CN110343670B

CN110343670B - Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof

Info

Publication number: CN110343670B
Application number: CN201810301212.1A
Authority: CN
Inventors: 田克恭; 肖燕; 张超林; 孙进忠; 张许科
Original assignee: Pulaike Biological Engineering Co Ltd
Current assignee: Pulaike Biological Engineering Co Ltd
Priority date: 2018-04-04
Filing date: 2018-04-04
Publication date: 2022-08-30
Anticipated expiration: 2038-04-04
Also published as: CN110343670A

Abstract

The invention provides a recombinant porcine pseudorabies virus low virulent strain, which has the immunogenicity of porcine pseudorabies virus antigens and the immunogenicity of porcine circovirus antigens simultaneously. The vaccine composition prepared from the recombinant porcine pseudorabies virus attenuated strain can not only provide complete protection for the porcine pseudorabies virus and the porcine circovirus simultaneously; can also completely protect the porcine circovirus from different regional sources, and the protection effect is superior to that of the corresponding subunit vaccine.

Description

Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof

Technical Field

The invention relates to a recombinant porcine pseudorabies virus low virulent strain for expressing a porcine circovirus Cap protein gene, a preparation method and a vaccine composition prepared by using the recombinant virus strain, belonging to the field of biological products for animals.

Background

Porcine Circovirus (PCV) belongs to the genus circovirus of the family circoviridae, and is the smallest vertebrate virus found to date. PCV is divided into three genotypes, namely PCV1, PCV2 and PCV3 according to pathogenicity, antigenicity and difference of nucleotide sequences. Wherein PCV1 is widely present in but not pathogenic to swinery, and the genome length is 1759 bp. PCV2 has pathogenicity, and the genome length is 1767bp or 1768 bp. PCV3 is a porcine circovirus that has been recently isolated and confirmed to be pathogenic in porcine reproductive failure cases, and has a genome length of 2.0 kb.

Porcine Pseudorabies virus (PRV) mainly causes severe neurological symptoms, respiratory diseases and reproductive disorders in pigs. The pseudorabies of the pigs widely exists in China, is seriously harmful and is one of main epidemic diseases which restrict the large-scale pig farm production. The recently epidemic porcine pseudorabies has a new characteristic, and is characterized in that pigs of any age can be infected, the infection can be spread horizontally in a swinery, the incubation period is short (1-2 days), the morbidity can reach 100 percent at most, the mortality of the sick pigs can reach 100 percent at most, and the infection can cause high fever of the pigs (40-42 ℃ and lasts for more than 3 days). The prior vaccine can not completely resist wild virus attack after immunizing pigs, still has symptoms of high fever, mental depression, appetite reduction or abominability and the like, the infection rate is over 80 percent, the morbidity rate is over 30 percent, and the mortality rate is between 10 and 20 percent.

Clinically, PCV2, PCV3 and PRV often present a mixed infection situation, thereby causing the epidemic to become more severe. At present, no vaccine capable of simultaneously controlling PCV2, PCV3 and PRV infection exists at home and abroad, and no vaccine capable of simultaneously controlling recently epidemic PCV2, PCV3 and new PRV infection exists at home and abroad, so that a vaccine capable of solving the outbreaks of the epidemic diseases by one injection is urgently needed to deal with new clinical situations.

Disclosure of Invention

In order to solve the problems, the porcine circovirus Cap protein gene is recombined into the porcine pseudorabies virus attenuated strain to construct the recombined porcine pseudorabies virus strain expressing the porcine circovirus Cap protein gene.

The invention provides a recombinant porcine pseudorabies virus low virulent strain, wherein a genome of the recombinant porcine pseudorabies virus low virulent strain is recombined with porcine circovirus Cap protein and can express the porcine circovirus Cap protein, and the porcine circovirus Cap protein gene is porcine circovirus type 2 and/or type 3Cap protein gene.

The recombinant porcine pseudorabies virus attenuated strain can express the porcine circovirus Cap protein, so that the recombinant porcine pseudorabies virus attenuated strain not only has the immunogenicity of the porcine pseudorabies virus antigen, but also has the immunogenicity of the porcine circovirus antigen.

As an embodiment of the invention, the porcine pseudorabies virus low-virulent strain from the recombinant porcine pseudorabies virus low-virulent strain is a low-virulent strain of a porcine pseudorabies virus variant strain.

As a preferred embodiment of the invention, the low virulent strain of the porcine pseudorabies virus is a low virulent strain of HN1201 strain or HN1202 strain.

As a more preferred embodiment of the present invention, the porcine pseudorabies virus attenuated strain is HN1201-R strain.

As an embodiment of the invention, in the recombinant porcine pseudorabies virus attenuated strain, the porcine circovirus type 2Cap protein gene is a porcine circovirus type 2new gene subtype Cap protein gene.

In a preferred embodiment of the present invention, in the recombinant porcine pseudorabies virus attenuated strain of the present invention, the protein gene of the porcine circovirus type 2new gene subtype Cap is represented by SEQ id No.1 or a degenerate sequence thereof, and the protein gene of the porcine circovirus type 3Cap is represented by SEQ id No.2 or a degenerate sequence thereof.

The invention also relates to a vaccine composition, wherein the vaccine composition comprises an immunizing amount of the recombinant porcine pseudorabies virus low-virulent strain and a freeze-drying protective agent.

The vaccine composition can provide complete protection against the porcine pseudorabies virus and the porcine circovirus, can provide complete protection against the porcine pseudorabies virus and the porcine circovirus only by immunization once, and can effectively protect the porcine circovirus 2a, 2b and 2d gene subtypes.

The vaccine composition can provide complete protection for porcine circovirus from various geographical sources, and the protection effect of the vaccine composition is better than that of a corresponding porcine circovirus subunit vaccine (virus-like particle vaccine): the vaccine composition of the invention not only provides complete protection for the porcine circovirus on the 21 st day after immunization, but also provides complete protection for the corresponding porcine circovirus subunit vaccine (virus-like particle vaccine) on the 28 th day after immunization, and can inhibit the disease condition earlier than the porcine circovirus subunit vaccine; the protective effect on the porcine pseudorabies virus is equivalent to that of the corresponding porcine pseudorabies virus attenuated vaccine.

As an embodiment of the invention, in the vaccine composition of the invention, the content of the low virulent strain of the recombinant porcine pseudorabies virus is more than or equal to 10 ^6.0 TCID ₅₀ /ml。

As a preferred embodiment of the invention, in the vaccine composition of the invention, the content of the attenuated strain of the recombinant porcine pseudorabies virus is 10 ^6.0 TCID ₅₀ /ml。

As an embodiment of the present invention, the vaccine composition of the present invention further comprises the following antigens: classical swine fever virus antigen, porcine reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, mycoplasma hyopneumoniae antigen, porcine parvovirus antigen, and/or porcine encephalitis b virus antigen.

