CN109337874B

CN109337874B - Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine

Info

Publication number: CN109337874B
Application number: CN201811508840.3A
Authority: CN
Inventors: 周远成; 代洪波; 林艳; 廖果; 王雪涛; 邝声耀; 阴文奇
Original assignee: Livestock Bioengineering Co ltd
Current assignee: Livestock Bioengineering Co ltd
Priority date: 2018-12-10
Filing date: 2018-12-10
Publication date: 2020-05-12
Anticipated expiration: 2038-12-10
Also published as: CN109337874A

Abstract

The invention discloses a recombinant porcine pseudorabies virus, application thereof and a recombinant porcine pseudorabies live vaccine, and relates to the field of animal biological products. The preservation number of the recombinant porcine pseudorabies virus provided by the invention is CGMCC No: 16289. the recombinant porcine pseudorabies virus is obtained by artificial modification, the pathogenicity of the recombinant porcine pseudorabies virus is removed, the genes TK, gI, gE, 11K and 28K of the pseudorabies virus are deleted, and the fusion protein of the porcine epidemic diarrhea virus S truncated protein fusion porcine CD40L protein can be expressed. After the pig is immunized by the recombinant pseudorabies live vaccine prepared from the recombinant porcine pseudorabies virus, the pig can obtain immunity for resisting the attack of porcine epidemic diarrhea virus and porcine pseudorabies virus. Has good immune effect and wide application prospect.

Description

Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine

Technical Field

The invention relates to the field of animal biological products, in particular to a recombinant porcine pseudorabies virus, application thereof and a recombinant porcine pseudorabies live vaccine.

Background

Porcine Pseudorabies (PR), also known as Aujeszky's Disease (AD), is a highly contagious infectious disease of various domestic animals such as pigs, cattle and sheep and wild animals caused by Pseudorabies virus (PRV) with fever, extreme itching (except pigs) and encephalomyelitis as main symptoms. Pigs are the natural host, the main reservoir and the source of infection for the disease, PRV can infect pigs of all ages, with the lower the age the more serious the disease becomes after infection and the higher the mortality rate. The death rate of the suckling piglets after infection is high and can reach 100 percent, and the suckling piglets can have nervous symptoms such as diarrhea, vomiting, limb swimming movement and the like; weaned pigs and fattening pigs are infected and mainly show fever and respiratory tract symptoms; the adult pigs do not get ill or only show slight symptoms such as body temperature rise and are mostly infected invisibly; pregnant sows can cause abortion, stillbirth, mummy and the like after infection; the disease can also cause sterility of boars, testicular swelling of boars, and the like.

2011 and in front and at the back of China, pseudorabies of pigs occurs in a plurality of areas, which causes great economic loss to the pig breeding industry in China. The outbreak epidemic of porcine epidemic diarrhea also appears in China at the same time. Laboratory tests show that the mixed infection of the porcine pseudorabies virus and the porcine epidemic diarrhea virus exists in many cases. The severity of the disease after the infection of the two pathogens is negatively related to the age of the pig, and both can cause diarrhea and vomiting of piglets. Aiming at porcine pseudorabies and porcine epidemic diarrhea, the economic loss caused by disease infection can be obviously reduced by using vaccine immunization, but no porcine pseudorabies and porcine epidemic diarrhea virus combined vaccine is available on the market. Therefore, the development of a recombinant vaccine capable of simultaneously preventing porcine pseudorabies and porcine epidemic diarrhea is imminent.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a recombinant porcine pseudorabies virus which is obtained by artificial modification, main pathogenic genes TK, gI, gE, 11K and 28K genes of the pseudorabies virus are deleted through gene editing and recombination technology, and truncated fragments capable of expressing porcine epidemic diarrhea virus S protein are inserted into the positions where the gI, gE, 11K and 28K genes are deleted and fused with fusion protein of porcine CD40L protein. The constructed recombinant virus has no pathogenicity to the pig, the immunogenicity of the recombinant virus is effectively reserved, and the vaccine prepared by using the recombinant porcine pseudorabies virus can provide the immunity for resisting the porcine pseudorabies virus and the porcine epidemic diarrhea virus for the pig after immunizing the pig.

