CN109337874A - A kind of recombinant porcine pseudorabies are malicious and its apply and recombinant porcine pseudorabies live vaccine - Google Patents

A kind of recombinant porcine pseudorabies are malicious and its apply and recombinant porcine pseudorabies live vaccine Download PDF

Info

Publication number
CN109337874A
CN109337874A CN201811508840.3A CN201811508840A CN109337874A CN 109337874 A CN109337874 A CN 109337874A CN 201811508840 A CN201811508840 A CN 201811508840A CN 109337874 A CN109337874 A CN 109337874A
Authority
CN
China
Prior art keywords
recombinant
pseudorabies
porcine pseudorabies
virus
poison
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811508840.3A
Other languages
Chinese (zh)
Other versions
CN109337874B (en
Inventor
周远成
代洪波
林艳
廖果
王雪涛
邝声耀
阴文奇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Huashen Animal Biological Products Co ltd
Original Assignee
Sichuan Huashen Animal Biological Products Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Huashen Animal Biological Products Co ltd filed Critical Sichuan Huashen Animal Biological Products Co ltd
Priority to CN201811508840.3A priority Critical patent/CN109337874B/en
Publication of CN109337874A publication Critical patent/CN109337874A/en
Application granted granted Critical
Publication of CN109337874B publication Critical patent/CN109337874B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5254—Virus avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16721—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16761—Methods of inactivation or attenuation
    • C12N2710/16762—Methods of inactivation or attenuation by genetic engineering

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention discloses a kind of recombinant porcine pseudorabies poison and its application and recombinant porcine pseudorabies live vaccines, are related to animal biological product field.The deposit number of recombinant porcine pseudorabies poison provided by the invention is CGMCC No:16289.The recombinant porcine pseudorabies poison is obtained after artificial reconstructed, pathogenic to be removed, and has lacked Pseudorabies virus TK, gI, gE, 11K and 28K gene, and can express the fusion protein of Porcine epidemic diarrhea virus S truncated protein fusion pig CD40L albumen.It can make the immunity that pig obtains resistance Porcine epidemic diarrhea virus and porcine pseudorabies virus attacks poison after the recombination pseudorabies living vaccines immune swine prepared using the recombinant porcine pseudorabies poison.Immune effect is preferable, has broad application prospects.

