gctcaacgct 2160

acattcactg tttgtgttgg tcctgaagcg tctagctcaa ttgggtgtac agctcacgtg 2220

ctgaccccgg atgaaccatt caacgggaag aaatttgttg tttctcgctg caatgaggcc 2280

tccttggctg cactggaagg caactgtgtt caatctgcgt tgggtatatg tatgtctgat 2340

aaggatttga cccatctctg tcacttcatt aagggaaaaa ttgtcaatga caatgtaagg 2400

ttggatgaac tacccgccaa tcaacatgtg gtaaccgtta actcggtgtt tgatttggcc 2460

tgggctcttc gccgtcacct aacattggca gggcagtttc aagccatcag agccgcatat 2520

gatgtgctaa ctgctcccga caaggtccct gcaatgttga gacactggat ggatgaaact 2580

tccttttcag atgaacatgt tgttacccaa tttatcacac ctggtggtat cataatcctg 2640

gagtcgtgtg gtggtgcacg aatctgggca ctgggtcaca atgtgatccg tgctggagga 2700

gtcaccgcaa cacctaccgg cggatgtgtt agattgatgg gtttgtccgc gcacactatg 2760

ccatggtctg aaatctttag ggaactcttc tctcttttag gaaagatttg gtctaacatt 2820

aaggtttcca ctctagttct tactgccctt ggtatgtacg catcaagatt taggcccaag 2880

actgaagcaa aaggaaaaac aaagaaaaag attggaccat acaggggtcg tggtgtcgct 2940

ctcactgatg atgaatatga tgagtggaga gagcacaacg cttctagaaa acttgatcta 3000

tcagtggaag atttcctaat gttgcgccac cgcgcagcac taggtgctga cgacgctgat 3060

gctgtaaaat ttagatcatg gtggaattct cgatcaaaaa tggccaatga ttacgactat 3120

gatgatgtca ccgtgattgg caaaggcggt gtcagaaatg aaaagatcag aacaagcact 3180

ttgaaagcta ttgatcgtgg ttacgacatt ggcttcgctg aggaatccgg ccctggaacc 3240

aaatttcaca agaatgcaat tggatcggta actgatatct gtggtgaaca caaagggtac 3300

tgtgtacata tgggtcatgg cgtttacgca tctgtggctc acgtggttaa gggtgactcc 3360

ttcttccttg gtgaaaggat ctttgatgta aaaactaatg gggaattctg ttgcttccgc 3420

agcacaaaga tcctgcctag tgctgctcca ttcattgctg gaaaacctac tagagacccc 3480

tggggatccc ctgtggccac tgattggaaa ccaaaagcct atacaacaac ttcagggaag 3540

attgttgggt gctttgccac aacatcaact gagactcgtc ctggggactg tggtttacca 3600

tacattgatg acaatggtag ggttacaggt ttgcacactg gctctggggg ccccaaaacc 3660

ccgagtgcaa agttggtagt tccttacatc catattgata tgaaatcaaa atctgtgact 3720

ccacaaaagt acgatgcaac aaaacctgac attagctaca agggcttaat ctgcaaacaa 3780

ttggatgaaa ttagagtaat accaaaagga acacgacttc atgtttctcc agctcacatt 3840

gatgactttg aagaatgctc ccatcaacct gcttctcttg gtagtggtga ccctagatgc 3900

cccaaatctc ttactgctat tgttgttgat tctttgaaac cttattgtga taatgtagaa 3960

ggacctcccc acgatatctt acacagagtg cagaagatgc ttatagatca cctctctggc 4020

ttcgttccga tgaacatctc ttcagaacaa tctatgcttt ctgcttttca taagcttaat 4080

catgacacct cttgtggacc atacctgggt ggtagaaaga aagatcacat gacaaatggt 4140

gagccagaca aaccactatt ggaccttctt tcagcaaaat ggaaattagc aacacaaggt 4200

attgcactcc cacatgagta cacaattggc ttaaaggatg agttaagacc cattgagaaa 4260

gtgcaggaag ggaaaaggcg aatgatctgg ggatgtgatg ttggagttgc taccgtgtgc 4320

gctgctgcat tcaaaggtgt cagtgatgca attacagcaa accaccaata cgggcctgtt 4380

caagttggta tcaacatgga cagtccaagt gttgaggcgc tctaccaaag gataaaaagt 4440

gctgcaaagg tatttgcagt tgattactcc aaatgggatt caactcaatc gcctcgggta 4500

agtgctgcat caattgacat actacgatat ttttctgatc ggtccccaat cgtggattct 4560