The invention also aims to provide application of the recombinant porcine pseudorabies virus.

The invention also aims to provide a recombinant porcine pseudorabies live vaccine which is prepared from the recombinant porcine pseudorabies virus and has a better immune effect.

The invention also aims to provide a method for preparing the recombinant porcine pseudorabies vaccine. The recombinant porcine pseudorabies live vaccine prepared by the method has better immune effect.

The invention is realized by the following steps:

on one hand, the invention provides a recombinant porcine pseudorabies virus, the preservation number of which is CGMCC No: 16289.

further, the recombinant pseudorabies virus lacks the following genes: TK, gI, gE, 11K and 28K.

Further, the recombinant pseudorabies virus is capable of expressing a porcine epidemic diarrhea virus S protein, which S protein comprises a porcine epidemic diarrhea virus receptor binding domain.

Further, the recombinant pseudorabies virus can express the porcine CD40L protein.

Furthermore, the exogenous protein expressed by the recombinant pseudorabies virus is a fusion protein formed by a porcine epidemic diarrhea virus S protein receptor binding structural domain and porcine CD40L protein.

Furthermore, the amino acid sequence of the fusion protein is shown as SEQ ID NO. 5.

The recombinant porcine pseudorabies virus provided by the invention is obtained by deleting TK, gI, gE, 11K and 28K genes on the basis of a pseudorabies virus PRV-FJ strain and carrying out gene editing.

The strain is preserved in China General Microbiological Collection Center (CGMCC) of China microbiological collection management Committee No.1 Hospital No.3 of the West Lu of the Kyoho area in the Beijing city in 2018, 08 and 29 days, and is named after taxonomy: porcine Pseudorabies virus (pseudorabiae virus); the preservation number is: CGMCC NO. 16289.

In addition, the vaccine prepared by adopting the recombinant porcine pseudorabies virus strain is verified by immunogenicity test that the gE antibody detection result is negative, the gB antibody is positive, and can induce porcine pseudorabies virus neutralizing antibody with higher titer and porcine epidemic diarrhea virus neutralizing antibody, and can effectively resist the attack of porcine pseudorabies and porcine epidemic diarrhea.

On the other hand, the invention provides the application of the recombinant porcine pseudorabies virus in preparing vaccines for pigs.

Wherein the vaccine for the pig is a vaccine for preventing porcine pseudorabies and/or porcine epidemic diarrhea; preferably, the vaccine is a live vaccine.

In a further aspect, the present invention provides a recombinant porcine pseudorabies live vaccine comprising the recombinant pseudorabies virus as described above and a stabilizer.

Further, in some embodiments of the invention, the stabilizing agent is a gelatin sucrose protectant.

Further, in some embodiments of the present invention, the gelatin sucrose protectant comprises 1% -3% gelatin and 10% sucrose, with the balance being water.

In another aspect, the present invention provides a method for preparing the recombinant porcine pseudorabies live vaccine, which comprises the following steps:

step (a): inoculating the recombinant porcine pseudorabies virus into passage cells to obtain virus liquid;

step (b): the harvested virus fluid is mixed with a stabilizer.

Further, the preparation method further comprises the following steps: step (c): and (3) carrying out vacuum freeze drying on the mixed solution of the virus liquid and the stabilizer to prepare the finished product of the porcine pseudorabies live vaccine.

Further, in some embodiments of the present invention, the gelatin sucrose protectant contains 1% -3% gelatin (i.e. 100ml of gelatin sucrose protectant contains 1-3g gelatin) and 10% sucrose by weight/volume.

Further, in some embodiments of the invention, in step (b), the virus fluid is mixed with a stabilizer in equal volumes.

Further, in some embodiments of the invention, the passaged cells are ST cells, BHK21 cells, MDBK cells, VERO cells, MDCK cells, PK15 cells, 293T cells, 293F cells, and the like, preferably BHK21 cells.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows the results of PRV gB/gE antibody and pseudorabies virus neutralizing antibody assays at 28 days post-immunization, note: and the antibody gB/gE is detected, the S/N value is positive when less than 0.6, negative when more than 0.7 and suspicious when 0.6 to 0.7.