Description

A kind of recombinant porcine pseudorabies are malicious and its apply and recombinant porcine pseudorabies live vaccine
Technical field
The present invention relates to animal biological product fields, in particular to a kind of recombinant porcine pseudorabies poison and its application With recombinant porcine pseudorabies live vaccine.
Background technique
Porcine pseudorabies (Pseudorabies, PR) are also known as aujeszky's disease (Aujeszky's disease, AD), are A variety of domestic animals such as pig, ox, sheep caused by Pseudorabies virus (Pseudorabiesvirus, PRV) and wild animal are to send out Heat, surprise are itched (except pig) and encephalomyelitis is a kind of highly contagious disease of cardinal symptom.Pig be the disease natural host, Major storage host and the infection sources, PRV can infect the pig of institute's has age, more serious, the death rate of falling ill after age smaller infection Also higher.The death rate is very high after suckling pig infection, up to 100%, may occur in which the nervous symptoms such as diarrhea, vomiting, four limbs swimming； Fever and respiratory symptom are mainly shown as after weanling pig and growing and fattening pigs infection；It does not fall ill or is showed only as after Adult Pig infection The light symptoms such as body temperature raising, mostly in stealthy infection；Will lead to miscarriage after pregnant sow infection, produce stillborn foetus, the mummification of fetus etc.；It should Disease can also cause boar infertility, Testis of Boar Pig swelling etc..
The multiple area outburst porcine pseudorabies in 2011 front and backs China cause huge economic damage to China's pig-breeding industry It loses.The same period, also there is the eruption and prevalence of pig epidemic diarrhea in China.It is found by laboratory testing, there are pigs in many cases The mixed infection of Pseudorabies virus and Porcine epidemic diarrhea virus.Morbidity severity is in age pig year after two kinds of pathogen infections Negative correlation is responsible for grice diarrhoea vomiting.It, can be significant using vaccine immunity for porcine pseudorabies and pig epidemic diarrhea Economic loss caused by due to disease infection is reduced, but there is no on porcine pseudorabies and Porcine epidemic diarrhea virus bigeminy vaccine City.Therefore develop a kind of can prevent porcine pseudorabies and the recombinant vaccine of pig epidemic diarrhea is extremely urgent simultaneously.
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of recombinant porcine pseudorabies poison, which is manually to be changed Obtained after making, by gene editing and recombinant technique lacked Pseudorabies virus principal causative gene TK, gI, gE and 11K, 28K gene, and inserted in the position of gI, gE, 11K and 28K gene delection and can express Porcine epidemic diarrhea virus S protein Truncated segment and merge the fusion protein of pig CD40L albumen.Constructed recombinant virus is to pig no pathogenicity, immunogenicity It is effectively retained, resistance porcine pseudorabies can be provided for pig after the vaccine immunity pig prepared using the recombinant porcine pseudorabies poison The immunity of poison and Porcine epidemic diarrhea virus.
Another object of the present invention is to provide the applications of above-mentioned recombinant porcine pseudorabies poison.
Another object of the present invention is to provide a kind of recombinant porcine pseudorabies live vaccines, and the vaccine is by above-mentioned Recombinant Swine Pseudorabies virus is made, with preferable immune effect.
Another object of the present invention is to provide a kind of methods for preparing above-mentioned recombinant porcine pseudorabies vaccine.Pass through the party Recombinant porcine pseudorabies live vaccine made from method has preferable immune effect.
The present invention is implemented as follows:
On the one hand, the present invention provides a kind of recombinant porcine pseudorabies poison, deposit number is CGMCC No:16289.
Further, the recombinant pseudorabies virus lacks following gene: TK, gI, gE, 11K and 28K.
Further, the recombinant pseudorabies virus can express Porcine epidemic diarrhea virus S albumen, the S protein packet Receptor binding domain containing Porcine epidemic diarrhea virus.
Further, the recombinant pseudorabies virus can express pig CD40L albumen.
Further, foreign protein expressed by the recombinant pseudorabies virus be Porcine epidemic diarrhea virus S protein by The fusion protein that body binding structural domain and pig CD40L albumen are formed.
Further, the amino acid sequence of the fusion protein is as shown in SEQ ID NO.5.
Recombinant porcine pseudorabies poison provided by the invention be lacked on the basis of PRV-FJ plants of Pseudorabies virus TK, GI, gE, 11K and 28K gene obtain recombinant porcine pseudorabies poison of the invention after gene editing.
The strain was preserved in positioned at the Chinese micro- of Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 on 08 29th, 2018 Biological deposits administration committee common micro-organisms center (CGMCC), taxology name: porcine pseudorabies virus (Pseudorabies virus)；Deposit number: CGMCC NO.16289.