gctgctaaca ctcttaaaag cccccctgtt gcaattttca atggcgttgc cgtgaaggtt 4620

tcatcaggat tgccatctgg gatgcctctc acatctgtta taaattcact taatcactgt 4680

ttgtatgttg gttgtgctat tcttcaatct cttgaatctc gcaatatacc tgtcacttgg 4740

aatttatttt cttctttcga tatgatgact tacggtgatg atggagtgta catgttccct 4800

acaatgtttg ctagtattag tgaccagatt tttggaaacc tgtctgctta cggtctgaag 4860

cccacaagag ttgacaaaac tgtaggtgca attgaaccca ttgacccaga atcagttgtc 4920

tttctcaaaa gaacaataac tagaaccccc caaggaatta gaggacttct tgatcgtagt 4980

tcaataatta ggcaatttta ctacatcaaa ggtgagaaca cagatgattg gaagaacccc 5040

ccaaagaaca ttgacccaac ttctagaggt caacagttgt ggaacgcttg cttgtatgcc 5100

agtcaacatg gtgttgaatt tttcaacaag gtgtacaagt tggctgaaaa ggctgttgag 5160

tttgagaagt tgcattttga gccaccaacc tatcactcag ctttggagca ttacaacagc 5220

caattcaatg gtgtggaggc gcggtatgac cagatcgata cgagtggtat gaccgccctt 5280

cactgtgatg tgttcgaagt ttgagcatgt gctcaacctg cgctaacgtg cttaaatact 5340

atgattggga cccccatttt aaattggtga ttaacccaaa ttcattcctc tccgtaggct 5400

tctgtgacaa ccccctcacg tgttgttacc cagaattact tccagaattt ggaactgtgt 5460

gggactgtaa ccagtcacca cttcaaattt accttgagtc aatccttggt gatgacgagt 5520

ggtcgtctac ctatgatgct attgacccag tagttccccc aatgcattgg gatgaagcag 5580

gtaaaatctt ccaaccacac cctggtgtgc tcatgcacca cctcatctct gaggttgcaa 5640

agggatggga cccaaacctt ccactcttta gattagaagc ggatgatgga tccattactg 5700

cacccgaaca aggaacacca gttggtgggg tgattgctga gccaagcgct caaatgtcaa 5760

ctgcggcgga catggcttct gggaaaagtg ttgactctga gtgggaggct ttcttctcat 5820

tccacactag cgtcaactgg ggcaccacag aaacccaagg taagattctc ttcaaccaat 5880

ccttaggacc ccttctaaac ccatatctag aacatttatc taagttgtac gttgcttggt 5940

ctggatctgt tgaagttagg ttttcaattt ctggctctgg tgtctttgga ggaaagcttg 6000

cggctattgt tgtgccaccg ggagttgatc ctgtgcagag cacctcaatg ctgcaatatc 6060

ctcatgttct atttgacgct cgtcaagtgg aacctgttat ctttactatc cctgatctta 6120

ggaattctct ttaccactta atgtctgaca ctgatactac atctctggtc attatggtct 6180

acaatgattt gataaaccca tatgctagcg acactaattc gtctggatgc attgtcacag 6240

tggaaacaaa gcctgggcct gattttaagt tccatctttt gaaaccgcct ggttcaatgt 6300

tgacgcatgg ttctgtacca tcagatttga tcccaaaaac atcttcatta tggattggta 6360

atcgctattg gtctgatatc actgatttca ttgttcgccc cttcgtattc caagcaaatc 6420

gccactttga ttttaatcag gaaacagctg gatggagcac cccaaggttc cggcctatca 6480

gtgtcaccat cagtcagcag agcggtgcaa aattgggaac tgggattgcc actgatttca 6540

tcgtgcctgg gattccagat ggttggccag atacaacaat ttcggaaaaa ctcattcctg 6600

ccggtgatta tgctatcaca gattcctcca acaatgacat cgtcacaaag gctgattatg 6660

agagagcaga tgttatcaaa aacaatacca atttcagagg tatgtacata tgtggtgccc 6720

ttcaaagagc ttggggagac aagaaaattt ccaatactgc atttatcacc actgcaacaa 6780

ttgatggtgc caaaatcaag ccttgtaaca agatagatca atcaaagatt actgtgttcc 6840

aggataacca tgttaacaga gatgtgcaaa cttctgatga cacactggcc ttgcttggtt 6900

acacagggat tggagaagag gctataggtg cagacaggga aagggtggta cgaattagca 6960