FIG. 2 is a graph showing the temperature change of PRV-FJ after challenge, note: fever occurs when the body temperature exceeds 40.5 ℃.

FIG. 3 shows the results of detection of neutralizing antibodies against PEDV serum 14 days after immunization.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Artificially modified pseudorabies virus

1. Strain

PRV-FJ strain, which is separated from porcine disease material of pseudorabies of Fujian pigs in 2015 by key laboratories of Sichuan province of infectious diseases of livestock and poultry; the sick pigs mainly show symptoms of body temperature rise, poor appetite, sneezing and the like. The PRV-FJ strain was 10⁷TCID₅₀The dose per head infected weaned piglets of 28 days old had no neurological symptoms and all died 7 days after challenge.

PEDV-CV777 strain and SA014 strain were provided by intensive laboratory preservation of infectious diseases of livestock and poultry in Sichuan province.

ST cells and 293T cells were cultured in a DMEM medium containing 10% fetal bovine serum (Gibco).

2. Recombinant vector construction

Artificially synthesizing SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 and SEQ ID NO.4, then directionally cloning SEQ ID NO.1 to the Ase I enzyme cutting site of a pEGFP-C1 vector, naming the site as pEGFP-gI, directionally cloning SEQ ID NO.2 to the Mlu I enzyme cutting site of the pEGFP-gI, naming the site as pEGFP-gI28K, cloning SEQ ID NO.3 between the BspE I and Bcl I enzyme cutting sites of a pEGFP-gI28K vector, and naming the constructed vector as pPED-RBDCD 40L. SEQ ID NO.4 was directionally cloned between EcoR1 and HindIII cleavage sites of pUC57 vector, which was designated pUC-TK.

3. Gene editing vector construction

Vectors for TK and gE gene editing were constructed using the primers in Table 1, following the methods described in LentiCRISPR v2 vector (Addge Inc.), and named vectors psgRNA-TK and psgRNA-gE, respectively.

gI. The four genes gE, 11K and 28K are adjacent, so 4 genes can be deleted simultaneously using psgRNA-gE and the corresponding homologous sequences.

TABLE 1 gRNA construction primer information

4. Recombinant virus construction

Extracting PRV-FJ strain genome DNA according to a conventional method; PRV-FJ genomic DNA (3. mu.g), pUC-TK plasmid (5. mu.g) and psgRNA-TK plasmid (5. mu.g) were mixed, and 293T cells with good growth status were transfected according to Lipofectamine 3000(Thermo fisherscientific) instructions, and cultured at 37 ℃ after transfection until cytopathic effect appeared. The virus supernatant was inoculated into BHK21 cells and single virus plaques were selected. The selected virus is inoculated with BHK21 cells in a plaque mode, virus liquid is obtained, virus DNA is extracted according to a conventional method, and primers TKF: CATCCTCCGGATCTACCTCGACGGC and TKR: CACACCCCCATCTCCGACGTGAAGG PCR amplification was carried out with reference to Lyophilized HS Taq PCR Master Mix (TAKARA) kit instructions, and a sample of about 680bp of the amplified fragment was selected for sequencing. The virus rPRV-FJ-delTK was purified after sequencing.

The rPRV-FJ-delTK genome was extracted according to a conventional method, and the extracted genomic DNA (3. mu.g), plasmid pPED-RBDCD40L (5. mu.g) and psgRNA-gE were transfected into 293T cells having a good growth state according to Lipofectamine 3000(Thermo fisher scientific) instructions, and cultured at 37 ℃ after transfection until cytopathic effects occurred. The virus supernatant was inoculated with ST cells, green fluorescent plaques were picked, and three rounds of plaque purification were performed, and the purified virus was named rPRV-TIE18 (RBD).

The pPED-RBDCD40L plasmid contains homology arms for the gE and 28K genes, and has a CMV promoter in the middle of the homology arms, coding sequences for PEDV S truncated protein and CD40L fusion protein, and a poly A signal sequence. Therefore, after the plasmid is recombined on pseudorabies virus, PEDV S protein and CD40L protein fusion protein can be expressed.

