CN105018433A

CN105018433A - Porcine pseudorabies virus gene deletion strain, vaccine composition and preparation method and application thereof

Info

Publication number: CN105018433A
Application number: CN201410157536.4A
Authority: CN
Inventors: 张许科; 孙进忠; 谭菲菲; 肖燕; 田克恭
Original assignee: Pulaike Biological Engineering Co Ltd
Current assignee: Pulaike Biological Engineering Co Ltd
Priority date: 2014-04-18
Filing date: 2014-04-18
Publication date: 2015-11-04
Anticipated expiration: 2034-04-18
Also published as: CN105018433B

Abstract

The invention provides a porcine pseudorabies virus weak strain which is a porcine pseudorabies virus variant strain which can not express RR (response regulator) proteins. The invention further provides a vaccine composition containing a porcine pseudorabies virus weak strain antigen and a preparation method and application thereof. Through a live vaccine immunogenicity test and a pathogenic immunogenicity test, the porcine pseudorabies live vaccine is proved to have great protective efficacy, have basically no clinical symptoms and show great immune protection.

Description

Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application

Technical field

The present invention relates to the vaccine composition of a kind of porcine pseudorabies virus gene-deleted strain and preparation thereof, and preparation method and application, belong to animal virology field.

Background technology

Pseudoabies, sick also known as AujeszkyShi, be the multiple domestic animal such as pig, ox, sheep caused by herpesvirus suis I type (Suid herpesvirus1strain) in herpetoviridae (Herpesviridae) α subfamily, the one of poultry and wildlife with heating, very to itch (except pig) and encephalomyelitis is the acute infectious disease of primary symptom.The pseudoabies of pig extensively exists in China, and harm is serious, is one of main epidemic disease of restriction large-scale pig farm production.It can cause pregnant sow miscarriage, stillborn foetus or mummy tire and piglet to occur nervous symptoms, paralysis, and mortality ratio is high.PRV has stronger pantropic, neurotropism and latent infection characteristic, can latent infection for a long time in peripheral nervous system, becomes infectious virus, will be fallen ill by the host of latent infection when latent virus is activated.

The pseudo-rabies attenuated vaccine control porcine pseudorabies that present technology generally uses gE to lack, use and adopt the strain of nature disappearance or artificial some virulent gene of disappearance to prevent porcine pseudorabies, to be Bucharest strain to go down to posterity for 800 times the attenuated vaccine strain obtained through chicken embryo and chick embryo fibroblast in such as BUK strain, and it has lacked most of gE gene.The artificial pseudo-rabies SA215 strain HB-98 strain lacked etc. are for preventing porcine pseudorabies in addition.

Nearest research reports that porcine pseudorabies there occurs new feature, outstanding behaviours is that the pig at any age all can infect, can in swinery horizontal transmission, latent period short (1 ~ 2 day), sickness rate is between 10% ~ 100%, morbidity pig mortality ratio (piglet mortality ratio can up to 100%) between 10% ~ 100%, the high heat (40 ~ 42 DEG C of pig can be caused after infection, continue more than 3 days), expiratory dyspnea, diarrhoea, breathe heavily, cough, sneeze, hindlimb paralysis, dog sits, suddenly fall down to the ground, twitch, can not lie on one's side, opisthotonus, swimming shape is struck, finally die of exhaustion, and herd boar semen quality can be caused to decline, farrowing sow miscarriage (up to 35%), premature labor, stillborn foetus, the breeding difficulty symptoms such as weak son (all dead before weak young 14 ages in days).Can not resist wild poison after the vaccine immunity pig of prior art completely to attack, still there will be high heat, spirit is depressed, and appetite declines or the symptom such as useless exhausted, and infection rate is more than 80%, and sickness rate is more than 30%, and mortality ratio is between 10% ~ 20%.Such as Peng Jinmei etc. the isolation identification of the new epidemic strain of porcine pseudorabies virus and antigenic diversity analysis. Chinese Preventive Veterinary Medicine report, 2013,35 (1): 1-4; Tong Wu etc. the separation andpreconcentration of Pseudorabies virus in immune sequela piglet. Chinese zoonosis journal, 2013,21 (3): 1-7; Yu et al., Pathogenic Pseudorabies Virus, China, 2012.Emerging infectiousDiseases.2014,20 (1): 102-104; An et al., Pseudorabies virus variant inBartha-K61-vaccinated pigs, China,, prior art also do not have vaccine can solve the pseudoabies that for pseudorabies variant cause Emerging infectious Diseases.2013.19 (11): 1749-1755).

Summary of the invention

For solving the deficiencies in the prior art, the invention provides a kind of attenuation porcine pseudorabies strain of work, for preventing and treating the swine rabies that variation Pseudorabies virus causes.Wherein, described porcine pseudorabies virus strain can not expressive function RR protein.

Main purpose of the present invention is to provide a kind of PRV (Pseudorabies virus) low virulent strain, and wherein, described PRV (Pseudorabies virus) low virulent strain is the porcine pseudorabies strain can not expressing RR albumen, and preferably, described pseudoabies strain is pseudo-rabies variant.

Term " any sudden change in PRV (Pseudorabies virus) RR gene can not be referred to by expressive function RR protein ＂, as insert, substitute or deletion mutantion and cause it virulence reduce compared with wild-type pseudorabies time.Usually, sudden change is the insertion of one or more Nucleotide, replacement or disappearance.Especially, because Nucleotide inserts the coded amino acid frameshit caused.As a result, by synthesis brachymemma or RR albumen that amino acid changes, it has the functional of reduction or even basic not functional.

Term " RR albumen " refers to the ribonucleotide reductase of PRV (Pseudorabies virus), and the RR gene of pseudo-rabies is made up of large subunit (RR1, UL39 encode) and small subunit (RR2, UL40 encode), forms bivalent complex.Ribonucleoside bisphosphate is reduced into deoxyribonucleoside diphosphate by it, is an indispensable enzyme of dezyribonucleoside de novo synthesis.

As one embodiment of the present invention, the invention provides a kind of Pseudorabies virus genetically engineered low virulent strain lacking RR gene.

Another object of the present invention is to a kind of PRV (Pseudorabies virus) low virulent strain, wherein, described PRV (Pseudorabies virus) low virulent strain is the PRV (Pseudorabies virus) variant can not expressing TK, gE, gI albumen.

As another embodiment of the invention, the invention provides a kind of Pseudorabies virus genetically engineered low virulent strain lacking gE, TK, gI gene.

Preferably, described pseudo-rabies variant to be gE protein sequence be SEQ ID NO.07 or with its sequence homology be more than 95% strain; More preferably, described pseudorabies variant is that separated described PRV (Pseudorabies virus) variant is when reappearing described PRV (Pseudorabies virus) variant and infecting, pig still to be caused in immunity prior art after genetically deficient pseudo-rabies attenuated vaccine to occur high heat, spirit is depressed, the strain of appetite decline or the incurable disease shape that gives up; Most preferably, described pseudorabies variant is for when reappearing described PRV (Pseudorabies virus) variant and infecting, and after lacking the pseudo-rabies attenuated vaccine of more than one and one gene in gE, TK and gI gene in immunity prior art, still infected pigs's pseudoabies possessing has the strain making the depressed and appetite decline of 9-10 age in days piglet spirit.

Term " pseudorabies variant " is also referred to as highly pathogenic pseudorabies strain, refer to: the pig showing as any age all can infect, can in swinery horizontal transmission, latent period short (1 ~ 2 day), sickness rate is between 10% ~ 100%, morbidity pig mortality ratio (piglet mortality ratio can up to 100%) between 10% ~ 100%, the high heat (40 ~ 42 DEG C of pig can be caused after infection, continue more than 3 days), expiratory dyspnea, diarrhoea, breathe heavily, cough, sneeze, hindlimb paralysis, dog sits, suddenly fall down to the ground, twitch, can not lie on one's side, opisthotonus, swimming shape is struck, finally die of exhaustion, and herd boar semen quality can be caused to decline, farrowing sow miscarriage (up to 35%), premature labor, stillborn foetus, the breeding difficulty symptoms such as weak son (all dead before weak young 14 ages in days).Preferably, described pseudo-rabies variant is that separated described PRV (Pseudorabies virus) variant is when reappearing described PRV (Pseudorabies virus) variant and infecting, pig still to be caused in immunity prior art after genetically deficient pseudo-rabies attenuated vaccine to occur high heat, spirit is depressed, appetite declines or the strain of the useless symptom such as exhausted, preferably described pseudo-rabies variant to be gE protein sequence be SEQ ID NO.07 or with its sequence homology be more than 95% the strain of protein sequence.More preferably, described pseudorabies variant is for when reappearing described PRV (Pseudorabies virus) variant and infecting, and after lacking the pseudo-rabies attenuated vaccine of more than one and one gene in gE, TK and gI gene in immunity prior art, still infected pigs's pseudoabies possessing has the strain making the depressed and appetite decline of 9-10 age in days piglet spirit.