Using the recombinant virus via intranasal application be inoculated with 1 age in days piglet, do not cause piglet to fall ill, to pig do not have it is pathogenic, this Outside, it using vaccine made of the recombinant porcine pseudorabies poison strain, is verified through Study On Immunogenicity, gE antibody test result is Feminine gender, gB antibody is the positive, and be can induce in the porcine pseudorabies virus neutralizing antibody and Porcine epidemic diarrhea virus of more efficient valence And antibody, it can be effective against the invasion of porcine pseudorabies and pig epidemic diarrhea.
On the other hand, the application the present invention provides above-mentioned recombinant porcine pseudorabies poison in preparation pig vaccine.
Wherein, the pig vaccine is the vaccine for preventing porcine pseudorabies and/or pig epidemic diarrhea；Preferably, The vaccine is live vaccine.
In another aspect, the present invention provides a kind of recombinant porcine pseudorabies live vaccines comprising recombination as described above is pseudo- Rabies viruses and stabilizer.
Further, in some embodiments of the present invention, the stabilizer is gelatin sucrose protective agent.
Further, in some embodiments of the present invention, in the gelatin sucrose protective agent gelatin containing 1%-3% and 10% sucrose, surplus are water.
On the other hand, the present invention provides a kind of preparation method of recombinant porcine pseudorabies live vaccine as described above, Include the following steps:
Step (a): recombinant porcine pseudorabies poison as described above is inoculated with passage cell, harvests virus liquid；
Step (b): the virus liquid of harvest is mixed with stabilizer.
Further, the preparation method further include: step (c): by the mixed solution of virus liquid and stabilizer through vacuum The pseudorabies disease live-vaccine of finished product is made in freeze-drying.
Further, in some embodiments of the present invention, the stabilizer is gelatin sucrose protective agent.
Further, in some embodiments of the present invention, based on mass volume ratio, in the gelatin sucrose protective agent Gelatin containing 1%-3% (i.e. 100ml gelatin sucrose protective agent gelatin containing 1-3g) and 10% sucrose.
Further, in some embodiments of the present invention, in step (b), the virus liquid and stabilizer with etc. Volume mixture.
Further, in some embodiments of the present invention, the passage cell is ST cell, BHK21 cell, MDBK Cell, VERO cell, mdck cell, PK15 cell, 293T cell, 293F cell etc., preferably BHK21 cell.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this A little attached drawings obtain other relevant attached drawings.
Fig. 1 is immune rear PRV gB/gE antibody on the 28th and Pseudorabies virus neutralizing antibody measurement result, and note: gB/gE is anti- Physical examination is surveyed, and S/N value is the positive less than 0.6, is greater than 0.7 for feminine gender, 0.6 to 0.7 is suspicious.
Fig. 2 is that PRV-FJ attacks Temperature changing curve graph after poison, note: it is fever that body temperature, which is more than 40.5 DEG C,.
Fig. 3 is immune rear PEDV serum neutralizing antibody testing result on the 14th.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
Artificial reconstructed Pseudorabies virus
1, strain
PRV-FJ plants, by livestock and poultry infectious disease Key Laboratory of Sichuan Province from Fujian pseudorabies morbid pig pathological material of disease in 2015 Separation obtains；Morbid pig is mainly shown as that body temperature increases, loss of appetite, the symptoms such as sneezing.PRV-FJ plants with 107TCID50/ head Dosage infect 28 age in days weanling pigs, impassivity symptom, attack after poison 7 days it is all dead.
PEDV-CV777 plants and SA014 plants save offer by livestock and poultry infectious disease Key Laboratory of Sichuan Province.
ST cell and 293T cell, to contain the DMEM culture solution culture (Gibco company) of 10% fetal calf serum.
2, construction of recombinant vector
Artificial synthesized SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3SEQ ID NO.4, then by SEQ ID NO.1 directed cloning is named as pEGFP-gI at I restriction enzyme site of Ase of pEGFP-C1 carrier, and SEQ ID NO.2 is determined To being cloned at I restriction enzyme site of Mlu of pEGFP-gI, it is named as pEGFP-gI28K, SEQ ID NO.3 is cloned into Between I restriction enzyme site of BspE I and Bcl of pEGFP-gI28K carrier, the carrier built is named as pPED-RBDCD40L.It will SEQ ID NO.4 directed cloning is named as pUC-TK between EcoR1 the and HindIII restriction enzyme site of pUC57 carrier.
3, gene editing vector construction
TK and gE base is constructed according to LentiCRISPR v2 carrier (Addgene company) specification method using 1 primer of table Because of the carrier of editor, it is respectively designated as carrier psgRNA-TK and psgRNA-gE.
Tetra- genes of gI, gE, 11K and 28K are adjacent, therefore can be simultaneously using psgRNA-gE and corresponding homologous sequence Lack 4 genes.
1 gRNA of table constructs primer information
4, recombinant virus constructs
Conventionally extract PRV-FJ pnca gene group DNA；By PRV-FJ genomic DNA (3 μ g), pUC-TK plasmid Referring to (the Thermo fisher of Lipofectamine 3000 after the mixing of (5 μ g) and psgRNA-TK plasmid (5 μ g) Scientific) specification transfects the good 293T cell of growth conditions, and 37 DEG C of cultures are to there is cytopathy after transfection.Take disease Malicious supernatant is inoculated with BHK21 cell, selects the thermophilic spot of single virus.Take the thermophilic spot inoculation BHK21 cell of the virus selected, harvest virus Liquid conventionally extracts viral DNA, uses primer TKF:CATCCTCCGGATCTACCTCGACGGC and TKR: CACACCCCCATCTCCGACGTGAAGG is referring to Lyophilized HS Taq PCR Master Mix (TAKARA) kit Specification carries out PCR amplification, and the sample that amplified fragments are about 680bp is selected to carry out sequencing.Disease will be purified after sequencing Malicious rPRV-FJ-delTK.