5. Preservation of recombinant viruses

Inoculating the identified rPRV-TIE18(RBD) virus into BHK21 cells according to a conventional method, culturing until CPE appears, harvesting virus supernatant, subpackaging and storing at-80 ℃.

Example 2

Pathogenicity of rPRV-TIE18(RBD)

20 PRV antibody negative piglets of 1-3 days old are taken, randomly divided into 4 groups which are respectively marked as A, B, C, D groups, and the challenge test is carried out according to the following table. After challenge, the observation was continued for 14 days.

TABLE 2 pathogenicity test of rPRV-TIE18(RBD) and PRV-FJ on newborn piglets

Group of	Toxin counteracting toxic strain	Dosage of offensive toxin	Inoculation mode	Remarks for note
					A	rPRV-TIE18(RBD)	10⁸TICD₅₀	Nose drop
B	rPRV-TIE18(RBD)	10⁷TICD₅₀	Nose drop
					C	DMEM culture solution	2.0ml	Nose drop	Blank control
D	PRV-FJ	10⁷TICD₅₀	Nose drop

After the challenge, the body temperature of the piglets is observed and measured every day, and whether pseudorabies clinical symptoms and death occur is observed. The results are shown in the following table 3, wherein no body temperature rise and other clinical symptoms occur after nasal drip of rPRV-TIE18(RBD), the piglets inoculated with PRV-FJ by nasal drip have body temperature rise (shown in figure 2), diarrhea, vomiting symptoms and nervous symptoms in the second day after challenge, the piglets die in the 3 rd day after challenge, and die in the 4 th day after challenge. The blank control group did not show any clinical symptoms and was normal throughout the experiment.

TABLE 3 statistics of PRV-TIE18(RBD) and PRV-FJ Primary piglet pathogenicity test results

Group of	Generate heat	Vomiting due to diarrhea	Neurological symptoms	Number of deaths
					A	0/5	0/5	0/5	0/5
B	0/5	0/5	0/5	0/5
					C	0/5	0/5	0/5	0/5
D	5/5	4/5	4/5	5/5

Example 3

Preparation and test of porcine pseudorabies live vaccine rPRV-TIE18(RBD)

rPRV-TIE18(RBD) was seeded into BHK cells and virus fluid was harvested when more than 90% of the cells were diseased. Diluting the harvested virus liquid by 2 times, mixing with gelatin and sucrose protective agent (containing 2% gelatin and 10% sucrose) in equal volume, subpackaging according to 2 ml/bottle, and freeze-drying under vacuum. According to the appendix of Chinese animal pharmacy, the test shows that the bacterial and mycoplasma pollution and the exogenous virus pollution are avoided. The titer of the virus culture solution is 10^8.0TCID₅₀Each ml, the original volume virus content of the freeze-dried vaccine is 10^7.25TCID₅₀/ml。

Example 4

Immunogenicity of porcine pseudorabies live vaccine rPRV-TIE18(RBD)

(1) PRV-TIE18(RBD) immunogenicity to PRV

Selecting 15 pigs with pseudorabies antigen-antibody negative pigs of 3-4 weeks old, dividing into A, B, C groups at random, and carrying out intramuscular injection inoculation according to the table 4. Serum was isolated from all test pigs 28 days after vaccination and tested for gB antibody (IDEXX), gE antibody (IDEXX), and serum neutralizing antibody (PRV-FJ neutralization). After 28 days of immunization, all test pigs were inoculated with PRV-FJ (10)⁷TICD₅₀First) were tested for challenge protection.