The recombinant porcine pseudorabies virus low virulent strain can also form a vaccine composition together with other one or more antigens. For example, the live vaccines of the present invention can be used in combination with other inactivated pathogens or antigens to prepare combination or composite vaccines against a variety of diseases including infection with porcine pseudorabies virus and porcine circovirus.

Other viral or pathogen antigens in the vaccine composition of the invention may be live pathogen antigens, or inactivated pathogen antigens or subunit antigens; when other antigen components are inactivated pathogen antigens or subunit antigens, the antigen components of the attenuated strain of the recombinant porcine pseudorabies virus and other inactivated pathogen antigens or subunit antigens can be separately preserved, stored or transported.

As a preferred embodiment of the present invention, the vaccine composition of the present invention further comprises the following antigens: classical swine fever virus antigens, porcine reproductive and respiratory syndrome virus antigens, haemophilus parasuis antigens, and/or mycoplasma hyopneumoniae antigens.

As a preferred embodiment of the present invention, the vaccine composition of the present invention further comprises an adjuvant comprising (1) an alumina gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) a copolymer of a polymer of acrylic acid or methacrylic acid, maleic anhydride and an alkenyl derivative; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide and Gel adjuvant.

The vaccine composition of the present invention further comprises an adjuvant component capable of promoting the immunogenic efficacy of inactivated antigens and subunit antigens.

The invention also relates to application of the vaccine composition in preparing a medicament for preventing porcine circovirus and porcine pseudorabies virus infection.

The invention adopts the porcine pseudorabies variant strain as a carrier for the first time, expresses the current new porcine circovirus type 3Cap protein gene and/or the new gene subtype porcine circovirus type 2Cap protein gene, and prepares the recombinant virus live vaccine, thereby not only protecting the pseudorabies variant strain, but also protecting the porcine circovirus type 3, the porcine circovirus type 2 with different gene subtypes and the mixed infection of the porcine circovirus type 3 and the porcine circovirus type 2. The live vaccine can provide effective protection against different PCV2 gene subtypes and PCV3, expands the application range of the vaccine, and can prevent separate infection and mixed infection of PCV2 different gene subtypes and PCV 3.

Detailed Description

Hereinafter, embodiments of the present invention will be described.

Porcine pseudorabies variant strain

The porcine pseudorabies variant strain is also called a highly pathogenic porcine pseudorabies strain and refers to: the pig is infected at any age, can be horizontally spread in a swinery, has short incubation period (1-2 days), has the highest morbidity of 100 percent and the highest mortality of the sick pig of 100 percent, and can cause the high fever of the pig after infection (40-42 ℃ and lasts for more than 3 days).

Preferably, the pseudorabies variant strain is the separated porcine pseudorabies virus variant strain, and when the infection of the porcine pseudorabies virus variant strain is reproduced, the porcine pseudorabies virus variant strain still causes high fever, depression, anorexia or abolish symptoms after immunization of a pseudorabies attenuated vaccine with gene deletion in the prior art.

Preferably, the pseudorabies variant strain is a strain which enables a 9-10-day-old piglet to be depressed in spirit and reduced in appetite after a pseudorabies attenuated vaccine which is deleted in one or more genes of gE, TK and gI in the prior art is immunized when the infection of the porcine pseudorabies variant strain is reproduced.

More preferably, the pseudorabies variant strains are porcine pseudorabies virus JS-2012 strains, porcine pseudorabies HeN1 strains, NVDC-PRV-BJ strains, NVDC-PRV-HEB strains, NVDC-PRV-SD strains, PRV TJ strains, porcine pseudorabies virus variant strains PRV-ZJ01, porcine pseudorabies virus variant strains HN1201 strains and porcine pseudorabies virus variant strains HN1202 strains. The pseudorabies variant strains have good immunogenicity and can be used as parent strains of vaccine strains.

The porcine pseudorabies virus strain JS-2012 is disclosed in the separation and identification of pseudorabies virus in immunized sick piglets [ J ]. Tongwu, Zhang Qingzhan, Zhenghao and the like, Chinese animal infectious disease academic newspaper 2013,21(3): 1-7); porcine pseudorabies HeN1 strain with the preservation number of CGMCCNO.6656, disclosed in patent application CN 102994458A; NVDC-PRV-BJ strain, NVDCPRV-HEB strain, and NVDC-PRV-SD strain are disclosed in Pathological Pseudomonas Virus, Xiuling Yu, Zhi Zhou, Dongmei Hu, et al China,2012 EmergingInfections Diseases, www.cdc.gov/eid ol.20, No.1, January 2014; the PRV TJ strain (PRV TJ) disclosed in Chun-Hua Wang, Jin Yuan, Hua-Yang Qin, et al, A novel gE-deleted microorganisms virus (PRV) pro-video rapid and complete protection from free passage change with the PRV variant implementation in Bartha-K61-modified shock amplification in China Vaccine 32(2014)3379 and 3385; the porcine pseudorabies virus variant PRV-ZJ01 with the preservation number of CGMCC NO.8170 is disclosed in the patent application CN 103627678A; porcine Pseudorabies virus HN1201 strain (strain HN1201), the preservation number of which is CCTCC NO. V201311, disclosed in patent application CN 104004774A; porcine Pseudorabies virus HN1202 strain (strain HN1202) with the preservation number of CCTCC NO. V201335 is disclosed in patent application CN 104328090A.

Porcine pseudorabies variant attenuated strain

The porcine pseudorabies variant attenuated strain is a strain which is obtained by artificially attenuating or naturally attenuating the porcine pseudorabies variant strain as a parent strain and retains the immunogenicity and the self-propagating capability of the porcine pseudorabies variant virulent parent strain, but the toxicity is greatly reduced.

Preferably, in the live vaccine rPRV-Cap, the PRV is a gI, gE, 11K and 28K four-gene deletion attenuated strain of porcine pseudorabies virus HN1201 strain.

More preferably, the strain weakened by the deletion of the gI, gE, 11K and 28K four genes is the HN1201-R strain weakened by natural passage.

The gI, gE, 11K and 28K four genes naturally deleted weakening strain HN1201-R strain of porcine pseudorabies virus HN1201 strain is disclosed in patent application CN 105087506A.

Amount of immunity

An "immunizing amount" is understood to mean an "immunologically effective amount," also referred to as an immunoprotective amount or an amount effective to produce an immune response, of antigen effective to induce an immune response in a recipient, sufficient to prevent or ameliorate the signs or symptoms of disease, including adverse health effects or complications thereof. The immune response may be sufficient for diagnostic purposes or other testing, or may be suitable for use in preventing signs or symptoms of disease, including adverse health consequences or complications thereof caused by infection by a pathogen. Humoral immunity or cell-mediated immunity or both can be induced. The immune response of an animal to an immunogenic composition can be assessed indirectly, for example, by measuring antibody titers, lymphocyte proliferation assays, or directly by monitoring signs or symptoms after challenge with wild-type strain, while the protective immunity provided by the vaccine can be assessed by measuring, for example, clinical signs of the subject such as mortality, reduction in morbidity, temperature values, the subject's overall physiological status, and overall health and performance. The immune response may include, but is not limited to, induction of cellular and/or humoral immunity.