Most preferably pseudo-rabies variant includes but not limited to that (preserving number is CCTCC NO.V201311 in PRV (Pseudorabies virus) HN1201 strain (Pseudorabies virus, strain HN1201); Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on May 20th, 2013), JS-2012 strain (Tong Wu, Zhang Qingzhan, Zheng Hao etc., the separation andpreconcentration [J] of Pseudorabies virus in immune sequela piglet. Chinese zoonosis journal 2013,21 (3): 1-7); Pseudorabies HeN1 strain is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center, and its culture presevation is numbered CGMCCNO.6656, is disclosed in patent application CN102994458A; NVDC-PRV-BJ strain, NVDCPRV-HEB strain and NVDC-PRV-SD strain (Xiuling Yu, Zhi Zhou, Dongmei Hu, et al.PathogenicPseudorabiesVirus, China, 2012EmergingInfectious Diseases, www.cdc.gov/eid ol.20, No.1, January2014.(preserving number is CCTCC NO.V201335 in PRV (Pseudorabies virus) HN1202 strain (Pseudorabies virus, strain HN1202); Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on August 26th, 2013).

Term of the present invention " homology " refers to the similarity degree of two aminoacid sequences or two nucleotide sequences in this application.The homology of aminoacid sequence or nucleotide sequence can be calculated by any appropriate means well known in the art, such as, target amino acid (or Nucleotide) sequence and reference amino acid (or Nucleotide) sequence can be carried out sequence alignment, vacancy can be introduced if desired, make amino acid (or Nucleotide) number identical between the sequence of two comparisons reach optimization, and calculate the per-cent of same amino acid (or Nucleotide) between two amino acid (or Nucleotide) sequences on this basis.The comparison of amino acid (or Nucleotide) sequence and the calculating of homology can pass through software simulating well known in the art, such as, but be not limited to, BLAST software (can obtain: http://blast.ncbi.nlm.nih.gov/Blast.cgi in the network address at US National Biotechnology Information center (NCBI), or see, such as, Altschul S.F.et al, J.Mol.Biol., 215:403-410 (1990); Stephen F.et al, Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 software (can obtain: http://www.eji.ac.uk/Toolsa/clustalw2/ in European Bioinformatics institute network address, separately see, such as, Higgins D.G.etal, Methods in Enzymology, 266:383-402 (1996); Larkin M.A.et al, Bioinformatics (Oxford, England), 23 (21): 2947-8 (2007)); (can obtain on the website of information biology institute of Sweden: http://tcoffee.vital-it.ch/cgi-bin/Tcoffee/tcoffee_cgi/index.cg i with TCoffee software etc., separately see, such as, Poirot O.et al, Nucleic Acids Res., 31 (13): 3503-6 (2003); Notredame C.etal, J.Mol.Boil., 302 (1): 205-17 (2000)).When using software to carry out sequence alignment, can use the default parameters that software provides, or also can adjust the parameter that software provides according to practical situation, these all in the knowledge of those skilled in the range.

NVDC-PRV-BJ strain, NVDCPRV-HEB strain and NVDC-PRV-SD strain are disclosed in Xiuling Yu, Zhi Zhou, Dongmei Hu, et al.Pathogenic PseudorabiesVirus, China, 2012EmergingInfectious Diseases, www.cdc.gov/eid ol.20, No.1, January2014.

PRV (Pseudorabies virus) HN1202 strain (Pseudorabies virus, strain HN1202) preserving number is CCTCC NO.V201335; Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on August 26th, 2013.

Preferably, in described PRV (Pseudorabies virus) low virulent strain genome, the ORF of whole RR albumen lacks.

Preferably, it is one or more that described PRV (Pseudorabies virus) low virulent strain lacks in TK, gE, gI gene further.

As a kind of preferred implementation of the present invention, the invention provides a kind of Pseudorabies virus genetically engineered low virulent strain lacking gE, TK, gI, RR gene.

Preferably, the Pseudorabies virus genetically engineered low virulent strain of described a kind of gE of disappearance, TK, gI and RR gene is disappearance gE, TK and gI of pseudorabies HN1201 strain and the genetically engineered low virulent strain of RR gene.

Preferably, the aminoacid sequence of the nucleotide sequence coded SEQ.NO.4 of TK gene location in described PRV (Pseudorabies virus) low virulent strain genome; In described PRV (Pseudorabies virus) low virulent strain genome, gE and gI gene location nucleotides sequence is classified as the nucleotide sequence of SEQ.NO.6.

As a kind of preferred implementation of the present invention, the invention provides a kind of PRV (Pseudorabies virus) low virulent strain, wherein, described PRV (Pseudorabies virus) low virulent strain comprise can not express RR, TK, gE, gI albumen HN1201 strain, HN1202 strain, JS-2012 strain, pseudorabies HeN1 strain, NVDC-PRV-BJ strain, NVDCPRV-HEB strain or NVDC-PRV-SD strain.

As a kind of preferred implementation of the present invention, described pseudo-rabies viurs attenuated strain strain for utilize engineered deletion RR gene for the pseudorabies HN1201 strain preserving number that PRV (Pseudorabies virus) HN1201 strain (Pseudorabies virus, strain HN1201) is wherein said be CCTCC NO.V201311; Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on May 20th, 2013.

As a kind of preferred implementation of the present invention, described pseudo-rabies viurs attenuated strain strain lacks gE, TK, gI pseudorabies HN1201 strain for utilizing genetic engineering means.

As a kind of preferred implementation of the present invention, described pseudo-rabies viurs attenuated strain strain lacks gE, TK, gI and RR gene pig pseudo-rabies HN1201 strain for utilizing genetic engineering means.

Term used herein " attenuation " refers to: the PRV (Pseudorabies virus) virulence compared with not modified parent plant through genetically deficient reduces.Show minimizing and and the shortening of holding time of fever of the dead head number of pig, fever head number.If one or more of virus strain determine that the parameter of disease severity reduces in the statistical significance of difference, then its " virulence is less ".

Another aspect of the present invention relates to a kind of vaccine composition, and wherein, described vaccine composition contains the described genetically deficient strain of immunity amount.

Another object of invention is to provide a kind of vaccine composition, and wherein, described vaccine composition comprises described PRV (Pseudorabies virus) low virulent strain antigen and the carrier of immunity amount.

As one embodiment of the present invention, described vaccine composition comprises attenuated live vaccine and the carrier of the porcine pseudorabies virus strain variant of the described disappearance RR gene of immunity amount.

As another embodiment of the invention, described vaccine composition comprises attenuated live vaccine and the carrier of the porcine pseudorabies virus strain variant of described disappearance gE, TK, gI gene of immunity amount.

As a kind of preferred implementation of the present invention, described vaccine composition comprises attenuated live vaccine and the carrier of the porcine pseudorabies virus strain variant of described disappearance gE, TK, gI and RR gene of immunity amount.

Preferably, described PRV (Pseudorabies virus) low virulent strain antigen is the PRV (Pseudorabies virus) low virulent strain of living; Described vaccine composition comprises lyophilized vaccine further.

As one embodiment of the present invention, described vaccine composition is the attenuated live vaccine of the porcine pseudorabies virus strain of disappearance RR gene.

As another embodiment of the invention, the invention provides a kind of attenuated live vaccine lacking gE, TK, gI gene.

As a kind of preferred implementation of the present invention, the invention provides a kind of attenuated live vaccine lacking the pseudo-rabies variant of gE, TK, gI and RR gene.