TABLE 4 grouping of PRV-TIE18(RBD) versus PRV immunogenicity assays

Group of	Strain	Age of the animal	Immunization dose	Toxin counteracting toxic strain	Dosage of offensive toxin
						A	PRV-TIE18(RBD)	3-4 weeks old	10^5.0TICD₅₀	PRV-FJ	10⁷TICD₅₀
B	PRV-Bartha K61	3-4 weeks old	10^5.5TICD₅₀	PRV-FJ	10⁷TICD₅₀
						C	DMEM	3-4 weeks old	2.0ml	PRV-FJ	10⁷TICD₅₀

The gE antibody detection results of 2 immunization groups and a control group are 0/5 positive 28 days after immunization; PRV-TIE18(RBD) and PRV-Bartha K61 total 2 immunization groups of gB antibody 5/5 positive, control group gB antibody 0/5 positive; the PRV-TIE18(RBD) immunization group had higher serum neutralizing antibodies to PRV-FJ (mean 61) than the PRV-Bartha K61 immunization group (mean 36), and the control group had no neutralizing antibodies to PRV-FJ. The experimental data are shown in fig. 1, in fig. 1: and the antibody gB/gE is detected, the S/N value is positive when less than 0.6, negative when more than 0.7 and suspicious when 0.6 to 0.7.

The results of the PRV challenge protection test are shown in Table 5. After PRV-FJ toxin challenge, no fever or inappetence occurs in PRV-TIE18(RBD) immune group, and the PRV-TIE18(RBD) immune group is continuously observed to be totally alive in 14 days and protected by 5/5; PRV-Bartha K61 immunohistochemical group 1/5 showed fever and anorexia, all survived in observation period, onset of 1/5 and protection of 4/5; the control group was all febrile, all had anorexia, died 2 within the observation period, 5/5 morbidity, 2/5 mortality.

TABLE 5 PRV-TIE18 statistics of PRV immunogenic challenge protection test results

(2) PRV-TIE18(RBD) immunogenicity assay for PEDV

Selecting 15 piglets with 3 days old porcine epidemic diarrhea virus antigen antibody negative, dividing into A, B, C groups at random, and performing intramuscular injection inoculation according to the table 6. Serum was isolated from all test pigs 14 days after vaccination and tested for serum neutralizing antibodies. After the completion of blood collection 14 days after immunization, all test pigs were orally inoculated with PEDV-SA014 (10)^6.0TICD₅₀First) were tested for challenge protection.

TABLE 6 grouping of PRV-TIE18(RBD) for PEDV immunogenicity assays

Group of	Strain	Age of the animal	Immunization dose	Toxin counteracting toxic strain	Dosage of offensive toxin
						D	PEDV-CV777	Age of 3 days	10^5.0TICD₅₀	PEDV-SA014	10^6.0TICD₅₀
E	PRV-TIE18(RBD)	Age of 3 days	10^5.0TICD₅₀	PEDV-SA014	10^6.0TICD₅₀
						F	DMEM	Age of 3 days	2.0ml	PEDV-SA014	10^6.0TICD₅₀

Blood was collected 14 days after immunization for detection of PEDV neutralizing antibodies, and the mean value of neutralizing antibodies in PRV-TIE18(RBD) immunization group serum was 1: 36; mean neutralizing antibody 1 for PEDV-CV777 immunization group: 33, slightly higher than the PRV-TIE18(RBD) immunized group. The experimental data are shown in FIG. 3.

After the virus challenge by PEDV SA014, no diarrhea symptom appears in both the PRV-TIE18(RBD) immune group and the PEDV-CV777 immune group, and after continuous observation for 7 days, all test pigs survive and are protected by 5/5; all of the control groups showed diarrhea symptoms, and 3 of the control groups showed lassitude and anorexia, with 5/5 onset.

TABLE 7 statistics of PRV-TIE18(RBD) versus PEDV immunogenic challenge protection test results

Group of	Diarrhea (diarrhea)	Vomiting	Loss of appetite	Number of deaths	Results
						A	0/5	0/5	0/5	0/5	5/5 protection
B
		0/5	0/5	0/5	0/5	5/5 protection
C							5/5	0/5	3/5	0/5	5/5 onset of disease

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Sichuan Huashen animal bioproduct Co., Ltd