Porcine circovirus type 3

The porcine circovirus type 3 is a circovirus with a genome of 2.0kb, has homology of less than 50 percent with known circovirus, namely nucleotide or amino acid sequences, is a novel porcine circovirus, and can cause dermatitis nephrotic syndrome, proliferative necrotizing pneumonia, reproductive failure and inflammatory reaction of heart and multiple systems of pigs by mixed infection with various pathogens.

Porcine circovirus type 2new gene subtype

The "porcine circovirus type 2new gene subtype" refers to a new PCV2 gene subtype, wherein the ORF2 gene of the new PCV2 gene subtype has mutation or is recombined from ORF2 genes of different gene subtypes, the new PCV2 gene subtype has a PCV2b tag sequence, but an independent branch is formed in genetic evolution analysis, and clinical characteristics of a pig infected with only a strain of the gene subtype are as follows: persistent high temperature, anorexia, mental depression, coarse and disorganized fur, emaciation and slow growth rate, and lung consolidation, lymphadenectasis and kidney necrosis.

Preferably, the porcine circovirus type 2new gene subtype not only has immunogenicity against porcine circovirus type 2new gene subtype strains, but also retains immunogenicity against porcine circovirus type 2a, 2b, 2d subtypes.

Adjuvant

Adjuvants are non-specific immunopotentiators that, when injected or pre-injected into the body with an antigen, can enhance the body's immune response to the antigen or alter the type of immune response.

Such an adjuvant is not necessarily required for efficacy of the live recombinant porcine pseudorabies virus according to the invention, but would be worthwhile to add an adjuvant, in particular for a combination vaccine comprising the live recombinant porcine pseudorabies virus according to the invention and an antigenic substance from another pathogenic virus or microorganism. Adjuvants are non-specific stimulators of the immune system that enhance the host's immune response to the vaccine. Examples of adjuvants known in the art are Freund's complete and incomplete adjuvants, vitamin E, non-ionic block polymers, muramyl dipeptides, ISCOMs (immunostimulating complex, see for example European patent EP 109942), saponins, mineral oils, vegetable oils, and Carbopol.

Preferably, the adjuvant comprises (1) an alumina gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) a copolymer of a polymer of acrylic acid or methacrylic acid, maleic anhydride and an alkenyl derivative; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide and Gel adjuvant.

Pharmaceutical carrier

A pharmaceutical carrier refers to other ingredients added to a vaccine composition that are carriers or diluents that do not stimulate the body and do not hinder the biological activity and properties of the compound used.

For example, the pharmaceutical carrier may comprise a pharmaceutically acceptable carrier or diluent useful in the present invention, including stabilizers such as SPGA, sugars (e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein-containing materials such as bovine serum or skim milk, and buffers (e.g., phosphate buffered saline).

Especially when such stabilizers are added to the vaccine, the vaccine is very suitable for freeze drying. Thus, in a more preferred form of this embodiment, the live vaccine is in a freeze-dried form.

Combination vaccine and composite vaccine

The term "combination vaccine" as used herein is intended to mean a vaccine prepared from a viral mixture of a recombinant virus of the invention and at least one different virus.

The term "composite vaccine" as used herein refers to a vaccine prepared from viruses and bacteria. For example, the recombinant viruses of the present invention may be mixed or combined with classical swine fever virus, porcine reproductive and respiratory syndrome virus and/or haemophilus parasuis, mycoplasma. Infection of porcine pseudorabies virus

The porcine pseudorabies virus infection can mean that pigs at any age are infected, can be horizontally transmitted in a pig group, has short latency (1-2 days), has the morbidity of 10-100 percent and the mortality of the sick pigs of 10-100 percent (the mortality of piglets can be as high as 100 percent), can cause high fever (40-42 ℃ and lasts for more than 3 days) of the pigs after infection, has dyspnea, diarrhea, asthma, cough, sneezing, hind limb paralysis, dog sitting, falling down suddenly, convulsion, lying on one side, angle arc rebound, stroke-like water, finally decays and dies, can cause the quality reduction of semen of breeding boars, abortion (up to 35 percent) of pregnant sows, premature birth, dead fetus, weak piglets (all die before 14 days of weak piglets), and other reproductive disorder symptoms, but is not limited. The above symptoms are different from the symptoms generated after the infection of the common porcine pseudorabies virus in the prior art: after infection, adult pigs (with the weight of more than 50 kg) can cause high fever (40-42 ℃ and lasting for more than 3 days), dyspnea, diarrhea, asthma, cough, sneezing, hind limb paralysis, dog sitting, suddenly falling down, twitching, lying on side, turning over at the angle, swimming, and finally dying due to exhaustion; newborn piglets and piglets within 4 weeks of age suddenly suffer from diseases and are killed in large quantities, and the death rate reaches over 90 percent; the sick piglets mainly show that the body temperature rises to over 41 ℃, the appetite is abolished, and obvious neurological symptoms and diarrhea are accompanied; the piglets before and after weaning are mainly respiratory symptoms and show dyspnea, cough, rhinorrhea and the like.

Infection of porcine circovirus

Porcine circovirus infection may refer to disease caused by infection of porcine circovirus type 2 and/or type 3 alone or in combination. Porcine circovirus type 2 infection includes PCV2a, PCV2b, PCV2d, PCV2new gene subtype infection. The diseases caused by infection can be non-exhaustive, including, but not limited to, postweaning multisystemic wasting syndrome, porcine dermatitis nephrotic syndrome, hyperplastic necrotizing pneumonia, reproductive disorders and cardiac and multisystemic inflammatory responses.

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

The chemical reagents used in the examples of the present invention are all analytical reagents and purchased from the national pharmaceutical group.

In order that the invention may be more readily understood, reference will now be made to the following examples. The experimental methods are conventional methods unless specified otherwise; the biomaterial is commercially available unless otherwise specified.

Example 1 isolation and identification of porcine circovirus type 2 and determination of Cap protein Gene

1. Origin of disease material

In a domestic pig farm for immunizing commercial PCV2 vaccine, the phenomena of sow abortion and mummy fetus increase occur sporadically. Affected sows showed anorexia and contain mummified fetuses of different gestational ages in the litters of the miscarriage, consistent with symptoms of PCV 2-related miscarriage. PCV2 was positive as detected by immunohistochemistry and quantitative PCR. PCV2 is still detected from diseased pig tissues after immunization of PCV2 commercial vaccine, the reason is worthy of deep study, and in order to further clarify the reason, each tissue pathogen is selected for pathogen isolation.