Optionally, one or more compounds with adjuvanticity can be added in vaccine.This adjuvant is not necessarily needed to realize effect according to the PRV (Pseudorabies virus) of the attenuation of work of the present invention, but the corresponding especially combination-vaccine comprised according to the PRV (Pseudorabies virus) of the attenuation of work of the present invention and the antigenicity substance from another Causative virus or microorganism (seeing below), adds adjuvant by being worth.Adjuvant is immune nonspecific stimulation agent.They strengthen host to the immunne response of vaccine. the example of adjuvant as known in the art be Fu Shi completely and Freund's incomplete adjuvant, vitamin-E, non-ionic block polymer, Muramyl dipeptide, ISCOMs (immune-stimulating complexes, see, for example European patent EP 109942), saponin(e, mineral oil, vegetables oil, and Carbopol.

Therefore, in the preferred form of this embodiment, the attenuated vaccine according to work of the present invention comprises adjuvant.

Other examples of pharmaceutically acceptable carrier used in the present invention or thinner comprise stablizer, as SPGA, carbohydrate (such as, sorbyl alcohol, N.F,USP MANNITOL, starch, sucrose, glucose, dextran), protein, as albumin or casein, material containing protein, as bovine serum or skimming milk and damping fluid (such as, phosphate buffered saline buffer).

Special in this stablizer is added vaccine, vaccine is very suitable for lyophilize.Therefore, in the preferred form of this embodiment, the attenuated vaccine lived is cryodesiccated form.

In addition, pseudorabies vaccine of the present invention can combinationally use to prepare with other inactivation pathogenic agent or antigen the combined vaccine or combination vaccine of resisting the various diseases comprising porcine pseudorabies.Term used herein " combined vaccine " is used in reference to the vaccine prepared from the virus mixture of porcine pseudorabies virus of the present invention and at least one different virus.Term " combination vaccine " refers to the vaccine prepared from virus and bacterium.Such as, PRV (Pseudorabies virus) of the present invention can mix with Pestivirus suis, porcine reproductive and respiratory syndrome virus, pig circular ring virus and/or haemophilus parasuis, mycoplasma or combine.

As one embodiment of the present invention, weak poison of the present invention can insert foreign gene, described exogene encodes is selected from one or more antigens in the multiple cause of disease of infected pigs, described pathogenic agent is by porcine reproductive respiratory syndrome (PRRS) virus, swine influenza virus, pig parvoviral, Transmissible gastroenteritis virus, rotavirus, pig circular ring virus 1 type or 2 types, intestinal bacteria, erysipelothrix rhusiopathiae (Erysipelothrix rhusi opathiae), bordetella bronchiseptica (Bordetella bronchiseptica), haemophilus parasuis (Haemophilus parasuis), mycoplasma hyopneumoniae (Mycoplasma hyopneumoniae) and swine streptococcus (Streptococcus suis) composition.

Preferably, described vaccine composition also comprises medium, adjuvant, vehicle.

Vaccine composition of the present invention also can comprise medium, adjuvant and/or vehicle.Physiological saline or distilled water can be used as medium.

Another object of the present invention is to provide a kind of method preparing described vaccine composition, and wherein, described method comprises: PRV (Pseudorabies virus) low virulent strain described in (1) amplification cultivation; And (2) add lyophilized vaccine in the PRV (Pseudorabies virus) low virulent strain of described amplification cultivation.

An also object of the present invention is to provide the application of described vaccine composition in the medicine preparing prevention and therapy porcine pseudorabies.

Preferably, described porcine pseudorabies is the porcine pseudorabies caused by PRV (Pseudorabies virus) variant.

The pig that term used herein " porcine pseudorabies virus relative disease " may be used for pointing out to show as any age all can infect, can in swinery horizontal transmission, latent period short (1 ~ 2 day), sickness rate is between 10% ~ 100%, morbidity pig mortality ratio (piglet mortality ratio can up to 100%) between 10% ~ 100%, the high heat (40 ~ 42 DEG C of pig can be caused after infection, continue more than 3 days), expiratory dyspnea, diarrhoea, breathe heavily, cough, sneeze, hindlimb paralysis, dog sits, suddenly fall down to the ground, twitch, can not lie on one's side, opisthotonus, swimming shape is struck, finally die of exhaustion, and herd boar semen quality can be caused to decline, farrowing sow miscarriage (up to 35%), premature labor, stillborn foetus, the breeding difficulty symptoms such as weak son (all dead before weak young 14 ages in days), but be not limited thereto.The symptom difference produced after having infected common porcine pseudorabies virus in above-mentioned symptom and prior art is: Adult Pig (body weight is more than 50kg pig) after infecting can be caused after having infected can to cause the high heat of pig (40 ~ 42 DEG C, continue more than 3 days), expiratory dyspnea, diarrhoea, breathes heavily, cough, sneeze, hindlimb paralysis, dog sits, suddenly fall down to the ground, twitch, can not lie on one's side, opisthotonus, swimming shape is struck, and finally dies of exhaustion; New life and the piglet sudden onset within 4 week age, large quantities of death occurs, and mortality ratio reaches more than 90%; Morbidity piglet main manifestations is that body temperature rise reaches more than 41 DEG C, and appetite is absolutely useless, with obvious nervous symptoms and diarrhoea; Pre-and Post-Weaning Piglets is mainly Respiratory symptoms, performance expiratory dyspnea, cough, rhinorrhea etc.

Term used herein " prevention " refers to by giving suppress pseudorabies to infect according to vaccine composition of the present invention or postpone all behaviors of seizure of disease.Term " treatment " refers to all behaviors making porcine pseudorabies virus infect the symptom caused to alleviate or take a turn for the better by giving vaccine composition according to the present invention.

Accompanying drawing explanation

Fig. 1 is the structure schematic diagram of pUCRRA-GFP-B plasmid;

Fig. 2 is RR genetically deficient position and RRA and RRB homology arm position schematic diagram on genome;

Fig. 3 is the PCR fragment electrophoresis comparison diagram confirming before and after porcine pseudorabies virus HN1201 strain RR genetically deficient by PCR method;

Fig. 4 is TK genetically deficient position and TKA and TKB homology arm position schematic diagram on genome;

Fig. 5 is the PCR fragment electrophoresis comparison diagram confirming before and after porcine pseudorabies virus HN1201 strain TK genetically deficient by PCR method;

Fig. 6 is gE/gI deletion sites and gEIA and gEIB homology arm position schematic diagram on genome;

Fig. 7 is the comparison diagram confirming before and after porcine pseudorabies virus HN1201 strain gE/gI genetically deficient by PCR method.

in sequence table:

Sequence 1 is porcine pseudorabies virus HN1201 strain strain RR gene nucleotide series;

Sequence 2 is porcine pseudorabies virus HN1201 strain strain TK gene nucleotide series;

Sequence 3 is this position nucleotide sequence after porcine pseudorabies virus HN1201 strain strain TK genetically deficient;

Sequence 4 is this position aminoacid sequence after porcine pseudorabies virus HN1201 strain strain TK genetically deficient;

Sequence 5 is porcine pseudorabies virus HN1201 strain strain gE/gI full genome nucleotide sequence;

Sequence 6 is this position nucleotide sequence after porcine pseudorabies virus HN1201 strain strain gE/gI full genome disappearance.

Sequence 7 is the gE aminoacid sequence of porcine pseudorabies virus HN1201 strain.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiments are only exemplary, do not form any restriction to scope of the present invention.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.

Term " head part " in the present invention refers to the amount of vaccine of every pig injection.

" TCID50 " (50%tissue culture infective dose) described in the present invention refers to half cell culture infective amount, is a kind of representation representing virus infectivity.

MEM liquid nutrient medium (liquid) the MEM dehydrated medium of purchased from American Life Technologies company is prepared according to its specification sheets.

DMEM substratum of the present invention is with reference to the preparation of GB/T18641-2002 appendix A compound method.

" PBS " described in the present invention refers to the english abbreviation of phosphate buffered saline buffer (Phosphate Buffer Saline), uses the PBS of the pH7.4 of 0.01mM in the present invention, prepares by described in " molecular cloning " third edition.

The present embodiment PRV (Pseudorabies virus) HN1201 strain (Pseudorabies virus, strainHN1201) preserving number used is CCTCC NO.V201311; Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on May 20th, 2013.

The present embodiment PRV (Pseudorabies virus) HN1202 strain (Pseudorabies virus, strainHN1202) preserving number used is CCTCC NO.V201335; Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on August 26th, 2013.