RPRV-FJ-delTK genome is conventionally extracted, genomic DNA (3 μ g), the pPED- of extraction are taken RBDCD40L plasmid (5 μ g) and psgRNA-gE are referring to Lipofectamine 3000 (Thermo fisher scientific) Specification transfects the good 293T cell of growth conditions, and 37 DEG C of cultures are to there is cytopathy after transfection.Viral supernatants are taken to be inoculated with ST cell, the thermophilic spot of picking green fluorescence carry out the thermophilic spot purifying of three-wheel, purified virus are named as rPRV-TIE18 (RBD).
PPED-RBDCD40L plasmid contains gE and 28K DNA homolog arm, and has CMV promoter among homology arm, coding The coded sequence and poly a-signal sequence of PEDV S truncated protein and CD40L fusion protein.Therefore the plasmid is recombinated to puppet PEDV S protein and CD40L fusion protein can be given expression to after on rabies viruses.
5, the preservation of recombinant virus
RPRV-TIE18 (RBD) virus after identification is conventionally inoculated with BHK21 cell, culture is to there is CPE After harvest viral supernatants, after packing -80 DEG C preservation.
The strain was preserved in positioned at the Chinese micro- of Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 on 08 29th, 2018 Biological deposits administration committee common micro-organisms center (CGMCC), taxology name: porcine pseudorabies virus (Pseudorabies virus)；Deposit number: CGMCC NO.16289.
Embodiment 2
RPRV-TIE18's (RBD) is pathogenic
1~3 age in days PRV negative antibody piglet 20 is taken, 4 groups is randomly divided into and is respectively labeled as A, B, C, D group, under Table carries out challenge test.It is observed continuously 14 after attacking poison.
Pathogenicity of 2 rPRV-TIE18 of table (RBD) and PRV-FJ to newborn piglet
Group Attack poison strain Attack toxic dose Vaccination ways Remarks
A rPRV-TIE18(RBD) 108TICD50 Collunarium
B rPRV-TIE18(RBD) 107TICD50 Collunarium
C DMEM culture solution 2.0ml Collunarium Blank control
D PRV-FJ 107TICD50 Collunarium
It attacks and observes and measure piglet body temperature after poison daily, see whether pseudoabies clinical symptoms and death occur.As a result Do not occur body temperature raising and other clinical symptoms after rPRV-TIE18 (RBD) collunarium as shown in table 3 below, and collunarium is inoculated with PRV- There is within the piglet of FJ second day after attacking poison piglet body temperature occur and increase (see Fig. 2), diarrhea, symptoms of emesis and nervous symptoms, attacks poison Piglet death in 3rd day afterwards, all death in the 4th day after attacking poison.Blank control group does not occur any clinical symptoms, tests entire mistake Cheng Zhongjun is normal.
3 PRV-TIE18 of table (RBD) and PRV-FJ counts newborn piglet pathogenicity test results
Group Fever Diarrhea and vomiting Nervous symptoms The dead quantity
A 0/5 0/5 0/5 0/5
B 0/5 0/5 0/5 0/5
C 0/5 0/5 0/5 0/5
D 5/5 4/5 4/5 5/5
Embodiment 3
The preparation and inspection of pseudorabies disease live-vaccine rPRV-TIE18 (RBD)
RPRV-TIE18 (RBD) is inoculated with bhk cell, harvests virus liquid when 90% or more cytopathy.It will harvest disease After being mixed in equal volume after 2 times of venom dilutions with gelatin sucrose protective agent (containing 2% gelatin and 10% sucrose), by 2ml/ bottles dispense into Row vacuum freezedrying.It examines according to " Chinese veterinary drug shop " annex without bacterium and mycoplasma contamination, no exogenous virus pollution.Culture Virus liquid potency is 108.0TCID50/ ml, it is respectively 10 that freeze dried vaccine, which reverts to original volume viral level,7.25TCID50/ml。
Embodiment 4
The immunogenicity of pseudorabies disease live-vaccine rPRV-TIE18 (RBD)
(1) PRV-TIE18 (RBD) is to PRV Study On Immunogenicity
3-4 week old porcine pseudorabies antigen-antibody feminine gender piglet 15 are chosen, totally 3 groups of A, B, C are divided at random, by table 4 Carry out intramuscular injection inoculation.28 days after vaccine inoculation, all test pig blood sampling separation serum carry out gB antibody (IDEXX), gE resists Body (IDEXX) and serum neutralizing antibody (PRV-FJ neutralization) detection.Blood sampling on the 28th terminates after exempting from, and all test pig collunariums connect Kind PRV-FJ (107TICD50/ head) carry out protest test.
4 PRV-TIE18 of table (RBD) is grouped PRV Study On Immunogenicity
Group Strain Animal age in days Immunizing dose Attack poison strain Attack toxic dose
A PRV-TIE18(RBD) 3-4 week old 105.0TICD50 PRV-FJ 107TICD50
B PRV-Bartha K61 3-4 week old 105.5TICD50 PRV-FJ 107TICD50
C DMEM 3-4 week old 2.0ml PRV-FJ 107TICD50
28 days after immune, the gE antibody test result of 2 immune groups and control group equal 0/5 is positive；PRV-TIE18(RBD) Totally 2 immune group gB antibody equal 5/5 are positive with PRV-Bartha K61, and control group gB antibody 0/5 is positive；PRV-TIE18 (RBD) immune group is higher than PRV-Bartha K61 immune group (mean value 36) to the serum neutralizing antibody (mean value 61) of PRV-FJ, Control group is without PRV-FJ neutralizing antibody.Test data is shown in Fig. 1, in Fig. 1: gB/gE antibody test, and S/N value is the positive less than 0.6, It is feminine gender greater than 0.7,0.6 to 0.7 is suspicious.