2. Isolation and culture of viral strains

The disease material is mixed according to the proportion of 1: 10 (volume ratio) adding DMEM culture solution, grinding and preparing tissue suspension; repeatedly freezing and thawing the tissue suspension for 3 times, centrifuging at 12000r/min for 15min, and collecting supernatant; filtering the supernatant with 0.22 μm filter membrane, passaging the filtrate on PK15 cells, culturing at 37 deg.C for 1h, adding 2% calf serum-containing DMEM culture solution, and culturing at 37 deg.C for 5 days. And (4) harvesting a culture solution containing the virus, and after 2 times of freeze thawing, harvesting the virus.

3. Identification of viruses by PCR and sequencing analysis

And (3) taking the virus culture harvested in the step (3), extracting nucleic acid of a virus sample by using a nucleic acid extraction kit, and performing PCR amplification identification by using a PCV2 specific primer, wherein the result shows that a 1.7kb strip is amplified by PCR. And (3) sending the PCR product to a sequencing company for nucleotide sequence determination, and carrying out genetic evolution analysis on a sequence determination result. The result shows that the whole genome sequence of the virus strain has less than 96 percent of homology with other reported PCV2, the amino acid sequence is less than 94 percent, and further whole genome sequence analysis shows that the virus strain is between PCV2b and PCV2d, the ORF2 gene has mutation or is recombined by ORF2 genes of different gene subtypes, and the virus strain belongs to a new PCV2 gene subtype determined by genetic evolution analysis.

4. Cap protein gene amplification

Oligonucleotide primers were synthesized based on the conserved region sequences at the 5 'and 3' ends of the Cap protein gene, and PCR was performed. The primer sequences are shown in Table 1.

TABLE 1 amplification primers for porcine circovirus type 2Cap protein gene

PCV2-Cap-F	CCCATGCCCTGAATTTCCA
		PCV2-Cap-R	CAGCGCACTTCTTTCGTTTTCAG

And (3) sending the PCR product to Invitrogen company for sequencing, wherein the result shows that compared with the Cap protein amino acid sequence of PCV2 in the prior art, the amino acid sequence coded by the Cap protein gene has gene mutation or recombination at 52-64, 106-108 and 131-137, the Cap protein gene is subjected to codon optimization according to the sequencing result, and the optimized Cap protein gene sequence is shown as a sequence table SEQ ID NO. 1.

Example 2 isolation and identification of porcine circovirus type 3 and determination of Cap protein Gene

1. Sources of pathological materials

Compared with the historical average value, the mortality of the sows is increased by 9.4%, the conception rate is reduced by 1.2%, and the mummy fetus is increased by 8.2% in a commercial pig farm in China. Clinically, affected sows show anorexia, with symptoms of multifocal papules, blotches, and surface dermatitis. Mummified fetuses of different gestational ages were contained in the litters of the miscarriage, consistent with symptoms of PCV 2-associated miscarriage. Although the overall clinical manifestations and abortion symptoms observed in sows were consistent with the reproductive disorders caused by porcine circovirus type 2, different tissues of all sows, including kidney, lymph nodes, lung, skin and stillborn fetuses, were negative for PCV2, PRRSV, PPV, CSFV, mycoplasma hyopneumoniae detection by immunohistochemistry and quantitative PCR. To further check the cause, various tissue disease materials are selected for pathogen separation.

2. Isolation and culture of viral strains

The disease material is mixed according to the proportion of 1: 10 (volume ratio) adding DMEM culture solution, grinding and preparing tissue suspension; repeatedly freezing and thawing the tissue suspension for 3 times, centrifuging at 12000r/min for 15min, and collecting supernatant; filtering the supernatant with 0.22 μm filter membrane, passaging the filtrate on PK15 cells, culturing at 37 deg.C for 1h, adding 2% calf serum-containing DMEM culture solution, and culturing at 37 deg.C for 5 days. And (4) harvesting culture solution containing virus, and after freezing and thawing the culture solution for 2 times, harvesting the virus.

3. Identification of viral species by PCR and sequencing analysis

And (3) taking the virus culture obtained in the step (1), extracting nucleic acid of a virus sample by using a nucleic acid extraction kit, and performing PCR amplification identification by using a circovirus species specific primer, wherein the result shows that a 2000bp band is amplified by PCR. And (3) sending the PCR product to a sequencing company for nucleotide sequence determination, and carrying out genetic evolution analysis on a sequence determination result. The results show that the genome sequence and amino acid sequence of the virus strain are less than 50% homologous with other reported circovirus, and according to the standard of the international committee for virology classification, the virus of the same species in the circovirus genus should have > 75% homology of genome nucleotide sequence and the Cap protein has > 70% homology of amino acid sequence, so that the virus strain is a new porcine circovirus and is also the third circovirus found on the pig body at present.

4. Cap protein gene amplification

Oligonucleotide primers were synthesized based on the conserved region sequences at the 5 'and 3' ends of the Cap protein gene, and PCR was performed. The primer sequences are shown in Table 2.

TABLE 2 porcine circovirus type 3Cap protein gene amplification primers

PCV3-Cap-F	CCA CAG AAG GCG CTA TGT C
		PCV3-Cap-R	CCG CAT AAG GGT CGT CTT G

And (3) sending the PCR product to Invitrogen company for sequencing, and carrying out codon optimization on the Cap protein gene according to a sequencing result, wherein the sequence of the optimized Cap protein gene is shown as a sequence table SEQ ID NO. 2.

Example 3 construction of porcine circovirus type 2Cap protein Gene recombinant porcine pseudorabies Virus live vector

1. Construction of recombinant vector pUC-gIA-US2B-PCV2-Cap

Naturally deleting four genes of gI, gE, 11K and 28K of a porcine pseudorabies virus HN1201 strain to obtain a weakened strain HN1201-R, taking the virus nucleic acid of the HN1201-R strain as a template, respectively amplifying gIA and US2B homologous arm gene sequences by using gIF and gIR primers and US2F and US2R primers, and respectively cloning the gene sequences to a pUC19 vector in an enzyme digestion mode to construct a recombinant vector pUC-gIA; subjecting pUC-gIA and US2B to restriction enzyme digestion treatment by SalI and HindIII respectively, and then connecting to obtain pUC-gIA-US 2B;

PCV2Cap protein gene with size of about 702bp is obtained by amplification with PCV2-Cap-F and PCV2-Cap-R primers by using PCV2 genome isolated in example 1 as a template, and is cut with NheI and BamHI and connected with pAc-GFP-C1 plasmid cut with NheI and BamHI to obtain PCV2Cap protein gene plasmid pAc-PCV2-Cap with CMV promoter; the plasmid pAc-PCV2-Cap is used as a template, a CMV-PCV2-Cap fragment with the size of about 1482bp is obtained by amplification with a CMVF primer and an SV40R primer, the fragment is subjected to enzyme digestion treatment by Smal I and SalIsI, and is connected with pUC-gIA-US2B subjected to the same enzyme digestion treatment, and the plasmid pUC-gIA-US2B-PCV2-Cap is obtained by enzyme digestion identification.

Primer sequences are shown in Table 3.