<120> recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine

<160>5

<170>PatentIn version 3.5

<210>1

<211>1151

<212>DNA

<213> Artificial sequence

<400>1

ggcgtgaaca tcctcaccga cttcatggtg gcgctccccg aggggcaaga gtgcccgttc 60

gcccgcgtgg accagcaccg cacgtacaag ttcggcgcgt gctggagcga cgacagcttc 120

aagcggggcg tggacgtgat gcgattcctg acgccgttct accagcagcc cccgcaccgg 180

gaggtggtga actactggta ccgcaagaac ggccggacgc tcccgcgggc ctacgccgcc 240

gccacgccgt acgccatcga ccccgcgcgg ccctcggcgg gctcgccgag gcccaggccc 300

cggccccggc ccaggccccg gccgaagccc gagcccgccc cggcgacgcc cgcgcccccc 360

ggccgcctgc ccgagccggc gacgcgggac cacgccgccg gggggcgccc cacgccgcga 420

cccccgaggc ccgagacgcc gcaccgcccc ttcgccccgc cggccgtcgt gcccagcggg 480

tggccgcagc ccgcggagcc gttcccgccc cggaccaccg ccgcgccggg cgtctcgcgc 540

caccgctcgg tgatcgtcgg cacgggcacc gcgatgggcg cgctcctggt gggcgtgtgc 600

gtctacatct tcttccgcct gaggggggcg aaggggtatc gcctcctggg cggtcccgcg 660

gacgccgacg agctaaaagc gcagcccggt ccgtagcctc cgcagtaccg gcgtcgatga 720

tgatggtggc gcgcgacgtg acccggctcc ccgcggggct cctcctcgcc gccctgaccc 780

tggccgccct gaccccgcgc gtcgggggcg tcctcttcag gggcgccggc gtcagcgtgc 840

acgtcgccgg cagcgccgtc ctcgtgcccg gcgacgcgcc caacctgacg atagacggga 900

cgctgctgtt tctggagggg ccctcgccga gcaactacag cgggcgcgtg gagctgctgc 960

gcctcgaccc caagcgcgcc tgctacacgc gcgagtacgc cgccgagtac gacctctgcc 1020

cccgcgtgca ccacgaagcc ttccgcggct gcctgcgcaa gcgcgagccg ctcgcccggc 1080

gcgcgtccgc cgcggtggag gcgcgccggc tattaatata acttcgtata gcatacatta 1140

tacgaagtta t 1151

<210>2

<211>999

<212>DNA

<213> Artificial sequence

<400>2

atctcccccg gctcgctggc cctgctgccg cgcgccgtgc gccccgtcgt gcggacgcgg 60

tccgacccca cggcgccgtt ctacatcacc accgagacgc acgagctgac gcggcgcccc 120

ccggcggacg gctcgaagcc cggggagccc ctcaggatca gcccaccccc gcggctggac 180

acggagtggt cgtccgtcct gaacgggatc cagtacctga actcgggggc ccggggcacg 240

gcccccgtcc acctgtggat cctgggcgcc gccgacctct gcgaccaggt gctcctggcc 300

gcctcccgca gcaccgccgc cggagcctcc cacgcccaga cgggcgcgcg cctgacccgg 360

cgccggcccg ggctgacgga cgccgacgcc ctggacgtga tcgtcgccgg gatccaggcg 420

acccgcgcca tgttcgcgcg ggtccacaac cgctcctggc gccacgccgg cgagtggacg 480

gaggccctgc actcccagat cgtgacccgg ggcgacgtgc gccggcgccg aggcgggcgc 540

ggcaacggac gcgagcgcgc cccgcgatgt accatctcct agacggcagg atctctccgc 600

gtcccccacc cccccaaaaa acaaacaata aacgctctcg ctctggcacc cgatgacacg 660

cctccgtcct ctctctccct cccactgacg ccacccctcc cctcgccgac aacgccatcg 720

tcgcccggcg tcggccggac cggcggttct ccccccaccc cgtccccccc caccccgtcc 780

ccccccaccc ctgcccccgc ttcgtccgac tctcgccccc cgcgggaggg ttccgcggct 840

cgctccccgt ctcatccccc cgtctcatcc ccccgtctca ctcccatctc cctccctcca 900

ccccgtctca tccccccatc tcccttcccc acgagggccg ggaggggaaa aaacgcccga 960

gagacgagag agttgaggtt cgagcggcgg gccgccgtg 999

<210>3

<211>1683

<212>DNA

<213> Artificial sequence

<400>3

ggcagtggag gcagtggaga gggcagagga agtctgctaa catgcggtga cgtcgaggag 60

aatcctggcc cagaattcat gcatcaccac caccaccacg gaccaaggct gcagccatac 120

ggaggactgc aggacggaca ggtgaagatc ggatccgccc ccgtgctggt gtacagcaac 180