PRV protest test the results are shown in Table 5.After PRV-FJ attacks poison, PRV-TIE18 (RBD) immune group is not sent out Heat and spiritual loss of appetite, are observed continuously all survivals on the 14th, 5/5 protection；PRV-Bartha K61 immune group 1/5 is sent out Heat and spiritual appetite stimulator, all survive in the observation period, 1/5 morbidity, 4/5 protection；Control group all generates heat, and spirit all occurs Appetite stimulator, dead 2 in the observation period, 5/5 morbidity, 2/5 is dead.
5 PRV-TIE18 of table counts PRV immunogenicity protest test result
(2) PRV-TIE18 (RBD) is to PEDV Study On Immunogenicity
3 age in days Porcine epidemic diarrhea virus antigen-antibody feminine genders piglet 15 are chosen, totally 3 groups of A, B, C is divided at random, presses Table 6 carries out intramuscular injection inoculation.14 days after vaccine inoculation, all test pig blood sampling separation serum carry out the inspection of serum neutralizing antibody It surveys.Blood sampling on the 14th terminates after exempting from, all test pig oral vaccination PEDV-SA014 (106.0TICD50/ head) it carries out attacking poison protection examination It tests.
6 PRV-TIE18 of table (RBD) is grouped PEDV Study On Immunogenicity
Group Strain Animal age in days Immunizing dose Attack poison strain Attack toxic dose
D PEDV-CV777 3 ages in days 105.0TICD50 PEDV-SA014 106.0TICD50
E PRV-TIE18(RBD) 3 ages in days 105.0TICD50 PEDV-SA014 106.0TICD50
F DMEM 3 ages in days 2.0ml PEDV-SA014 106.0TICD50
Blood sampling on the 14th carries out the detection of PEDV neutralizing antibody, PRV-TIE18 (RBD) immune group serum neutralizing antibody after immune Mean value is 1:36；PEDV-CV777 immune group neutralizing antibody mean value 1:33, slightly above PRV-TIE18 (RBD) immune group.Test number According to seeing Fig. 3.
After attacking poison with PEDV SA014, PRV-TIE18 (RBD) immune group and PEDV-CV777 immune group do not occur abdomen Symptom is rushed down, is observed continuously 7, all test pig survivals, equal 5/5 protection；All there is symptom of diarrhea in control group, there is 3 appearance Spirit, loss of appetite, 5/5 morbidity.
7 PRV-TIE18 of table (RBD) counts PEDV immunogenicity protest test result
Group Diarrhea Vomiting Spiritual loss of appetite The dead quantity As a result
A 0/5 0/5 0/5 0/5 5/5 protection
B 0/5 0/5 0/5 0/5 5/5 protection
C 5/5 0/5 3/5 0/5 5/5 morbidity
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Sichuan Huashen Animal Biolog Products Co., Ltd.
<120>a kind of recombinant porcine pseudorabies poison and its application and recombinant porcine pseudorabies live vaccine
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 1151
<212> DNA
<213>artificial sequence
<400> 1
ggcgtgaaca tcctcaccga cttcatggtg gcgctccccg aggggcaaga gtgcccgttc 60
gcccgcgtgg accagcaccg cacgtacaag ttcggcgcgt gctggagcga cgacagcttc 120
aagcggggcg tggacgtgat gcgattcctg acgccgttct accagcagcc cccgcaccgg 180
gaggtggtga actactggta ccgcaagaac ggccggacgc tcccgcgggc ctacgccgcc 240
gccacgccgt acgccatcga ccccgcgcgg ccctcggcgg gctcgccgag gcccaggccc 300
cggccccggc ccaggccccg gccgaagccc gagcccgccc cggcgacgcc cgcgcccccc 360
ggccgcctgc ccgagccggc gacgcgggac cacgccgccg gggggcgccc cacgccgcga 420
cccccgaggc ccgagacgcc gcaccgcccc ttcgccccgc cggccgtcgt gcccagcggg 480
tggccgcagc ccgcggagcc gttcccgccc cggaccaccg ccgcgccggg cgtctcgcgc 540
caccgctcgg tgatcgtcgg cacgggcacc gcgatgggcg cgctcctggt gggcgtgtgc 600
gtctacatct tcttccgcct gaggggggcg aaggggtatc gcctcctggg cggtcccgcg 660
gacgccgacg agctaaaagc gcagcccggt ccgtagcctc cgcagtaccg gcgtcgatga 720
tgatggtggc gcgcgacgtg acccggctcc ccgcggggct cctcctcgcc gccctgaccc 780
tggccgccct gaccccgcgc gtcgggggcg tcctcttcag gggcgccggc gtcagcgtgc 840
acgtcgccgg cagcgccgtc ctcgtgcccg gcgacgcgcc caacctgacg atagacggga 900
cgctgctgtt tctggagggg ccctcgccga gcaactacag cgggcgcgtg gagctgctgc 960
gcctcgaccc caagcgcgcc tgctacacgc gcgagtacgc cgccgagtac gacctctgcc 1020
cccgcgtgca ccacgaagcc ttccgcggct gcctgcgcaa gcgcgagccg ctcgcccggc 1080
gcgcgtccgc cgcggtggag gcgcgccggc tattaatata acttcgtata gcatacatta 1140
tacgaagtta t 1151
<210> 2
<211> 999
<212> DNA
<213>artificial sequence
<400> 2
atctcccccg gctcgctggc cctgctgccg cgcgccgtgc gccccgtcgt gcggacgcgg 60
tccgacccca cggcgccgtt ctacatcacc accgagacgc acgagctgac gcggcgcccc 120
ccggcggacg gctcgaagcc cggggagccc ctcaggatca gcccaccccc gcggctggac 180
acggagtggt cgtccgtcct gaacgggatc cagtacctga actcgggggc ccggggcacg 240
gcccccgtcc acctgtggat cctgggcgcc gccgacctct gcgaccaggt gctcctggcc 300
gcctcccgca gcaccgccgc cggagcctcc cacgcccaga cgggcgcgcg cctgacccgg 360
cgccggcccg ggctgacgga cgccgacgcc ctggacgtga tcgtcgccgg gatccaggcg 420
acccgcgcca tgttcgcgcg ggtccacaac cgctcctggc gccacgccgg cgagtggacg 480
gaggccctgc actcccagat cgtgacccgg ggcgacgtgc gccggcgccg aggcgggcgc 540
ggcaacggac gcgagcgcgc cccgcgatgt accatctcct agacggcagg atctctccgc 600
gtcccccacc cccccaaaaa acaaacaata aacgctctcg ctctggcacc cgatgacacg 660
cctccgtcct ctctctccct cccactgacg ccacccctcc cctcgccgac aacgccatcg 720
tcgcccggcg tcggccggac cggcggttct ccccccaccc cgtccccccc caccccgtcc 780
ccccccaccc ctgcccccgc ttcgtccgac tctcgccccc cgcgggaggg ttccgcggct 840