PRV is that the English of term PRV (Pseudorabies virus) Pseudorabies virus is write a Chinese character in simplified form.

The preparation of embodiment 1, PRV HN1201 strain RR deleted strain

The structure of the GFP intermediate transfer carrier needed for 1.1PRV HN1201RR lacks

According to the sequence SEQ ID NO.2 of the RR gene that will lack, at its two ends design homology arm, be respectively RRA and RRB.RRA and RRB is cloned on pUC19 carrier, called after pUCRRAB.Then by between GFP gene clone to RRA and RRB on pUCRRAB, recombinant virus transfer vector is obtained, name pUCRRA-GFP-B.In transfer vector, homology arm is RR both sides sequences, so the recombinant virus obtained after restructuring is RR genetically deficient.Recombinant transfer vector builds schematic diagram and sees Fig. 1, and Fig. 2 is RRA and RRB homology arm position on genome.

1.1.1, the amplification of homologous recombination arm and clone

1.1.1.1 design of primers and Template preparation

Two pairs of primers are designed, the homology arm for RR gene both sides of increasing according to the gene order of HN1201 virus:

The upstream and downstream primer of left side homology arm RRA is respectively:

RRAF:CCG gAATTCgCGACCTGGAGGAGGCGTGGCT(underscore is EcoR I restriction enzyme site)

RRAR:CTAG tCTAGAataacttcgtataatgtatgctatacgaagttatTGTCTGGGCGGGGCGGGACAA(underscore is Xba I restriction enzyme site, and lowercase is loxp site)

The upstream and downstream primer of right side homology arm RRB is respectively:

RRBF:ACAT gCATGCataacttcgtatagcatacattatacgaagttatGCGGCAAAACACTAATAAAGCG TTGA(underscore is SphI restriction enzyme site, and lowercase is loxp site)

RRBR:CCC aAGCTTgGAGAAGCACTACCAGGAGACGACC(underscore is Hind III digestion site)

Get PRV HN1201 and infect vero cell, after pathology occurs cell more than 80%, get part supernatant, adopt RRneaid Viral Nucleic Acid Extraction test kit to extract virus genom DNA, as the template of homology arm amplification.

1.1.1.2 the amplification of homology arm RRA, RRB and clone

Utilize the PrimeSTAR of TAKARA to carry out pcr amplification RRA, RRB, system and condition as follows:

PRV HN1201DNA	1μL
		primSTAR	0.5μL
2*primSTAR GC buffer	25μL
		dNTP(25mM)	4μL
Upstream primer	0.5μL
		Downstream primer	0.5μL
Water	Supply 50 μ L

After RRA with the RRB fragment that pcr amplification goes out is separated by agarose gel electrophoresis, reclaims test kit with sky root glue and reclaim object fragment.After RRA fragment and pUC19 carrier are used EcoRI and XbaI double digestion respectively, reclaim object fragment, after T4DNA ligase connects, transform DH5 α, coating ammonia benzyl plate 37 DEG C of overnight incubation.Picking mono-clonal enzyme identifies correct plasmid called after pUCRRA after cutting qualification correctly.PUCRRA and RRB is reclaimed object fragment with after SphI and HindIII double digestion respectively, after T4DNA ligase connects, transforms DH5 α, coating ammonia benzyl plate 37 DEG C of overnight incubation.Picking mono-clonal extracts plasmid, cuts and checks order identify correct plasmid called after pUCRRAB through enzyme.

1.1.2 the amplification of marker gene GFP

1.1.2.1GFP the removal of carrier pAcGFP-C1 multiple clone site

By pAcGFP-C1 plasmid (purchased from Clontech, article No. 632470) with after Bgl II and SmaI double digestion, reclaim linearizing carrier, fill through DNA Polymerase I Large (Klenow) Fragment, after T4DNA Ligase connects, transformed competence colibacillus cell DH5 α obtains the GFP plasmid deleting MCS, called after: pAcGFP Δ MCS.

1.1.2.2GFP the amplification of gene

Primer according to pAcGFP-C1 carrier sequence design amplification GFP:

Upstream primer

CMVU:ACGC gTCGACtAGTTATTAATAGTAATCAATTACG (underscore is SalI restriction enzyme site)

Downstream primer

SV40R:ACAT gCATGCcTAGAATGCAGTGAAAAAAATGC (underscore is Sph I restriction enzyme site)

With plasmid pAcGFP Δ MCS for template amplification GFP gene, system and condition as follows:

pAcGFPΔMCS	1μL
		primSTAR	0.5μL
2*primSTAR GC buffer	25μL
		dNTP(25mM)	4μL
Upstream primer CMVU	0.5μL
		Downstream primer SV40R	0.5μL
Water	Supply 50 μ L

Electrophoresis reclaims the connection that object band carries out next step.

1.1.3GFP the connection of marker gene and pUCRRAB

By GFP with after Sal I and Sph I double digestion, reclaim object fragment, be connected, transformed competence colibacillus cell DH5 α with the pUCRRAB plasmid through same double digestion, picking mono-clonal extracts plasmid, the plasmid called after pUCRRA-GFP-B that enzyme is cut and qualification of checking order is correct.The structure of pUCRRA-GFP-B plasmid is as Fig. 1.

1.2 acquisitions of recombinant virus containing GFP

1.2.1 transfer vector and HN1201DNA cotransfection Vero cell obtain recombinant virus

With liposome method cotransfection Vero cell, by 3ug PRV-HN1201 virus genom DNA and 5ug transfer vector pUCRRA-GFP-B, carry out transfection according to the step on Lipofectamine2000 (Invitrogen, article No. 11668030) specification sheets.Cultivate in 37 DEG C of incubators containing 5%CO2.36-48h after transfection, cytopathy to appear, and after lesion has fluorescence, harvested cell supernatant, is P0 for recombinant virus, called after rPRV-GFP-RR ^-.

1.2.2 the plaque purification of recombinant virus

By the P0 of acquisition for recombinant virus rPRV-GFP-RR ^-after vero cells infection, spread the low melting-point agarose of 2%, occur after obvious pathology and fluorescence until cell after 48h, picking with the plaque of green fluorescence after-70 DEG C of freeze thawing 3 times, 10 times of doubling dilutions are inoculated in Vero cell six orifice plate completed in advance, continue picking green fluorescence plaque and carry out purifying, through the plaque purification that 8 take turns, obtain purifying not containing the recombinant virus rPRV-GFP-RR that the RR of wild-type virus HN1201 lacks ^-.

1.3RR lacks the deletion of GFP marker gene in recombinant virus

PBS185 plasmid (buy the loxP site from addgene, Cre enzyme identification homology arm RRA downstream and RRB upstream, the sequence in the middle of two loxp sites deleted) and the recombinant virus rPRV-GFP-RR of Cre enzyme will be expressed ^-genomic dna cotransfection vero cell, after result transfection there is obvious pathology in 24h, and single fluorescence is many.The P0 of results carries out plaque screening for inoculating Vero cell after viral doubling dilution, and picking does not have the plaque of fluorescence to carry out next round purifying.Take turns screening purifying through 2, obtain the virus not having fluorescence, called after vPRV-RR ^-.

1.4PRV HN1201RR ^-strain missing gene is identified

RR gene two ends sequences Design for disappearance identifies the primer of RR genetically deficient for a pair, and sequence is as follows:

RRDCF：atgagcgtgcagatcggcaacg

RRDCR：accaggagacgaccgaggacaacg

The PCR primer size of wild-type virus amplification is the PCR fragment size that 6193bp, RR deleted virus increases is 2708bp, sees Fig. 3.

Extract the purified virus vPRV-RR not having fluorescence obtained in 1.3 ^-with the genomic dna of wild-type virus, PCR qualification shows RR genetically deficient, and GFP marker gene is also deleted.Illustrate not containing the RR deleted virus purifying success of GFP marker gene.By the virus strain called after PRV HN1201RR of disappearance RR gene ^-strain.