TABLE 3 primers used for recombinant vector construction

CMVF	gcatGAAGAC gc gtcgTAGTTATTAATAGTAATCAATTACG
		SV40R	cttctgtccgcaCTAGAATGCAGTGAAAAAAATGC
gIF	ccgGAATTCgcaggtggaccggctgctgaacgag
		gIR	Cgc ggatcc Cttctg tacgacgccggtactgcggaggctacggaccg
US2F	Acgcgtcgac cttctgag tgcggacgcggtccgaccccacgg
		US2R	CCC AAGCTT gacgaggaagaggaggacgaggaag

2. Construction of pCas9/gRNA gene knockout vector

gIgRNAF and gIgRNAR primer sequences (shown in Table 4) are artificially synthesized, annealed, connected with pCas9/gRNA vector digested by EcoRV, and the connection product is transformed into Escherichia coli competent cell DH5 alpha. A single colony is picked up and identified to be 190bp in size, and is named as pCAS-gRNA-gI plasmid.

TABLE 4 primers used for construction of pCas9/gRNA gene knock-out vectors

3. Obtaining of PCV2Cap protein-containing gene recombinant pseudorabies virus

Vero cells were co-transfected with 3. mu.g of PRV strain HN1201-R viral genome and 5. mu.g of pUC-gIA-US2B-PCV2-Cap, pCAS-gRNA-gI according to Lipofectamine 2000 instructions. When the cytopathic effect after transfection reaches 90%, harvesting and purifying to obtain the recombinant virus containing PCV2Cap protein gene, named as rPRV-gI ^- /gE ^- /11K ^- /28K ^- -PCV2-Cap (recombinant virus 1 for short).

The recombinant pseudorabies virus inserted with PCV2Cap protein gene can be obtained by detecting the supernatant of the cell infected by the recombinant virus through PCR.

Example 4 construction of porcine circovirus type 3Cap protein Gene recombinant porcine pseudorabies Virus live vector

PCV3 genome separated in example 2 is used as a template, PCV3-Cap-F and PCV3-Cap-R primers are used for amplification to obtain PCV3Cap protein gene with the size of about 645bp, the PCV3Cap protein gene is cut by NheI and BamHI and is connected with pAc-GFP-C1 plasmid cut by NheI and BamHI to obtain PCV3Cap protein gene plasmid pAc-PCV3-Cap containing CMV promoter; the plasmid pAc-PCV3-Cap is used as a template, a CMV-PCV3-Cap fragment with the size of about 1425bp is obtained by amplification with a CMVF primer and an SV40R primer, the fragment is subjected to enzyme digestion treatment by SmalI and SalIsI, and is connected with pUC-gIA-US2B subjected to the same enzyme digestion treatment, and the plasmid pUC-gIA-US2B-PCV3-Cap is obtained by enzyme digestion identification.

According to the method of example 3, PRV HN1201-R strain virus genome, pUC-gIA-US2B-PCV3-Cap, pCAS-gRNA-gI are co-transfected into Vero cells to construct porcine pseudorabies virus live vector of recombinant porcine circovirus type 3Cap protein gene, and the recombinant virus containing PCV3Cap protein gene is obtained after identification and named as rPRV-gI ^- /gE ^- /11K ^- /28K ^- -PCV3-Cap (recombinant virus 2 for short).

Example 5 construction of porcine circovirus type 2 and type 3Cap protein Gene recombinant porcine pseudorabies Virus live vectors

PCV2Cap protein gene with size of about 702bp is obtained by amplification with PCV2-Cap-F and PCV2-Cap-R primers by using PCV2 genome isolated in example 1 as a template, and is cut with NheI and BamHI and connected with pAc-GFP-C1 plasmid cut with NheI and BamHI to obtain PCV2Cap protein gene plasmid pAc-PCV2-Cap with CMV promoter;

PCV3 genome separated in example 2 is used as a template, PCV3-Cap-F and PCV3-Cap-R primers are used for amplification to obtain a PCV3Cap protein gene with the size of about 645bp, BsaI of the PCV3Cap protein gene is cut and treated, and then the PCV3Cap protein gene plasmid is connected with pAc-PCV2-Cap plasmid which is cut and treated with BamHI, so that PCV2Cap protein gene containing CMV promoter and PCV3Cap protein gene plasmid pAc-PCV2-Cap 3-Cap are obtained;

the plasmid pAc-PCV2-Cap-PCV3-Cap is used as a template, a CMVF and SV40R primer is used for amplification to obtain a CMV-PCV2-Cap-PCV3-Cap fragment with the size of about 2127bp, the fragment is subjected to enzyme digestion treatment by Smal I and SalIsI, the fragment is connected with pUC-gIA-US2B subjected to the same enzyme digestion treatment, and the plasmid pUC-gIA-US2B-PCV2-Cap-PCV3-Cap is obtained through enzyme digestion identification.

According to the method of example 3, PRV HN1201-R strain virus genome and pUC-gIA-US2B-PCV2-Cap-PCV3-Cap, pCAS-gRNA-gI are co-transfected into Vero cells to construct porcine circovirus type 2 and type 3Cap protein gene recombinant porcine pseudorabies virus live vectors, and the recombinant virus containing PCV2 and PCV3Cap protein genes is obtained through identification and named as rPRV-gI ^- /gE ^- /11K ^- /28K ^- -PCV2-Cap-PCV3-Cap (recombinant virus 3 for short).

Example 6 preparation of porcine circovirus type 2, type 3Cap protein Virus-like particle vaccine

The PCV2 and PCV3Cap protein genes shown in the sequence table SEQ ID NO.1 and the sequence table SEQ ID NO.2 are sent to Suzhou hong Xun Biotech Co., Ltd for complete sequence synthesis and are connected to pET28a plasmid. The connected plasmid and molecular chaperone plasmid pG-Tf2 are co-transformed into Escherichia coli BL21(DE3), Escherichia coli expression strains pET28a-PCV2-Cap/pG-Tf2/E.Coli BL21(DE3), pET28a-PCV3-Cap/pG-Tf2/E.Coli BL21(DE3) are constructed, and target protein soluble expression is carried out. The PCV2 and PCV3Cap protein expressed is subjected to 200KV transmission electron microscope with the magnification of 60000 times, and PCV2 and PCV3 virus-like particles which are negatively stained by 5% phosphotungstic acid and fixed on a carbon-sprayed copper net are observed, and the result shows that a large number of virus-like particles are uniform in size and are in a hollow particle state.

Mixing the prepared PCV2Cap protein and PCV3Cap protein in proportion, slowly adding the mixture into a water-soluble adjuvant Gel adjuvant (Saybolt France), continuously stirring for 12min by an emulsifying machine with the rotation speed of 800rpm in the adding process, and uniformly mixing. The specific formula of PCV2 and PCV3Cap protein virus-like particle vaccine is shown in Table 5.