cgctccccgt ctcatccccc cgtctcatcc ccccgtctca ctcccatctc cctccctcca 900
ccccgtctca tccccccatc tcccttcccc acgagggccg ggaggggaaa aaacgcccga 960
gagacgagag agttgaggtt cgagcggcgg gccgccgtg 999
<210> 3
<211> 1683
<212> DNA
<213>artificial sequence
<400> 3
ggcagtggag gcagtggaga gggcagagga agtctgctaa catgcggtga cgtcgaggag 60
aatcctggcc cagaattcat gcatcaccac caccaccacg gaccaaggct gcagccatac 120
ggaggactgc aggacggaca ggtgaagatc ggatccgccc ccgtgctggt gtacagcaac 180
atcggcgtgt gcaagagcgg atccatcgga agcgcctccg gaagcatcgg atacgtgcca 240
ctgcaggacg gccaggtgaa gatcggcggc tactctaata tcggcgtgtg caagggaagc 300
gcctgggcct tctacgtgcg cggatccgcc atgcagtacg tgtacacccc cacctactac 360
atgctgggaa gcgcccggtc cgactccagc ggcaagaaca ccccaaaggg aagcgccgga 420
tccgccggaa gcgccggctc cgccggcagc gccctggacg acggcttcta ccccatctcc 480
agccgcaacc tgctgtccca cgagcagccc atcagcttcg tgaccctgcc atccttcaac 540
gaccacagct tcgtgaacat caccgtgtcc gccagcttcg gcggcaggtc cggagctaac 600
ctgatcgcca gcgacaccac catcaacggc ttctccagct tctgcgtgga caccagacag 660
ttcaccatct ccctgttcta caacgtgacc aacagctacg gctacgtgtc caagagccag 720
gactccaact gccccttcac cctgcagagc gtgaacgact acctgtcctt cagcaagttc 780
tgcgtgtcca ccagcctgct ggcttccgcc tgcaccatcg acctgttcgg ctacccagac 840
ttcggctccg gcgtgaagtt caccagcctg tacttccagt tcaccaccgg agagctgatc 900
accggaaccc caaagccact ggagggagtg accgacgtgg gatccgccag cttccaccag 960
ctgccagccc gcagccccct gccagaattc ggaggaggag gatccggagg aggaggcagc 1020
ggcggcggcg gctccggcgg cggcggcagc aagatcgagg acgagcgcaa cctgcacgag 1080
gacttcgtgt tcatcaagac catccagcgg tgcaagcagg gagagggatc cctgagcctg 1140
ctgaactgcg aggagatccg gtcccagttc gaggacctgg tgaagggcat catgcagtcc 1200
aaggaggtga agaagaagga gaagagcttc gagatgcaca agggcgacca ggacccacag 1260
atcgctgctc acgtgatctc cgaggcttcc agcaagaccg ctagcgtgct gcagtgggct 1320
ccaaagggct actacaccct gagcaccaac ctggtgaccc tggagaacgg caggcagctg 1380
gccgtgaaga gacagggcat ctactacatc tacgcccagg tgaccttctg ctccaacagg 1440
gacgctgctg gacaggctcc cttcatcgcc agcctgtgcc tgagatcccc aagcggatcc 1500
gagcgcatcc tgctgagggc tgctaacacc cactccagct ccaagccatg cggacagcag 1560
tccatccacc tgggaggcgt gttcgagctg cagccaggag ctagcgtgtt cgtgaacgtg 1620
accgacccat cccaggtgag ccacggaacc ggcttcacca gcttcggcct gctgaagctg 1680
tga 1683
<210> 4
<211> 1000
<212> DNA
<213>artificial sequence
<400> 4
ccactgcccg ggtgatggcg ctcggcgggg cgctgtacgt gcccgagccg atggcgtact 60
ggcgcactct gttcgacacg gacacggtgg ccggtattta cgatgcgcag acccggaagc 120
agaacggcag cctgagcgag gaggacgcgg ccctcgtcac ggcgcagcac caggccgcct 180
tcgcgacgcc gtacctgctg ctgcacacgc gcctggtccc gctcttcggg cccgcggtcg 240
agggcccgcc cgagatgacg gtcgtctttg accgccaccc ggtggccgcg acggtgtgct 300
tcccgctggc gcgcttcatc gtcggggaca tcagcgcggc ggccttcgtg ggcctggcgg 360
ccacgctgcc cggggagccc cccggcggca acctggtggt ggcctcgctg gacccggacg 420
agcacctgcg gcgcctgcgc gcccgcgcgc gcgccgggga gcacgtggac gcgcgcctgc 480
tcacggccct gcgcaacgtc gacctggggc cctcgccgcg cgtctgcgcc gcggccgtgg 540
cggcgcagac gcgcggcatg gaggtgacgg agtccgcgta cggcgaccac atccggcagt 600
gcgtgtgcgc cttcacgtcg gagatggggg tgtgaccctc gcccctccca cccgcgccgc 660
ggccagatgg agaccgcgac ggaggcaacg acgacggcgt gggagggggc tcggggcgcg 720
tataaagcta tgtgtatgtc atcccaataa agtttgccgt gcccgtcacc atgcccgcgt 780
cgtccgtgcg cctcccgctg cgcctcctga ccctcgcggg cctcctggcc ctcgcggggg 840
ccgccgccct cgcccgcggc gcgccgcagg gtgggccgcc ctcgccgcag gggggtcccg 900
cgcccaccgc ggcgcccgcg cgcgggccca ccctgttcgt cctggtcggc gacggctccg 960
cgtggttcgt cttccagctc ggcgggctgg gggcgctcaa 1000
<210> 5
<211> 409
<212> PRT
<213>artificial sequence
<400> 5
Leu Asp Asp Gly Phe Tyr Pro Ile Ser Ser Arg Asn Leu Leu Ser His
1 5 10 15
Glu Gln Pro Ile Ser Phe Val Thr Leu Pro Ser Phe Asn Asp His Ser
20 25 30
Phe Val Asn Ile Thr Val Ser Ala Ser Phe Gly Gly Arg Ser Gly Ala
35 40 45
Asn Leu Ile Ala Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys
50 55 60
Val Asp Thr Arg Gln Phe Thr Ile Ser Leu Phe Tyr Asn Val Thr Asn
65 70 75 80
Ser Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr
85 90 95
Leu Gln Ser Val Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser
100 105 110
Thr Ser Leu Leu Ala Ser Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro
115 120 125
Asp Phe Gly Ser Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr
130 135 140
Thr Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Val Thr
145 150 155 160
Asp Val Gly Ser Ala Ser Phe His Gln Leu Pro Ala Arg Ser Pro Leu
165 170 175
Pro Glu Phe Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
180 185 190
Gly Ser Gly Gly Gly Gly Ser Lys Ile Glu Asp Glu Arg Asn Leu His
195 200 205
Glu Asp Phe Val Phe Ile Lys Thr Ile Gln Arg Cys Lys Gln Gly Glu
210 215 220
Gly Ser Leu Ser Leu Leu Asn Cys Glu Glu Ile Arg Ser Gln Phe Glu
225 230 235 240
Asp Leu Val Lys Gly Ile Met Gln Ser Lys Glu Val Lys Lys Lys Glu
245 250 255
Lys Ser Phe Glu Met His Lys Gly Asp Gln Asp Pro Gln Ile Ala Ala
260 265 270
His Val Ile Ser Glu Ala Ser Ser Lys Thr Ala Ser Val Leu Gln Trp
275 280 285
Ala Pro Lys Gly Tyr Tyr Thr Leu Ser Thr Asn Leu Val Thr Leu Glu
290 295 300
Asn Gly Arg Gln Leu Ala Val Lys Arg Gln Gly Ile Tyr Tyr Ile Tyr
305 310 315 320
Ala Gln Val Thr Phe Cys Ser Asn Arg Asp Ala Ala Gly Gln Ala Pro
325 330 335
Phe Ile Ala Ser Leu Cys Leu Arg Ser Pro Ser Gly Ser Glu Arg Ile
340 345 350
Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ser Lys Pro Cys Gly Gln
355 360 365
Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser
370 375 380
Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly
385 390 395 400
Phe Thr Ser Phe Gly Leu Leu Lys Leu
405