The preparation of embodiment 2, PRV HN1201 strain TK/gE/gI/ deleted strain

The preparation of 1.TK deleted strain

The structure of the GFP intermediate transfer carrier needed for 1.1PRV HN1201TK lacks

According to the sequence of the TK gene that will lack, at its two ends design homology arm, be respectively TKA and TKB.TKA and TKB is cloned on pUC19 carrier, called after pUCTKAB.Then by GFP gene clone on pUCTKAB, obtain recombinant virus transfer vector, name pUCTKA-GFP-B.In transfer vector, homology arm is TK both sides sequences, so the recombinant virus obtained after restructuring is the virus of TK genetically deficient.Fig. 4 is TK genetically deficient position and TKA and TKB homology arm position schematic diagram on genome.

1.1.1, the amplification of homologous recombination arm and clone

1.1.1.1 design of primers and Template preparation

Two pairs of primers are designed, the homology arm for TK gene both sides of increasing according to the gene order of HN1201 virus:

The upstream and downstream primer of left side homology arm TKA is respectively:

TKAF:CCG gAATTCgTAGTGCCGGTTGCCCACGTACA(underscore is EcoR I restriction enzyme site)

TKAR:CTAG tCTAGAataacttcgtatagcatacattatacgaagttatCGCTCAGGCTGCCGTTCTGC(underscore is Xba I restriction enzyme site, and lowercase is loxp site)

The upstream and downstream primer of right side homology arm TKB is respectively:

TKBF:ACAT gCATGCataacttcgtatagcatacattatacgaagttatAACGACGACGGCGTGGGAGG(underscore is Sph I restriction enzyme site, and lowercase is loxp site)

TKBR:CCC aAGCTTaGGGCGACGGCGAAGAAGAGC(underscore is Hind III digestion site)

Get PRV HN1201 and infect vero cell, after pathology occurs cell more than 80%, get part supernatant, adopt Geneaid Viral Nucleic Acid Extraction test kit to extract virus genom DNA, as the template of homology arm amplification.

1.1.1.2 the amplification of homology arm TKA, TKB and clone

Utilize the PrimeSTAR of TAKARA to carry out pcr amplification TKA, TKB, system and condition as follows:

After TKA with the TKB fragment that pcr amplification goes out is separated by agarose gel electrophoresis, reclaims test kit with sky root glue and reclaim object fragment.After TKA fragment and pUC19 carrier are used EcoRI and XbaI double digestion respectively, reclaim object fragment, after T4DNA ligase connects, transform DH5 α, coating ammonia benzyl plate 37 DEG C of overnight incubation.Picking mono-clonal enzyme identifies correct plasmid called after pUCTKA after cutting qualification correctly.PUCTKA and TKB is reclaimed object fragment with after SphI and HindIII double digestion respectively, after T4DNA ligase connects, transforms DH5 α, coating ammonia benzyl plate 37 DEG C of overnight incubation.Picking mono-clonal extracts plasmid, cuts and checks order identify correct plasmid called after pUCTKAB through enzyme.

1.1.2 the amplification of marker gene GFP

1.1.2.1GFP the removal of carrier pAcGFP-C1 multiple clone site

1.1.2.2GFP the amplification of gene

Primer according to pAcGFP-C1 carrier sequence design amplification GFP:

Upstream primer

Downstream primer

Electrophoresis reclaims the connection that object band carries out next step.

1.1.3GFP the connection of marker gene and pUCTKAB

By GFP with after Sal I and Sph I double digestion, reclaim object fragment, be connected, transformed competence colibacillus cell DH5 α with the pUCTKAB plasmid through same double digestion, picking mono-clonal extracts plasmid, the plasmid called after pUCTKA-GFP-B that enzyme is cut and qualification of checking order is correct.

1.2 TK containing GFP lack the acquisition of recombinant virus

1.2.1 transfer vector pUCTKA-GFP-B and HN1201DNA cotransfection Vero cell obtain recombinant virus

With liposome method cotransfection Vero cell, by 3 μ g PRV-HN1201 virus genom DNAs and 5 μ g transfer vector pUCTKA-GFP-B, transfection is carried out according to the step on Lipofectamine2000 (Invitrogen, article No. 11668030) specification sheets.Cultivate in 37 DEG C of incubators containing 5%CO2.36-48h after transfection, cytopathy to appear, and after lesion has fluorescence, harvested cell supernatant, is P0 for recombinant virus, called after rPRV-GFP-TK ^-.

1.2.2 recombinant virus rPRV-GFP-TK ^-plaque purification

By the P0 of acquisition for recombinant virus rPRV-GFP-TK ^-after vero cells infection, spread the low melting-point agarose of 2%, occur after obvious pathology and fluorescence until cell after 48h, picking with the plaque of green fluorescence after-70 DEG C of freeze thawing 3 times, 10 times of doubling dilutions are inoculated in Vero cell six orifice plate completed in advance, continue picking green fluorescence plaque and carry out purifying, through the plaque purification that 8 take turns, obtain purifying not containing the recombinant virus rPRV-GFP-TK that the TK of wild-type virus HN1201 lacks ^-.

1.3TK lacks the deletion of GFP marker gene in recombinant virus

PBS185 plasmid (buy the loxP site from addgene, Cre enzyme identification homology arm TKA downstream and TKB upstream, the sequence in the middle of two loxp sites deleted) and the recombinant virus rPRV-GFP-TK of Cre enzyme will be expressed ^-genomic dna cotransfection vero cell, after result transfection there is obvious pathology in 24h, and single fluorescence is many.The P0 of results carries out plaque select for inoculation after viral doubling dilution, and picking does not have the plaque of fluorescence to carry out next round purifying.Take turns screening purifying through 2, obtain the virus not having fluorescence, called after vPRV-TK ^-.Extraction purification virus genom DNA, PCR qualification shows TK genetically deficient, and GFP marker gene is also deleted.Illustrate not containing the TK deleted virus purifying success of GFP marker gene.By the virus strain called after PRV HN1201TK of disappearance TK gene ^-strain.

1.4PRV HN1201TK deleted strain gene identification

Extract TK deleted virus vPRV-TK ^-with the viral genome of wild-type virus, carry out PCR qualification, primer is as follows:

TKDCF：cctacggcaccggcaagagca

TKDCR：cgcccagcgtcacgttgaagac

The PCR primer size of wild-type virus amplification is the PCR fragment size that 1123bp, TK deleted virus increases is 742bp, sees Fig. 5.

The preparation of 2.TK/gE/gI deleted strain

2.1PRV HN1201 lacks the structure of the GFP intermediate transfer carrier needed for gI/gE

GI/gE gene is positioned at US7/US8 region adjacent on PRV genome, can design homology arm and gI/gE disappearance be fallen simultaneously.According to the sequence of the gE/gI gene that will lack, at its two ends design homology arm, be respectively gEIA and gEIB.GEIA and gEIB is cloned on pUC19 carrier, called after pUCgEIAB.Then by GFP gene clone on pUCgEIAB, obtain recombinant virus transfer vector, name pUCgEIA-GFP-B.In transfer vector, homology arm is gE/gI both sides sequences, thus with TK deleted virus HN1201TK ^-the recombinant virus obtained after restructuring is TK, gE, gI genetically deficient.Fig. 6 is gEIA and gEIB homology arm position on genome.

2.1.1 the amplification of homologous recombination arm and clone

2.1.1.1 design of primers and Template preparation

According to HN1201-TK ^-the gene order of virus designs two pairs of primers, the homology arm for gE/gI gene both sides of increasing:

The upstream and downstream primer of left side homology arm gEIA is respectively:

GEIAF:CCG gAATTCgGTCGTCGTGGGCATCGTCATC(underscore is EcoR I restriction enzyme site)

gEIAR:CTAG TCTAGAataacttcgtataatgtatgctatacgaagttat

TACGGACCGGGCTGCGCTTT(underscore is Xba I restriction enzyme site, and lowercase is Loxp site)

The upstream and downstream primer of right side homology arm gEIB is respectively:

GEIBF:ACAT gCATGCataacttcgtatagcatacattatacgaagttatCCCGCCCCGCTTAAATACCG(underscore is Sph I restriction enzyme site)

GEIBR:CCC aAGCTTcCAGGAGCACCTGGTCGCAGA(underscore is Hind III digestion site)

Get PRV HN1201-TK ^-virus infection vero cell, after pathology occurs cell more than 80%, gets part supernatant, adopts Geneaid Viral Nucleic Acid Extraction test kit to extract virus genom DNA, as the template of homology arm amplification.