atcggcgtgt gcaagagcgg atccatcgga agcgcctccg gaagcatcgg atacgtgcca 240

ctgcaggacg gccaggtgaa gatcggcggc tactctaata tcggcgtgtg caagggaagc 300

gcctgggcct tctacgtgcg cggatccgcc atgcagtacg tgtacacccc cacctactac 360

atgctgggaa gcgcccggtc cgactccagc ggcaagaaca ccccaaaggg aagcgccgga 420

tccgccggaa gcgccggctc cgccggcagc gccctggacg acggcttcta ccccatctcc 480

agccgcaacc tgctgtccca cgagcagccc atcagcttcg tgaccctgcc atccttcaac 540

gaccacagct tcgtgaacat caccgtgtcc gccagcttcg gcggcaggtc cggagctaac 600

ctgatcgcca gcgacaccac catcaacggc ttctccagct tctgcgtgga caccagacag 660

ttcaccatct ccctgttcta caacgtgacc aacagctacg gctacgtgtc caagagccag 720

gactccaact gccccttcac cctgcagagc gtgaacgact acctgtcctt cagcaagttc 780

tgcgtgtcca ccagcctgct ggcttccgcc tgcaccatcg acctgttcgg ctacccagac 840

ttcggctccg gcgtgaagtt caccagcctg tacttccagt tcaccaccgg agagctgatc 900

accggaaccc caaagccact ggagggagtg accgacgtgg gatccgccag cttccaccag 960

ctgccagccc gcagccccct gccagaattc ggaggaggag gatccggagg aggaggcagc 1020

ggcggcggcg gctccggcgg cggcggcagc aagatcgagg acgagcgcaa cctgcacgag 1080

gacttcgtgt tcatcaagac catccagcgg tgcaagcagg gagagggatc cctgagcctg 1140

ctgaactgcg aggagatccg gtcccagttc gaggacctgg tgaagggcat catgcagtcc 1200

aaggaggtga agaagaagga gaagagcttc gagatgcaca agggcgacca ggacccacag 1260

atcgctgctc acgtgatctc cgaggcttcc agcaagaccg ctagcgtgct gcagtgggct 1320

ccaaagggct actacaccct gagcaccaac ctggtgaccc tggagaacgg caggcagctg 1380

gccgtgaaga gacagggcat ctactacatc tacgcccagg tgaccttctg ctccaacagg 1440

gacgctgctg gacaggctcc cttcatcgcc agcctgtgcc tgagatcccc aagcggatcc 1500

gagcgcatcc tgctgagggc tgctaacacc cactccagct ccaagccatg cggacagcag 1560

tccatccacc tgggaggcgt gttcgagctg cagccaggag ctagcgtgtt cgtgaacgtg 1620

accgacccat cccaggtgag ccacggaacc ggcttcacca gcttcggcct gctgaagctg 1680

tga 1683

<210>4

<211>1000

<212>DNA

<213> Artificial sequence

<400>4

ccactgcccg ggtgatggcg ctcggcgggg cgctgtacgt gcccgagccg atggcgtact 60

ggcgcactct gttcgacacg gacacggtgg ccggtattta cgatgcgcag acccggaagc 120

agaacggcag cctgagcgag gaggacgcgg ccctcgtcac ggcgcagcac caggccgcct 180

tcgcgacgcc gtacctgctg ctgcacacgc gcctggtccc gctcttcggg cccgcggtcg 240

agggcccgcc cgagatgacg gtcgtctttg accgccaccc ggtggccgcg acggtgtgct 300

tcccgctggc gcgcttcatc gtcggggaca tcagcgcggc ggccttcgtg ggcctggcgg 360

ccacgctgcc cggggagccc cccggcggca acctggtggt ggcctcgctg gacccggacg 420

agcacctgcg gcgcctgcgc gcccgcgcgc gcgccgggga gcacgtggac gcgcgcctgc 480

tcacggccct gcgcaacgtc gacctggggc cctcgccgcg cgtctgcgcc gcggccgtgg 540

cggcgcagac gcgcggcatg gaggtgacgg agtccgcgta cggcgaccac atccggcagt 600

gcgtgtgcgc cttcacgtcg gagatggggg tgtgaccctc gcccctccca cccgcgccgc 660

ggccagatgg agaccgcgac ggaggcaacg acgacggcgt gggagggggc tcggggcgcg 720

tataaagcta tgtgtatgtc atcccaataa agtttgccgt gcccgtcacc atgcccgcgt 780

cgtccgtgcg cctcccgctg cgcctcctga ccctcgcggg cctcctggcc ctcgcggggg 840

ccgccgccct cgcccgcggc gcgccgcagg gtgggccgcc ctcgccgcag gggggtcccg 900

cgcccaccgc ggcgcccgcg cgcgggccca ccctgttcgt cctggtcggc gacggctccg 960