Claims (10)

1. a kind of recombinant porcine pseudorabies poison, which is characterized in that its deposit number is CGMCC No:16289.
2. recombinant porcine pseudorabies poison according to claim 1, which is characterized in that the recombinant pseudorabies virus missing is such as Lower gene: TK, gI, gE, 11K and 28K.
3. recombinant porcine pseudorabies poison according to claim 2, which is characterized in that the recombinant pseudorabies virus being capable of table Up to Porcine epidemic diarrhea virus S protein, the S protein includes Porcine epidemic diarrhea virus receptor binding domain.
4. recombinant porcine pseudorabies poison according to claim 3, which is characterized in that the recombinant pseudorabies virus being capable of table Up to pig CD40L albumen.
5. recombinant porcine pseudorabies poison according to claim 4, which is characterized in that expressed foreign protein is that pig is popular Property diarrhea virus S protein receptor binding domain and pig CD40L albumen formed fusion protein.
6. recombinant porcine pseudorabies poison according to claim 5, which is characterized in that the amino acid sequence of the fusion protein As shown in SEQ ID NO.5.
7. application of the recombinant porcine pseudorabies poison described in any one of claims 1-6 in preparation pig vaccine.
8. a kind of for preventing the recombinant porcine pseudorabies live vaccine of porcine pseudorabies and/or pig epidemic diarrhea, feature exists In comprising recombinant pseudorabies virus and stabilizer described in any one of claims 1-6.
9. the method for preparing recombinant porcine pseudorabies live vaccine as claimed in claim 8, which is characterized in that it includes following step It is rapid:
Step (a): recombinant porcine pseudorabies poison described in any one of claims 1-6 is inoculated with passage cell, harvests virus liquid；
Step (b): the virus liquid of harvest is mixed with stabilizer.
10. according to the method described in claim 9, it is characterized in that, the stabilizer is gelatin sucrose protective agent；Preferably, Gelatin containing 1%-3% and 10% sucrose in the gelatin sucrose protective agent.
CN201811508840.3A 2018-12-10 2018-12-10 Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine Active CN109337874B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811508840.3A CN109337874B (en) 2018-12-10 2018-12-10 Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811508840.3A CN109337874B (en) 2018-12-10 2018-12-10 Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine

Publications (2)

Publication Number Publication Date
CN109337874A true CN109337874A (en) 2019-02-15
CN109337874B CN109337874B (en) 2020-05-12

Family

ID=65303846

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811508840.3A Active CN109337874B (en) 2018-12-10 2018-12-10 Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine

Country Status (1)

Country Link
CN (1) CN109337874B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110305852A (en) * 2019-06-18 2019-10-08 扬州大学 Express the building of Porcine epidemic diarrhea virus S1 genetic recombination pseudorabies virus

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2430589A1 (en) * 2000-11-29 2002-07-25 University Of Rochester Helper virus-free herpes virus amplicon particles and uses thereof
CN101186902A (en) * 2006-07-04 2008-05-28 四川农业大学 Pseudorabies virus SA215, pseudorabies virus polygene deletion bacterin and preparation method thereof
CN104248762A (en) * 2014-06-24 2014-12-31 普莱柯生物工程股份有限公司 Porcine epidemic diarrhea vaccine composition, and preparation method and application thereof
CN104250640A (en) * 2014-08-22 2014-12-31 普莱柯生物工程股份有限公司 Porcine pseudorabies virus gene deletion strain, vaccine composition, preparation method and application thereof
CN107345222A (en) * 2017-06-27 2017-11-14 浙江省农业科学院 Express recombinant pseudorabies virus and its construction method and the application of Porcine epidemic diarrhea virus S1 albumen

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2430589A1 (en) * 2000-11-29 2002-07-25 University Of Rochester Helper virus-free herpes virus amplicon particles and uses thereof
CN101186902A (en) * 2006-07-04 2008-05-28 四川农业大学 Pseudorabies virus SA215, pseudorabies virus polygene deletion bacterin and preparation method thereof
CN104248762A (en) * 2014-06-24 2014-12-31 普莱柯生物工程股份有限公司 Porcine epidemic diarrhea vaccine composition, and preparation method and application thereof
CN104250640A (en) * 2014-08-22 2014-12-31 普莱柯生物工程股份有限公司 Porcine pseudorabies virus gene deletion strain, vaccine composition, preparation method and application thereof
CN107345222A (en) * 2017-06-27 2017-11-14 浙江省农业科学院 Express recombinant pseudorabies virus and its construction method and the application of Porcine epidemic diarrhea virus S1 albumen

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JINDAI FAN等: "Molecular characterization and phylogenetic analysis of pseudorabies virus variants isolated from Guangdong province of southern China during 2013–2014", 《JOURNAL OF VETERINARY SCIENCE》 *
陈晓春等: "伪狂犬病毒5基因缺失株体外重组获得缺失基因的研究", 《中国兽药杂志》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110305852A (en) * 2019-06-18 2019-10-08 扬州大学 Express the building of Porcine epidemic diarrhea virus S1 genetic recombination pseudorabies virus

Also Published As

Publication number Publication date
CN109337874B (en) 2020-05-12

Similar Documents

Publication Publication Date Title
CN104862286B (en) Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application
CN101633909B (en) Attenuated live vaccine strain for preventing pig-pig infection breeding and respiratory syndrome
TWI579297B (en) Combined vaccines for prevention of porcine virus infections
CN104513827A (en) Porcine epizootic diarrhea virus strain, attenuated vaccine strain thereof and application thereof
CN107815441A (en) A kind of II type Pseudorabies virus attenuated strain and its preparation method and application
CN104784686B (en) TGEV, PEDV bigeminal live vaccine and preparation method thereof
CN107899008B (en) Sick three subunit vaccines of a kind of pig epidemic diarrhea, transmissible gastroenteritis of swine, pig fourth type coronavirus
Tignon et al. Classical swine fever: comparison of oronasal immunisation with CP7E2alf marker and C-strain vaccines in domestic pigs
CN101724605B (en) Foot-and-mouth disease virus (FMDV) resistant monoclonal antibody and identified epitope and application thereof
CN106148287A (en) Porcine epidemic diarrhea virus strain and vaccine combination, preparation method and application
CN105031639A (en) Mink distemper-canine parvovirus enteritis bivalent vaccine and its preparation method and use
CN102221618B (en) Method for establishing hog cholera lapinized virus labeled vaccine strain and preparing vaccine
CN110527669A (en) A kind of porcine pseudorabies virus gene delection strain and its construction method and application
CN110029116A (en) The recombinant virus and preparation method of a kind of more epitope E 2 gene of Classical Swine Fever of secreting, expressing and application
CN105018433A (en) Porcine pseudorabies virus gene deletion strain, vaccine composition and preparation method and application thereof
CN109609468A (en) A kind of porcine pseudorabies virus of six gene delection, pseudorabies disease vaccine and preparation method
CN102727884B (en) Combined live vaccine against porcine reproductive and respiratory syndrome and pseudorabies, and preparation method thereof
CN106146626B (en) A kind of erysipelothrix ruhsiopathiae subunit vaccine and preparation method and application
CN102727883B (en) Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof
CN110201153A (en) A kind of rabbit hemorrhagic disease, pasteurellosis, Disease Caused By Bordetella Avium triple inactivated vaccine and preparation method thereof
CN109337874A (en) A kind of recombinant porcine pseudorabies are malicious and its apply and recombinant porcine pseudorabies live vaccine
CN107828741A (en) The dual-gene missing low virulent strain of pseudorabies virus and its application
CN109705223B (en) Recombinant subunit vaccine of orf virus and production method thereof
CN108251382A (en) A kind of porcine pseudorabies virus causes weak method and its causes weak Strain, vaccine composition and application
CN106190988A (en) Cat embedding cup virus CH JL5 strain inactivated vaccine

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: 610225 No.6, Muke Road, xihanggang Avenue, Southwest Airport Economic Development Zone, Shuangliu District, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan Province

Applicant after: Livestock Bioengineering Co., Ltd

Address before: 610000 Chengdu, Sichuan Shuangliu District, Southwest China Airport Economic Development Zone, West Hang Kong Road, animal husbandry Road No. 6

Applicant before: Sichuan Huashen Animal Biolog Products Co., Ltd.

GR01 Patent grant
GR01 Patent grant