TABLE 5PCV2 and PCV3Cap protein virus-like particle vaccine mixture ratio

Components	Vaccine 1	Vaccine 2
			PCV2-Cap protein (μ g/ml)	100	-
PCV3-Cap protein (μ g/ml)	-	100
			Gel adjuvant (V/V%)	10％	10％

EXAMPLE 7 immunogenicity testing of recombinant viruses

1. PCV2 portion

40 healthy piglets which are detected by ELISA at the age of 28-30 days and have PRV, PCV2, PCV3 antigen and antibody negativity are randomly divided into 8 groups and 5 groups. Groups 1-2 immunization of the recombinant virus 1 constructed in the example 3, groups 3-4 immunization of the recombinant virus 3 constructed in the example 5, groups 5-6 immunization of the vaccine 1 prepared in the example 6, and groups 7-8 immunization as challenge control groups. Recombinant virus immunization group injection 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) Vaccine 1 immunization group was injected with 2 ml/head, and challenge control group was inoculated with 2 ml/head DMEM medium. The 21 th day after the immunization of the groups 1, 3 and 5 and the 7 th group of the virus attacking control group are combined, the 28 th day after the immunization of the groups 2, 4 and 6 and the 8 th group of the virus attacking control group are combined to attack the virus, the virus attacking Strain is Porcine Circovirus type 2 HH3 Strain (Portone Circovirus type 2, Strain HH3, the Strain is preserved in China center for type culture Collection, the preservation number is CCTCC NO: V201726, the preservation date is 2017, 6 months and 4 days, the preservation address is university of Wuhan, China), the virus attacking dose is 10 ^5.0 TCID ₅₀ And/or continuously observing each piglet after the virus attack, and judging according to the clinical symptoms, pathological changes and virus detection results of each piglet, wherein the specific results are shown in tables 6 and 7.

TABLE 6 PCV2 challenge protection test results 21 days after immunization

TABLE 7 PCV2 challenge protection test results 28 days after immunization

The results show that 100% protection can be obtained 21 days after the pigs are immunized by the recombinant virus, and no virus is detected in all pigs after virus challenge; 2/5 swine virus test is positive 21 days after the swine is immunized by the virus-like particle vaccine 1. It was shown that antibody production was faster after immunization of pigs with recombinant virus, providing complete protection against PCV2 at least 1 week earlier compared to virus-like particle vaccines.

2. PCV3 portion

40 healthy piglets which are detected by ELISA at the age of 28-30 days and have PRV, PCV2, PCV3 antigen and antibody negativity are randomly divided into 8 groups and 5 groups. Groups 9-10 immunize the recombinant virus 2 constructed in example 4, groups 11-12 immunize the recombinant virus 3 constructed in example 5, groups 13-14 immunize the vaccine 2 prepared in example 6, and groups 15-16 immunize against virus. Recombinant virus immunization group injection 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) Vaccine 2 immunization group was injected with 2 ml/head, and challenge control group was inoculated with 2 ml/head DMEM medium. The 21 th day after the immunization of the 9 th group, the 11 th group and the 13 th group and the 15 th group of the attacking contrast group are attacked, the 28 th day after the immunization of the 10 th group, the 12 th group and the 14 th group and the 16 th group of the attacking contrast group are attacked, the attacking Strain is Porcine Circovirus 3 type SG (Porcine Circovirus type 3, Strain SG, preserved in China center for type culture Collection with the preservation number of CCTCC NO: V201712, the preservation date is 3 months 23 days in 2017, the preservation address is university of Wuhan and Wuhan), the attacking dose is 10 ^5.0 TCID ₅₀ And/or continuously observing each piglet after the challenge, and judging according to the clinical symptoms, pathological changes and virus detection results of each piglet, wherein the specific results are shown in tables 8 and 9.

TABLE 8 immunization 21 day PCV3 challenge protection test results

TABLE 9 PCV3 challenge protection test results 28 days after immunization

The results show that 100% protection can be obtained 21 days after the pigs are immunized by the recombinant virus, and no virus is detected in all pigs after virus challenge; 2/5 swine virus test is positive 21 days after the swine is immunized by the virus-like particle vaccine 2. It was shown that antibody production was faster after immunization of pigs with recombinant virus, providing complete protection against PCV3 at least 1 week earlier compared to virus-like particle vaccines.

3. PRV moiety

50 healthy piglets at 9 days of age, which were tested for PRV, PCV2, PCV3 antigen, antibody negative by ELISA, were randomly divided into 10 groups, 5 groups/group. The recombinant virus 1 constructed in the immunization example 3 of the 17 th to 18 th groups, the recombinant virus 2 constructed in the immunization example 4 of the 19 th to 20 th groups, the recombinant virus 3 constructed in the immunization example 5 of the 21 th to 22 th groups, the porcine pseudorabies virus HN1201-R strain immunized in the 23 th to 24 th groups, and the non-immunization of the 25 th to 26 th groups are taken as a virus challenge control group. Recombinant virus immunization group injection 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) HN1201-R strain immunization group was injected with 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) And 1ml of DMEM culture medium is inoculated in the challenge control group. The 21 th day after the immunization of the 17 th group, the 19 th group, the 21 st group and the 23 th group and the 25 th group of the virus attacking contrast group are used for virus attacking, the 28 th day after the immunization of the 18 th group, the 20 th group, the 22 th group and the 24 th group and the 26 th group of the virus attacking contrast group are used for virus attacking, the virus attacking strain is porcine pseudorabies virus HN1201 strain, and the virus attacking doses are 10 ^7.0 TCID ₅₀ The clinical symptoms and death conditions are continuously observed after the challenge, the results are shown in the table 10 and the table 11, and the body temperature of the piglets is measured and the clinical symptoms are observed every day after the challenge.

TABLE 10 PRV challenge protection test results 21 days after immunization

TABLE 11 PRV challenge protection test results 28 days post immunization

The results show that after the piglets are immunized by the recombinant virus and the porcine pseudorabies virus HN1201-R strain, virus infection can be blocked (clinical symptoms appear) no matter the piglets are attacked within 21 days after immunization or 28 days after immunization, 100 percent (5/5) protection can be provided for the piglets, and the control piglets die in 5 days after the attack. The recombinant virus shows good immune protection after immunizing a pig, and the recombinant foreign gene does not influence the immunogenicity of the source low virulent strain.