cgtggttcgt cttccagctc ggcgggctgg gggcgctcaa 1000

<210>5

<211>409

<212>PRT

<213> Artificial sequence

<400>5

Leu Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His

1 5 10 15

Glu Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser

20 25 30

Phe Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly Arg Ser Gly Ala

35 40 45

Asn Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys

50 55 60

Val Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn

65 70 75 80

Ser Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr

85 90 95

Leu Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser

100 105 110

Thr Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro

115 120 125

Asp Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr

130 135 140

Thr Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr

145 150 155 160

Asp Val Gly Ser Ala Ser Phe His Gln Leu Pro Ala Arg Ser Pro Leu

165 170 175

Pro Glu Phe Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

180 185 190

Gly Ser Gly Gly Gly Gly Ser Lys Ile Glu Asp Glu Arg Asn Leu His

195 200 205

Glu Asp Phe Val Phe Ile Lys Thr Ile Gln Arg Cys Lys Gln Gly Glu

210 215 220

Gly Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Arg Ser Gln Phe Glu

225 230 235 240

Asp Leu Val Lys Gly Ile Met Gln Ser Lys Glu Val Lys Lys Lys Glu

245 250 255

Lys Ser Phe Glu Met His Lys Gly Asp Gln Asp Pro Gln Ile Ala Ala

260 265 270

His Val Ile Ser Glu Ala Ser Ser Lys Thr Ala Ser Val Leu Gln Trp

275 280 285

Ala Pro Lys Gly Tyr Tyr Thr Leu Ser Thr Asn Leu Val Thr Leu Glu

290 295 300

Asn Gly Arg Gln Leu Ala Val Lys Arg Gln Gly Ile Tyr Tyr Ile Tyr

305 310 315 320

Ala Gln Val Thr Phe Cys Ser Asn Arg Asp Ala Ala Gly Gln Ala Pro

325 330 335

Phe Ile Ala Ser Leu Cys Leu Arg Ser Pro Ser Gly Ser Glu Arg Ile

340 345 350

Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ser Lys Pro Cys Gly Gln

355 360 365

Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser

370 375 380

Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly

385 390 395 400

Phe Thr Ser Phe Gly Leu Leu Lys Leu

405

Claims

1. A recombinant porcine Pseudorabies virus (Pseudorabies virus) is characterized in that the preservation number is CGMCCNo: 16289.

2. use of the recombinant porcine pseudorabies virus according to claim 1 for the preparation of a vaccine for pigs.

3. A recombinant porcine pseudorabies live vaccine for the prevention of porcine pseudorabies and/or porcine epidemic diarrhea, characterized in that it comprises the recombinant pseudorabies virus according to claim 1 and a stabilizer.

4. A method for preparing the recombinant porcine pseudorabies live vaccine according to claim 3, comprising the steps of: step (a): inoculating the recombinant porcine pseudorabies virus of claim 1 into passaged cells, and harvesting a virus solution; step (b): the harvested virus fluid is mixed with a stabilizer.

5. The method of claim 4, wherein the stabilizer is a gelatin sucrose protectant; the gelatin-sucrose protective agent contains 1-3% of gelatin and 10% of sucrose.