2.1.1.2 the amplification of homology arm gEIA, gEIB and clone

Utilize the PrimeSTAR of TAKARA to carry out pcr amplification gEIA, gEIB, system and condition as follows:

PRV HN1201-TK ^-DNA	1μL
		primSTAR	0.5μL
2*primSTAR GC buffer	25μL
		dNTP(25mM)	4μL
Upstream primer	0.5μL
		Downstream primer	0.5μL
Water	Supply 50 μ L

After gEIA with the gEIB fragment that pcr amplification goes out is separated by agarose gel electrophoresis, reclaims test kit with sky root glue and reclaim object fragment.After gEIA fragment and pUC19 carrier are used EcoR I and XbaI double digestion respectively, reclaim object fragment, after T4DNA ligase connects, transform DH5 α, coating ammonia benzyl plate 37 DEG C of overnight incubation.Picking mono-clonal enzyme identifies correct plasmid called after pUCgEIA after cutting qualification correctly.PUCgEIA and gEIB is reclaimed object fragment with after SphI and HindIII double digestion respectively, after T4DNA ligase connects, transforms DH5 α, coating ammonia benzyl plate 37 DEG C of overnight incubation.Picking mono-clonal extracts plasmid, cuts and checks order identify correct plasmid called after pUCgEIAB through enzyme.

2.1.2 the amplification of marker gene GFP

2.1.2.1GFP the removal of carrier pAcGFP-C1 multiple clone site

2.1.2.2GFP the amplification of gene

Primer according to pAcGFP-C1 carrier sequence design amplification GFP:

Upstream primer

Downstream primer

Electrophoresis reclaims the connection that object band carries out next step.

2.1.3GFP the connection of marker gene and pUCgEIAB

After GFP SalI and SphI double digestion, reclaim object fragment, be connected, transformed competence colibacillus cell DH5 α with the pUCgEIAB plasmid through same double digestion, picking mono-clonal extracts plasmid, the plasmid called after pUCgEIA-GFP-B that enzyme is cut and qualification of checking order is correct.

2.2 acquisitions of recombinant virus containing GFP

2.2.1 transfer vector pUCgEIA-GFP-B and vPRV-TK ^-dNA cotransfection Vero cell obtains recombinant virus

With liposome method cotransfection Vero cell, by 3 μ g PRV-TK ^-virus genom DNA and 5 μ g transfer vector pUCgEIA-GFP-B, carry out transfection according to the step on Lipofectamine2000 (Invitrogen, article No. 11668030) specification sheets.Cultivate in 37 DEG C of incubators containing 5%CO2.36-48h after transfection, cytopathy to appear, and after lesion has fluorescence, harvested cell supernatant, is P0 for recombinant virus, called after rPRV-GFP-TK ^-gE ^-gI ^-.

2.2.2 recombinant virus rPRV-GFP-TK ^-gE ^-gI ^-plaque purification

By the P0 of acquisition for recombinant virus rPRV-GFP-TK ^-gE ^-gI ^-after vero cells infection, spread the low melting-point agarose of 2%, occur after obvious pathology and fluorescence until cell after 48h, picking with the plaque of green fluorescence after-70 DEG C of freeze thawing 3 times, 10 times of doubling dilutions are inoculated in Vero cell six orifice plate completed in advance, continue picking green fluorescence plaque and carry out purifying, through the plaque purification that 10 take turns, what obtain purifying does not contain PRV-TK ^-the recombinant virus rPRV-GFP-TK of virus ^-gE ^-gI ^-.

2.3TK/gE/gI lacks the deletion of GFP marker gene in recombinant virus

PBS185 plasmid (buy the loxP site from addgene, Cre enzyme identification homology arm gEIA downstream and gEIB upstream, the sequence in the middle of two loxp sites deleted) and the recombinant virus rPRV-GFP-TK of Cre enzyme will be expressed ^-gE ^-gI ^-genomic dna cotransfection vero cell, after result transfection there is obvious pathology in 24h, and single fluorescence is many.The P0 of results carries out plaque select for inoculation after viral doubling dilution, and picking does not have the plaque of fluorescence to carry out next round purifying.Take turns screening purifying through 2, obtain the virus not having fluorescence, called after vPRV-TK ^-gE ^-gI ^-.Extraction purification virus genom DNA, PCR qualification shows that TK, gE, gI gene all lacks, and GFP marker gene is also deleted.Illustrate not containing the TK/gE/gI deleted virus purifying success of GFP marker gene.By the virus strain called after PRV HN1201TK of disappearance TK/gE/gI gene ^-/ gE ^-/ gI ^-strain.

2.4PRV HN1201TK ^-/ gE ^-/ gI ^-strain missing gene is identified

Extract the viral genome of TK/gE/gI deleted virus and wild-type virus, carry out PCR qualification, TK lacks primers designed with 1.4 in embodiment 2; GE/gI genetically deficient primers designed is as follows:

gEICF:tgcgtctacatcttcttccgcctgag

gEICR:caagtccgagtccgtgcccaca

The PCR primer size of wild-type virus amplification is the PCR fragment size that 3531bp, TK/gE/gI deleted virus increases is 592bp, sees Fig. 7.

The preparation of embodiment 3PRV HN1201TK-/gE-/gI-/RR-deleted strain

3.1PRV HN1201 lacks the structure of the GFP intermediate transfer carrier needed for RR

PRV HN1201TK is prepared by embodiment 2 ^-/ gE ^-/ gI ^-strain.According to the sequence of the 4th the gene RR gene that will lack, at its two ends design homology arm, be respectively RRA and RRB.RRA and RRB is cloned on pUC19 carrier, called after pUCRRAB.Then by GFP gene clone on pUCRRAB, obtain recombinant virus transfer vector, name pUCRRA-GFP-B.In transfer vector, homology arm is RR both sides sequences, so the recombinant virus obtained after restructuring is RR genetically deficient.Recombinant transfer vector builds schematic diagram and sees Fig. 1, and Fig. 2 is RRA and RRB homology arm position on genome.

3.1.1 the amplification of homologous recombination arm and clone

3.1.1.1 design of primers and Template preparation

According to HN1201TK ^-/ gE ^-/ gI ^-the RR gene order of virus designs two pairs of primers, the homology arm for RR gene both sides of increasing:

RRBR:CCC aAGCTTgGAGAAGCACTACCAGGAGACGACC(underscore is Hind III digestion site)

Get PRV HN1201TK ^-/ gE ^-/ gI ^-infect vero cell, after pathology occurs cell more than 80%, get part supernatant, adopt Geneaid Viral Nucleic Acid Extraction test kit to extract virus genom DNA, as the template of homology arm amplification.

3.1.1.2 the amplification of homology arm RRA, RRB and clone

PRV HN1201TK ^-/gE ^-/gI ^-DNA	1μL
		primSTAR	0.5μL
2*primSTAR GC buffer	25μL
		dNTP(25mM)	4μL
Upstream primer	0.5μL
		Downstream primer	0.5μL
Water	Supply 50 μ L

3.1.2 the amplification of marker gene GFP

3.1.2.1GFP the removal of carrier pAcGFP-C1 multiple clone site

3.1.2.2GFP the amplification of gene

Primer according to pAcGFP-C1 carrier sequence design amplification GFP:

Upstream primer

Downstream primer

Electrophoresis reclaims the connection that object band carries out next step.

3.1.3GFP the connection of marker gene and pUCRRAB

By GFP with after Sal I and Sph I double digestion, reclaim object fragment, be connected, transformed competence colibacillus cell DH5 α with the pUCRRAB plasmid through same double digestion, picking mono-clonal extracts plasmid, the plasmid called after pUCRRA-GFP-B that enzyme is cut and qualification of checking order is correct.

3.2 acquisitions of recombinant virus containing GFP

3.2.1 transfer vector pUCRRA-GFP-B and vPRV-TK ^-gE ^-gI ^-dNA cotransfection Vero cell obtains recombinant virus

With liposome method cotransfection Vero cell, by 3 μ g PRV-TK ^-gE ^-gI ^-virus genom DNA and 5 μ g transfer vector pUCRRA-GFP-B, carry out transfection according to the step on Lipofectamine2000 (Invitrogen, article No. 11668030) specification sheets.Cultivate in 37 DEG C of incubators containing 5%CO2.36-48h after transfection, cytopathy to appear, and after lesion has fluorescence, harvested cell supernatant, is P0 for recombinant virus, called after rPRV-GFP-TK ^-gE ^-gI ^-rR ^-.