Example 8 broad Spectrum protection assay for recombinant viruses

1. PCV2 portion

75 healthy piglets which are detected by ELISA at the age of 28-30 days and have PRV, PCV2, PCV3 antigen and negative antibody are randomly divided into 15 groups and 5 groups. Groups 27 to 31 immunize the recombinant virus 1 constructed in the example 3, groups 32 to 36 immunize the recombinant virus 3 constructed in the example 5, and groups 37 to 41 are not immunized and are used as an attack and toxicity control group. Recombinant virus immunization group injection 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) And 1ml of DMEM culture medium is inoculated in the challenge control group. The 21 th day after the immunization of the 27 th group and the 32 th group together with the attacking control group, the 37 th group uses the virulent strain of the porcine circovirus 2a gene subtype HN06 strain newly separated from Henan province of China to attack, the 28 th group and the 33 th day after the immunization together with the attacking control group, the 38 th group uses the virulent strain of the porcine circovirus 2b gene subtype JS04 strain newly separated from Jiangsu province of China to attack, the 29 th group and the 34 th day after the immunization of the 34 th group together with the attacking control group, the 39 th group uses the virulent strain of the porcine circovirus 2d gene subtype JL13 strain newly separated from Jilin province of China to attack, the 30 th group and the 35 th group after the immunization of the 21 th day together with the attacking control group, the 40 th group uses the virulent strain of the porcine circovirus 2new gene subtype CQ14 strain newly separated from Chongqing city of China to attack, the 31 th group and the 36 th group after the immunization together with the attacking control group, the 41 th group uses the virulent strain of the porcine circovirus 2new gene GD15 strain newly attacked by newly separated from Guangdong province of China to attack, the dose of each drug is 10 ^5.0 TCID ₅₀ And/or continuously observing each piglet after the virus attack, and judging according to the clinical symptoms, pathological changes and virus detection results of each piglet, wherein the specific results are shown in a table 12.

TABLE 12 broad-spectrum protection test results of recombinant viruses against PCV2 infection

The results show that the 37 th to 41 th groups of the virus attacking control groups have clinical symptoms of more than 40.5 ℃ of body temperature rise in different degrees after virus attacking, the clinical symptoms last for 3 to 5 days, such as anorexia, depression, rough and disordered hair, emaciation, slow growth speed and the like, the pathological changes of lung excess change, lymphadenectasis and necrotic spots in kidney in different degrees appear in the autopsy, and the porcine circovirus type 2 virus can be separated again by performing PCR detection on each organ tissue; and the 27 th to 36 th immune groups have no abnormal clinical symptoms after being attacked, have no abnormality in tissues and organs after being subjected to autopsy, and show that PCV2 is negative when PCR detection is carried out on all organ tissues. The recombinant virus provided by the invention is immunized for 21 days at a time, so that the pig can only provide effective and complete immune protection for the porcine circovirus type 2 virus of different regional sources and different gene subtypes, and the attacked PCV2 can not be detected from all visceral organs and tissues.

2. PCV3 portion

75 healthy piglets which are detected by ELISA at the age of 28-30 days and have PRV, PCV2, PCV3 antigen and negative antibody are randomly divided into 15 groups and 5 groups. Groups 42-46 immunize the recombinant virus 2 constructed in example 4, groups 47-51 immunize the recombinant virus 3 constructed in example 5, and groups 52-56 are not immunized as challenge control groups. Recombinant virus immunization group injection 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) And 1ml of DMEM culture medium is inoculated in the challenge control group. The 42 th group and the 47 th group after 21 days of immunization and the challenge control group 52 use the virulent strain of porcine circovirus type 3 HN12 strain newly separated from Henan province of China to challenge, the 43 th group and the 48 th group after 21 days of immunization and the challenge control group 53 use the virulent strain of porcine circovirus type 3 JS08 strain newly separated from Jiangsu province of China to challenge, and the 44 th group and the 49 th group after 21 days of immunization and the challenge control group 54 use the virulent strain newly separated from Jilin province of ChinaThe porcine circovirus type 3 JL11 virulent strains are subjected to virus attack, the porcine circovirus type 3 CQ04 virulent strains newly separated from Chongqing city in China are used for attacking 21 days after the 45 th group and the 50 th group are immunized together with the attacking control group 55 th group, the porcine circovirus type 3 GD05 virulent strains newly separated from Guangdong province in China are used for attacking the viruses for the 21 days after the 46 th group and the 51 st group are immunized together with the attacking control group 56 th group, and the dose of the attacking viruses is 10 ^5.0 TCID ₅₀ And/or continuously observing each piglet after the virus attack, and judging according to the clinical symptoms, pathological changes and virus detection results of each piglet, wherein the specific results are shown in a table 13.

TABLE 13 broad-spectrum protection test results of recombinant viruses against PCV3 infection

The results show that after the 52 th to 56 th groups of virus attacking control groups are subjected to virus attacking, the body temperature rises by more than 40.5 ℃ to different degrees, the clinical symptoms such as anorexia, depression, rough and disordered hair, emaciation, slow growth speed and the like are kept for 3 to 5 days, pathological changes such as lung consolidation, lymphadenectasis and necrotic spots in the kidney to different degrees are generated in the autopsy, PCR detection is carried out on each organ tissue, and porcine circovirus type 3 virus can be separated again; the 42 th to 51 th immune groups have no abnormal clinical symptoms after virus attack, have no abnormality in tissues and organs after the caesarean section, and show that PCV3 is negative when PCR detection is carried out on the tissues of organs. The recombinant virus provided by the invention is immunized for 21 days at a time, so that the pig can provide effective and complete immune protection only for porcine circovirus type 3 virus attack from different regional sources, and the attacked PCV3 can not be detected from all visceral organs and tissues.

The results show that the recombinant virus provided by the invention has broad-spectrum immunogenicity, and can completely protect against epidemic porcine circovirus type 3 and type 2 wild viruses. And after the recombinant virus is immunized, even if the wild virus infects an immunized pig, the development, growth and feeding and fattening of the pig are not affected (the positive rate of virus detection is 0).

Example 9 recombinant Virus Mixed infection protection assay

35 healthy piglets at 9 days of age, which were tested for PRV, PCV2, PCV3 antigen, antibody negative by ELISA, were randomly divided into 7 groups, 5 groups/group. Group 57 immunization of the recombinant virus 1 constructed in example 3, group 58 immunization of the recombinant virus 2 constructed in example 4, group 59 immunization of the recombinant virus 3 constructed in example 5, group 60 immunization of the vaccine 1 prepared in example 6, group 61 immunization of the vaccine 2 prepared in example 6, group 62 immunization of porcine pseudorabies virus HN1201-R strain, and group 63 immunization as a challenge control group. Recombinant virus and HN1201-R strain immunization group were injected at 1 ml/head (containing 10) ^6.0 TCID ₅₀ ) Vaccine 1 and vaccine 2 immunization groups are injected with 2 ml/head, and a virus challenge control group is inoculated with 2 ml/head of DMEM culture medium. The vaccine is attacked 21 days after the immunization of the 57 th group and the 60 th group, and the attacking virus strains are mixed virus liquid of porcine pseudorabies virus HN1201 strain and porcine circovirus type 2 HH3 strain; the virus is attacked 21 days after the 58 th group and the 61 th group are immunized, and the virus attacking strains are mixed virus liquid of porcine pseudorabies virus HN1201 strains and porcine circovirus 3 type SG strains; the 21 days after the immunization of the 59 th group and the 62 th group and the 63 th group of the virus attacking contrast group are used for virus attacking, and virus attacking strains are mixed virus liquid of porcine pseudorabies virus HN1201 strain, porcine circovirus type 2 HH3 strain and porcine circovirus type 3 SG strain; the toxin counteracting dose of HN1201 strain is 10 ^7.0 TCID ₅₀ The toxic attacking dose of the HH3 strain is 10 ^5.0 TCID ₅₀ Per head, SG strain toxic dose is 10 ^5.0 TCID ₅₀ A/head; after challenge, clinical symptoms and death status are continuously observed and shown in table 14, and after challenge, the body temperature of piglets is measured and clinical symptoms are observed every day.