cactgcctga ggctggtgcg cgaggtggaa accaccctat attttacaag aactctatca 7020

gccttggtta tgtgattggg tctattgatg tgttcaattc ccaaatcttg cacacttcta 7080

ggcaattgtc ccttaataat tatctgctgg ctcctgattc tctcgctgtc tataggataa 7140

ttgattctaa tggctcttgg tttgatgtgg gtattgactc tgatggattc tcctttgttg 7200

gtgtctctaa tattcctcac ctagaatttc cactctctgc ctcctacatg ggaatacaat 7260

tggcaaagat tcggcttgcc tcaaatatta ggagggatat gataaaatta tgaattcaat 7320

attaggcctc attgatgctg taaccaacac agtaagcaaa gcgcaacaaa ttgaattgga 7380

taaagctgca cttggtcaga atcgagaaat tgctttaaaa cgcattaatc tagatcaaca 7440

ggccctaaat aaccaggtgt cgcaatttaa caaaattctt gagcagaggg tacaaggccc 7500

aatacagtca gtacgattgg cacgtgctgc tggattccgg gttgaccctt actcatacac 7560

aaatcaaaat ttttatgatg accaactcaa tgcaattaga ctatcataca gaaatttatt 7620

taaaatgtag aaatttcttt taattttgga ttgattggat gtacctcttc gggctgtcgc 7680

atcgcgccta accccaggg 7699

<210> 2

<211> 24

<212> DNA

<213> Synthesis

<400> 2

gagacaatgt ctcaaactct gagc 24

<210> 3

<211> 24

<212> DNA

<213> Synthesis

<400> 3

caggctaaat caaacaccga gtta 24

<210> 4

<211> 24

<212> DNA

<213> Synthesis

<400> 4

gtggtaaccg ttaaytcggt gttt 24

<210> 5

<211> 22

<212> DNA

<213> Synthesis

<400> 5

cacgttagcg caggttgagc ac 22

<210> 6

<211> 20

<212> DNA

<213> Synthesis

<400> 6

cactgtgatg ttcgaagttt 20

<210> 7

<211> 18

<212> DNA

<213> Synthesis

<400> 7

ccctggggtt aggcgcwg 18

Claims

1. Callicarpa virus strainfeline calicivirus) The preparation method is characterized in that the cat calicivirus strain is named FCV-CCSN-1 and is preserved in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) on the 10 th month 19 of 2021, and the preservation number is: CGMCC No.21927.

2. Use of the feline calicivirus strain of claim 1 in the construction of an animal model for evaluating cellular metabolism, transcription and immunity after infection of cells by the feline calicivirus strain.

3. A vaccine composition comprising a vaccine acceptable carrier and the feline calicivirus strain of claim 1.

4. A vaccine composition according to claim 3, characterized in that the vaccine composition is a bivalent vaccine or a multivalent vaccine.

5. The vaccine composition of claim 3 or 4, wherein said feline calicivirus strain is present at a level of greater than or equal to 10 ^9.00 TCID ₅₀ /ml。

6. A vaccine composition according to claim 3, wherein the feline calicivirus strain is BEI inactivated.

7. The vaccine composition of claim 3, further comprising a vaccine adjuvant.

8. The vaccine composition of claim 7, wherein the vaccine adjuvant is a water-soluble adjuvant or an oily adjuvant.

9. Use of the feline calicivirus of claim 1 or the vaccine composition of claim 3 or 4 in the manufacture of a medicament for the prevention or treatment of respiratory infectious diseases; the respiratory infectious disease is feline infectious rhinoconjunctivitis.