3.2.2 recombinant virus rPRV-GFP-TK ^-gE ^-gI ^-rR ^-plaque purification

By the P0 of acquisition for recombinant virus rPRV-GFP-TK ^-gE ^-gI ^-rR ^-after vero cells infection, spread the low melting-point agarose of 2%, occur after obvious pathology and fluorescence until cell after 48h, picking with the plaque of green fluorescence after-70 DEG C of freeze thawing 3 times, 10 times of doubling dilutions are inoculated in Vero cell six orifice plate completed in advance, continue picking green fluorescence plaque and carry out purifying, through the plaque purification that 11 take turns, what obtain purifying does not contain PRV-TK ^-gE ^-gI ^-the recombinant virus rPRV-GFP-TK of four genetically deficients of virus ^-gE ^-gI ^-rR ^-.

3.3TK/gE/gI/RR lacks the deletion of GFP marker gene in recombinant virus

PBS185 plasmid (buy the loxP site from addgene, Cre enzyme identification homology arm RRA downstream and RRB upstream, the sequence in the middle of two loxp sites deleted) and the recombinant virus rPRV-GFP-TK of Cre enzyme will be expressed ^-gE ^-gI ^-rR ^-genomic dna cotransfection vero cell, after result transfection there is obvious pathology in 24h, and single fluorescence is many.The P0 of results carries out plaque select for inoculation after viral doubling dilution, and picking does not have the plaque of fluorescence to carry out next round purifying.Take turns screening purifying through 2, obtain the virus not having fluorescence, called after PRV-TK ^-gE ^-gI ^-rR ^-.Extraction purification virus genom DNA, PCR qualification shows RR genetically deficient, and GFP marker gene is also deleted.Illustrate not containing the TK/gE/gI/RR deleted virus purifying success of GFP marker gene.By the virus strain called after PRV HN1201TK of disappearance TK/gE/gI/RR gene ^-/ gE ^-/ gI ^-/ RR ^-strain.

3.4PRV HN1201TK/gE/gI/RR strain missing gene is identified

RR genetically deficient primers designed is with 1.4 in embodiment 1.The primers designed of TK gene, gE/gI genetically deficient is respectively with 1.4 in embodiment 2 and 2.4.

The pathogenicity of embodiment 4, Pseudorabies virus gene-deleted strain

The negative piglet 25 of pseudorabies antigen-antibody of 9 ages in days is divided into 5 groups (A, B, C, D and blank groups) at random, often organizes 5, divides into groups and attack malicious situation in table 1.

Table 1, the grouping of pathogenicity animal

After virus inoculation, measure piglet body temperature every day, observe clinical symptom and death condition, concrete outcome is in table 2.

Pathogenic to 9 age in days piglets of table 2 different pseudorabies gene-deleted strain

Result shows, and porcine pseudorabies virus HN1201 strain can cause 9 age in days piglet 100% death (5/5) and lack the PRV HN1201RR of RR gene ^-the PRVHN1201TK of strain and disappearance TK/gE/gI ^-/ gE ^-/ gI ^-/ strain, can cause the toxicity of virus to reduce, but still have residual virulence, can cause the clinical symptom such as heating, and lack the PRV HN1201 strain TK of TK/gE/gI/RR gene ^-/ gE ^-/ gI ^-/ RR ^-there is no toxicity completely.

The preparation of embodiment 5, porcine pseudorabies virus gene deleted live vaccine

5.1, the propagation of vaccine virus

RV HN1201RR prepared by embodiment 1 ^-pRV HN1201TK prepared by strain, embodiment 2 ^-/ gE ^-/ gI ^-pRV HN1201TK prepared by strain and embodiment 3 ^-/ gE ^-/ gI ^-/ RR ^-the seed culture of viruses 5 × 10 of strain ⁴doubly after dilution, inoculation has grown up to the ST cell of individual layer, and after absorption 1h, add the DMEM nutrient solution of 1000ml containing 2% foetal calf serum, put spinner culture in 37 DEG C of greenhouses, rotating speed is 6 turns/hour.After 80% cytopathy, multigelation 2 times, results virus, measures virus titer.Virus liquid puts cryopreservation.

5.2, in the every 100ml deionized water of protectant preparation with sucrose 40g, gelatin 8g, after fully melting, puts autoclaving (121 DEG C of 30min).

5.3, the proportioning of vaccine virus suspension

To prepare in 5.1 and the virus liquid preserved mixes by 1:1 (volume ratio) with the protective material protective material prepared in 5.2, point be filled in the blue or green bottle of sterilizing, every bottled amount 2.6ml.Freeze-drying.Inspection vaccine pollutes without bacterium and exogenous virus, basically identical with freeze-drying provirus content.RV HN1201RR prepared by embodiment 1 ^-strain lot number is 20140101, PRV HN1201TK prepared by embodiment 2 ^-/ gE ^-/ gI ^-strain lot number is 20140202, PRV HN1201TK prepared by embodiment 3 ^-/ gE ^-/ gI ^-/ RR ^-strain lot number is 20140303.

The immunogenicity experiments of embodiment 6, porcine pseudorabies virus gene deleted live vaccine

Negative for the PRV antigen-antibody of 9 ages in days piglet 25 is divided into 5 groups at random, 5/group, the vaccine of embodiment 5 preparation is inoculated according to table 3, control vaccine adopts pseudorabies living vaccine (the Bartha K-61 strain) lot number in the biological large pharmaceutical factory of Spain Hai Bolai to be 42RH, consumption uses to specifications, control group inoculation DMEM substratum 1ml/ head.Immunity attacks poison after latter 28 days, and attacking toxic agent amount is HN1201 strain porcine pseudorabies virus 1 × 10 ^7.0tCID ₅₀/ head, after attacking poison, every day measures piglet body temperature, observes clinical symptom and death condition (the results are shown in Table 3), takes a blood sample respectively before attacking poison to test group and control group piglet.

Table 3 Study On Immunogenicity animal divides into groups

Group	Vaccinate	Immunizing dose
			I group	20140101 batches	Intramuscular injection inoculation 1ml10 ^6.0TCID ₅₀/ head
II group	20140202 batches	Intramuscular injection inoculation 1ml10 ^6.0TCID ₅₀/ head
			III group	20140303 batches	Intramuscular injection inoculation 1ml10 ^6.0TCID ₅₀/ head
Control vaccine group	Porcine pseudorabies virus living vaccine	Intramuscular injection inoculation 2ml10 ^6.0TCID ₅₀/ head
			Blank group	DMEM substratum	Intramuscular injection inoculation 1ml/ head

After vaccine immunity, the method weekly with reference to serum neutralization test in GB/T18641-2002 method measures NAT, the results are shown in Table 4.

The antibody situation of different time after table 4 pseudorabies gene deleted live vaccine immunity piglet

The result display of table 4, after pseudorabies gene deleted live vaccine immunity piglet, can produce higher neutralizing antibody, and raise gradually with immunization time.

Immunity attacks poison after latter 28 days, and attacking toxic agent amount is PRV (Pseudorabies virus) HN1201 strain 1 × 10 ^7.0tCID ₅₀/ head, 1ml/ head, observation clinical symptom and death condition are in table 5, and after attacking poison, every day measures piglet body temperature and observes clinical symptom.

Table 5 pseudorabies living vaccine immunity piglet after attack malicious situation and clinical setting

The result display of table 4 and table 5, after pseudorabies gene-deleted vaccine immunity piglet, can infect (occurring clinical symptom) by blocking virus; 100%(5/5 can be provided for piglet) protection; and contrasting piglet, to attack latter 5 days of poison all dead afterwards, therefore, pseudorabies living vaccine has good protection.And III group effect is relative to control group living vaccine, and I group and II group do not have clinical symptom completely, demonstrate good immunoprotection and security.