TABLE 14 results of the protection test for mixed infection with recombinant viruses

The results show that the 63 rd group of the control group of the drug challenge died completely 4 days after the drug challenge; after piglets are immunized by the 57 th group, 58 th group and 59 th group of recombinant viruses, the piglets can be attacked after 21 days of immunization, the virus infection can be blocked (no clinical symptoms appear), and 100% (5/5) protection can be provided for the piglets; while the 60 th, 61 th and 62 th immunization groups were not effective in preventing mixed infection of PRV and PCV2 and/or PCV3, and remained in a morbid or dead state. The recombinant virus provided by the invention can provide effective and complete immune protection for pigs against PRV, PCV2 and PCV3 combined challenge by one-time immunization.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> Puleco bioengineering GmbH

<120> recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof

<160> 2

<170> PatentIn version 3.3<211> 702

<210> 1

<211> 702

<212> DNA

<213> Porcine Circovirus type 2new gene subtype (Porcine Circovirus type 2, new subtype)

<400> 1

atgacctacc cgcgtcgtcg ttaccgtcgt cgtcgtcacc gtccgcgttc tcacctgggt 60

cagatcctgc gtcgtcgtcc gtggctggtt cacccgcgtc accgttaccg ttggcgtcgt 120

aaaaacggta tcttcaacac ccgtctgtct cgttctttcg gttacaccgt tgttacctct 180

accgttaccc cgccgtcttg ggctgttgac atgatgcgtt tcaacatcaa cgacttcctg 240

ccgccgggtg gtggttctaa cccgcgttct gttccgttcg aatactaccg tatccgtaaa 300

gttaaagttg aattcttcgc tcgttctccg atcacccagg gtgaccgtgg tgttggttct 360

tctgctgtta tcctggacga caacttcgtt aacaaaacca acgctctgtc ttacgacccg 420

tacgttaact actcttctcg tcacaccatc acccagccgt tctcttacca ctctcgttac 480

ttcaccccga aaccggttct ggactctacc atcgactact tccagccgaa caacaaacgt 540

aaccagctgt ggctgcgtct gcagaccacc ggtaacgttg accacgttgg tctgggtacc 600

gctttcgaac actctatcta cgaccaggct tacaacatcc gtgttaccat gtacgttcag 660

ttccgtgaat tcaacctgaa agacccgccg ctgaacccgt aa 702

<210> 2

<211> 645

<212> DNA

<213> Porcine Circovirus type 3 (Portone Circovirus type 3)

<400> 2

atgcgtcacc gtgctatctt ccgtcgtcgt ccgcgtccgc gtcgtcgtcg tcgtcaccgt 60

cgtcgttacg ctcgtcgtaa actgttcatc cgtcgtccga ccgctggtac ctactacacc 120

aaaaaatact ctaccatgaa cgttatctct gttggtaccc cgcagaacaa caaaccgtgg 180

cacgctaacc acttcatcac ccgtctgaac gaatgggaaa ccgctatctc tttcgaatac 240

tacaaaatcc tgaaaatgaa agttaccctg tctccggtta tctctccggc tcagcagacc 300

aaaaccatgt tcggtcacac cgctatcgac ctggacggtg cttggaccac caacacctgg 360

ctgcaggacg acccgtacgc tgaatcttct acccgtaaag ttatgacctc taaaaaaaaa 420

cactctcgtt acttcacccc gaaaccgctg ctggctggta ccacctctgc tcacccgggt 480

cagtctctgt ctttcttctc tcgtccgacc ccgtggctga acacctacga cccgaccgtt 540

cagtggggtg ctctgctgtg gtctatctac gttccggaaa aaaccggtat gaccgacttc 600

tacggtacca aagaagtttg gatccgttac aaatctgttc tgtaa 645

Claims

1. A genome of the recombinant porcine pseudorabies virus low virulent strain is recombined with porcine circovirus Cap protein and can express porcine circovirus Cap protein, the porcine circovirus Cap protein gene is porcine circovirus type 2 and/or type 3Cap protein gene, the porcine circovirus type 2Cap protein gene is porcine circovirus type 2new gene subtype Cap protein gene, the porcine circovirus type 2new gene subtype Cap protein gene is shown in SEQ ID. NO.1, and the porcine circovirus type 3Cap protein gene is shown in SEQ ID. NO. 2.

2. The recombinant porcine pseudorabies virus low-virulent strain according to claim 1, wherein the porcine pseudorabies virus low-virulent strain from which the recombinant porcine pseudorabies virus low-virulent strain is derived is a low-virulent strain of a porcine pseudorabies virus variant strain; the porcine pseudorabies virus low virulent strain is a low virulent strain of HN1201 strain or HN1202 strain.

3. The recombinant porcine pseudorabies virus attenuated strain according to claim 1, wherein the porcine pseudorabies virus attenuated strain is HN1201-R strain.

4. A vaccine composition comprising an immunizing amount of the attenuated strain of recombinant porcine pseudorabies virus according to any one of claims 1 to 3 and a lyoprotectant.

5. The vaccine composition according to claim 4, wherein the content of the attenuated strain of the recombinant porcine pseudorabies virus is more than or equal to 10 ^6.0 TCID ₅₀ /ml。

6. The vaccine composition according to claim 4, wherein the content of the attenuated strain of the recombinant porcine pseudorabies virus is 10 ^6.0 TCID ₅₀ /ml。

7. The vaccine composition of claim 4, wherein the vaccine composition further comprises the following antigens: classical swine fever virus antigen, porcine reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, mycoplasma hyopneumoniae antigen, porcine parvovirus antigen, and/or porcine encephalitis b virus antigen.

8. The vaccine composition of claim 4, further comprising the following antigens: classical swine fever virus antigens, porcine reproductive and respiratory syndrome virus antigens, haemophilus parasuis antigens, and/or mycoplasma hyopneumoniae antigens.

9. The vaccine composition of claim 7, wherein the vaccine composition further comprises an adjuvant; the adjuvant comprises (1) an alumina gel adjuvant, saponin, alfvudine and DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) a copolymer of a polymer of acrylic acid or methacrylic acid, maleic anhydride and an alkenyl derivative; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide and Gel adjuvant.

10. Use of a vaccine composition according to any one of claims 4 to 9 in the manufacture of a medicament for the prevention of porcine circovirus and porcine pseudorabies virus infection.