The structure of the gene-deleted strain of embodiment 7NVDC-PRV-BJ strain, NVDCPRV-HEB strain and NVDC-PRV-SD, HN1202 strain Pseudorabies virus variant

Respectively with NVDC-PRV-BJ strain, NVDCPRV-HEB strain and NVDC-PRV-SD strain (Xiuling Yu, Zhi Zhou, Dongmei Hu, et al.Pathogenic PseudorabiesVirus, China, 2012EmergingInfectious Diseases, www.cdc.gov/eid ol.20, No.1, January2014) (applicant promises to undertake and specifies according to Guidelines for Patent Examination, 20 years are provided to the public from the patent applying date), HN1202 strain (Tibetan number is CCTCC NO.V201335); Be preserved in China typical culture collection center; Preservation address is Wuhan, China Wuhan University, and preservation date is on August 26th, 2013) be parent's strain, with reference to method disappearance TK/gE/gI and the RR gene of embodiment 2,3, the low virulent strain title of preparation is respectively NVDC-PRV-BJ TK ^-/ gE ^-/ gI ^-/ RR ^-strain, NVDCPRV-HEB TK ^-/ gE ^-/ gI ^-/ RR ^-strain, NVDC-PRV-SD TK ^-/ gE ^-/ gI ^-/ RR ^-strain, and PRVHN1202TK ^-/ gE ^-/ gI ^-/ RR ^-strain, proves genetically deficient through PCR with the contrast of parent's strain.

The preparation of embodiment 8NVDC-PRV-BJ strain, NVDCPRV-HEB strain and NVDC-PRV-SD, HN1202 strain Pseudorabies virus variant low virulent strain vaccine composition

According to each attenuated vaccine strain prepared by embodiment 5.1 method propagation embodiment 7; (with sucrose 40g in every 100ml deionized water, gelatin 8g, after fully melting to add protective material according to volume ratio 1:1 ratio; put autoclaving (121 DEG C of 30min) freeze-drying afterwards, NVDC-PRV-BJTK ^-/ gE ^-/ gI ^-/ RR ^-strain lot number is Q01, NVDCPRV-HEB TK ^-/ gE ^-/ gI ^-/ RR ^-strain lot number is Q02, NVDC-PRV-SDTK ^-/ gE ^-/ gI ^-/ RR ^-strain lot number is Q03, PRVHN1202TK ^-/ gE ^-/ gI ^-/ RR ^-strain lot number is Q04.

Embodiment 9, embodiment 7 prepare the pathogenicity of strain

Carry out toxicity test according to the method for embodiment 6, experiment pig is divided into 5 groups, often organizes 5, the NVDC-PRV-BJ TK of collunarium inoculation embodiment 7 preparation respectively ^-/ gE ^-/ gI ^-/ RR ^-strain, NVDCPRV-HEB TK ^-/ gE ^-/ gI ^-/ RR ^-strain, NVDC-PRV-SDTK ^-/ gE ^-/ gI ^-/ RR ^-strain, and PRVHN1202TK ^-/ gE ^-/ gI ^-/ RR ^-the carrying out of strain tests each group of equal collunarium inoculation 1ml(10 ^7.0tCID ₅₀/ ml), result shows each group of pig and all survives, and body temperature is normal, without clinical symptom.Prove the toxicity being reduced variation pseudo-rabies strain by disappearance TK/gE/gI/RR gene.

Embodiment 10, embodiment 8 prepare the Study On Immunogenicity of vaccine

According to the test method of embodiment 6 and inoculum size, Study On Immunogenicity is carried out to vaccine prepared by embodiment 8, Chengdu medical instruments factory of Simultaneous vaccination control vaccine pseudorabies living vaccine HB-98 strain lot number 1308011-1(Zhongmu Industry Co., Ltd), immunity attacks poison after latter 28 days, and attacking toxic agent amount is porcine pseudorabies virus HN1201 strain 1 × 10 ^7.0tCID ₅₀/ head, observes clinical symptom and death condition, and after attacking poison, every day measures piglet body temperature and observes clinical symptom, the results are shown in Table 6.

Table 6 pseudorabies living vaccine immunity piglet after attack malicious situation and clinical setting

The result display of table 6; after pseudorabies vaccine immunity piglet; (occurring clinical symptom) can be infected by blocking virus; 100%(5/5 can be provided for piglet) protection; vaccine control group only can provide 80%(4/5) protection; and contrasting piglet, to attack latter 3 days of poison all dead afterwards, therefore, pseudorabies living vaccine has good protection.In addition relative to the living vaccine of prior art, substantially there is no clinical symptom, demonstrate good immunoprotection

The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Claims

1. a PRV (Pseudorabies virus) low virulent strain, wherein, described PRV (Pseudorabies virus) low virulent strain is the porcine pseudorabies strain can not expressing RR albumen, and preferably, described pseudoabies strain is pseudo-rabies variant.

2. a PRV (Pseudorabies virus) low virulent strain, wherein, described PRV (Pseudorabies virus) low virulent strain is the PRV (Pseudorabies virus) variant can not expressing TK, gE, gI albumen.

3. the PRV (Pseudorabies virus) low virulent strain according to any one of claim 1 ~ 2, wherein, described pseudo-rabies variant to be gE protein sequence be SEQ ID NO.07 or with its sequence homology be more than 95% strain; Preferably, described pseudorabies variant is that separated described PRV (Pseudorabies virus) variant is when reappearing described PRV (Pseudorabies virus) variant and infecting, pig still to be caused in immunity prior art after genetically deficient pseudo-rabies attenuated vaccine to occur high heat, spirit is depressed, the strain of appetite decline or the incurable disease shape that gives up; More preferably, described pseudorabies variant is for when reappearing described PRV (Pseudorabies virus) variant and infecting, and after lacking the pseudo-rabies attenuated vaccine of more than one and one gene in gE, TK and gI gene in immunity prior art, still infected pigs's pseudoabies possessing has the strain making the depressed and appetite decline of 9-10 age in days piglet spirit.

4. the PRV (Pseudorabies virus) low virulent strain according to any one of claims 1 to 3, wherein, the ORF disappearance of whole RR albumen in described PRV (Pseudorabies virus) low virulent strain genome.

5. PRV (Pseudorabies virus) low virulent strain according to claim 3, wherein, it is one or more that described PRV (Pseudorabies virus) low virulent strain lacks in TK, gE, gI gene further.

6. PRV (Pseudorabies virus) low virulent strain according to claim 5, wherein, the aminoacid sequence of the nucleotide sequence coded SEQ.NO.4 of TK gene location in described PRV (Pseudorabies virus) low virulent strain genome; In described PRV (Pseudorabies virus) low virulent strain genome, gE and gI gene location nucleotides sequence is classified as the nucleotide sequence of SEQ.NO.6.

7. a PRV (Pseudorabies virus) low virulent strain, wherein, described PRV (Pseudorabies virus) low virulent strain comprise can not express RR, TK, gE, gI albumen HN1201 strain, HN1202 strain, JS-2012 strain, pseudorabies HeN1 strain, NVDC-PRV-BJ strain, NVDCPRV-HEB strain or NVDC-PRV-SD strain.

8. a vaccine composition, wherein, described vaccine composition comprises the PRV (Pseudorabies virus) low virulent strain antigen described in any one of claim 1 ~ 7 and the carrier of immunity amount; Preferably, described vaccine composition comprises PRV (Pseudorabies virus) low virulent strain antigen according to claim 3 and the carrier of immunity amount; More preferably, described vaccine composition comprises PRV (Pseudorabies virus) low virulent strain antigen according to claim 5 and the carrier of immunity amount; Further preferably, described vaccine composition comprises PRV (Pseudorabies virus) low virulent strain antigen according to claim 6 and the carrier of immunity amount; Most preferably, PRV (Pseudorabies virus) low virulent strain antigen according to claim 7 and carrier that vaccine composition comprises immunity amount is stated.

9. vaccine composition according to claim 8, wherein, described PRV (Pseudorabies virus) low virulent strain antigen is the PRV (Pseudorabies virus) low virulent strain of living; Described vaccine composition comprises lyophilized vaccine further.

10. prepare a method for the vaccine composition described in any one of claim 8 ~ 9, wherein, described method comprises:

(1) PRV (Pseudorabies virus) low virulent strain described in any one of amplification cultivation claim 1 ~ 7; And

(2) in the PRV (Pseudorabies virus) low virulent strain of described amplification cultivation, lyophilized vaccine is added.

The application of vaccine composition in the medicine preparing prevention and therapy porcine pseudorabies described in 11. any one of claim 8 ~ 9.

12. application according to claim 11, wherein, described porcine pseudorabies is the porcine pseudorabies caused by porcine pseudorabies strain variant according to claim 3.