CN111647568A

CN111647568A - Reverse genetic vaccine strain of novel variant strain of chicken infectious bursal disease virus and application thereof

Info

Publication number: CN111647568A
Application number: CN202010312138.0A
Authority: CN
Inventors: 祁小乐; 王笑梅; 高玉龙; 高立; 李凯; 刘长军; 潘青; 张艳萍; 崔红玉
Original assignee: Harbin Veterinary Research Institute of CAAS
Current assignee: Harbin Veterinary Research Institute of CAAS
Priority date: 2020-04-20
Filing date: 2020-04-20
Publication date: 2020-09-11

Abstract

The invention discloses a novel variant reverse genetic vaccine strain of chicken infectious bursal disease virus and application thereof. The reverse genetic vaccine strain of the novel chicken infectious bursal disease virus variant strain is named as rGtVarVP2, and is preserved in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.19383 and the preservation time of 3-12 months in 2020. rGtVarVP2 is a recombinant IBDV with a framework of a low virulent strain Gt and a main protective antigen gene VP2 replaced by a corresponding segment of a novel variant strain SHG19, and VP2 of SHG19 is introduced with a double-point mutation Q253H/A284T. The introduction of the double-point mutation Q253H/A284T enables the proliferation of recombinant strains on DF1 cells which would otherwise not be able to adapt to in vitro cell lines. The recombinant virus rGtVarVP2 is propagated on DF1 cells and then prepared into the novel IBDV variant reverse genetic vaccine (rGtVarVP2 strain), and animal experiments show that the novel IBDV variant reverse genetic vaccine (rGtVarVP2 strain) is safe and effective.

Description

Reverse genetic vaccine strain of novel variant strain of chicken infectious bursal disease virus and application thereof

Technical Field

The invention relates to a vaccine strain for chicken infectious bursal disease virus and application thereof, in particular to a novel variant reverse genetic vaccine strain for chicken infectious bursal disease virus and application thereof. The invention belongs to the technical field of veterinary drugs.

Background

Infectious Bursal Disease (IBD) is an important immunosuppressive disease of chickens, the etiology of which is Infectious Bursal Disease Virus (IBDV). The damage of IBDV to the poultry industry is divided into direct and indirect damage. Direct hazard: destroy the bursa of Fabricius of central immune organs and can kill directly. Indirect hazard: the low immunity of chicken infected and endured by IBDV causes vaccine immunity failure of other important diseases such as avian influenza, Newcastle disease and the like, and is easy to cause secondary infection, influence the production performance of chicken groups and cause serious economic loss. In conclusion, IBD seriously affects the health development of the poultry industry, and its preventive situation is very severe.

There are two serotypes of IBDV: serogroup I and serogroup II. The type I serum causes diseases to the chicken, and the type II serum does not cause diseases to the chicken. Over the past 60 years, serous type I IBDV has undergone two major mutations, one after the other of classical, variant and virulent strains. Since the last 90 s, the world is covered by the virulent IBDV (Veryvirule IBDV) which is mainly characterized by acute and high lethality, causing huge loss to the poultry industry. Over the last 30 years of effort, vvIBDV infections are gradually being controlled based on factors such as increased levels of feed management and widespread use of vaccines. However, in recent years, new changes of IBD appear, atypical IBD is discovered in parts of chicken farms in China successively, has no obvious appearance symptoms, but the bursa of fabricius of the central immune organ is seriously shrunk, so that the severe immunosuppression and the reduction of production performance are caused, and the healthy development of the poultry industry is seriously threatened. Since 2017, the laboratory has first identified that the pathogen of the epidemic is a novel IBDV variant strain, and the epidemic is spreading and expanding in main poultry farming areas such as Heilongjiang, Liaoning, Hebei, Beijing, Shandong, Jiangsu, Anhui, Guangxi, Shanxi, Yunnan, Zhejiang, Fujian, Hubei and the like (Vanlin and the like, 2019; Fan et al,2019,2020; Xu et al, 2019).

We found in earlier studies that the novel IBDV variant not only causes damage to central immune organs and immunosuppression, but also significantly affects productivity. More importantly, because the antigenicity is obviously different from that of vvIBDV, immune evasion of the novel IBDV variant strain occurs, so that some vaccines aiming at vvIBDV have unsatisfactory protection effect on the vvIBDV, and the novel IBDV variant strain is widely popularized in immune chickens. Therefore, it is necessary and urgent to develop a vaccine against the novel IBDV variant.

Disclosure of Invention

Aiming at the urgent problem that no vaccine is available for the prevention and control of the novel IBDV variant strain, the invention provides a novel IBDV variant reverse genetic vaccine strain (rGtVarVP2 strain), which can generate efficient protection against the attack of the novel IBDV variant strain.

In order to achieve the purpose, the invention adopts the following technical means:

the inventor of the invention separates and identifies the representative strain of the novel IBDV variant strain, researches and analyzes the molecular biological characteristics, pathogenicity and antigenicity of the representative strain, and finds that the SHG19 strain separated and identified by the invention belongs to the novel IBDV variant strain and can be used as the representative strain of the novel IBDV variant strain. In order to evaluate the immune protection effect of the existing commercial vaccines on the novel IBDV variant, the present study examined the virus-attacking protection situation of three vaccines (attenuated Vaccine A, subunit Vaccine B, and concatemeric Vaccine C) against vvIBDV on the novel IBDV variant SHG 19. The results show that the three vvIBDV vaccines have unsatisfactory challenge protection effect on the IBDV novel variant SHG 19. Therefore, the invention constructs a novel chicken infectious bursal disease virus variant reverse genetic vaccine strain named rGtVarVP 2. rGtVarVP2 is a recombinant IBDV with a framework of a low virulent strain Gt, wherein VP2 is replaced by the corresponding segment of a novel variant strain SHG19, and VP2 of SHG19 is introduced with double-point mutation Q253H/A284T (the corresponding nucleotide mutations are A889C and G980A of the A segment), and the introduction of double-point mutation Q253H/A284T enables the proliferation of recombinant strains which are not originally adapted to in vitro cell lines on DF1 cells. Therefore, the rGtVarVP2 is a recombinant IBDV which takes a attenuated vaccine strain as a framework, has main protective antigen genes consistent with the novel IBDV variant strain, and can adapt to DF1 cell culture. The recombinant virus rGtVarVP2 is propagated on DF1 cells, and then a novel IBDV variant reverse genetic vaccine (rGtVarVP2 strain) is prepared. SHG19 challenge protection test shows that the novel IBDV variant reverse genetic vaccine (rGtVarVP2 strain) is safe and effective.

On the basis of the research, firstly, the invention provides a novel variant reverse genetic vaccine strain of the chicken infectious bursal disease virus, which is named as rGtVarVP2 and is classified and named as the chicken infectious bursal disease virus, the vaccine strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the microbial research institute of China academy of sciences No. 3 of West Siro 1 of North Cheng, Naja, Beijing, has the preservation number of CGMCC No.19383, and the preservation time is 3 months and 12 days in 2020.

Furthermore, the invention also provides a method for preparing the reverse genetic vaccine strain cytotoxin of the novel chicken infectious bursal disease virus variant strain, which comprises the following steps:

culturing DF1 cells in a cell culture bottle, inoculating the novel variant strain reverse genetic vaccine strain of the chicken infectious bursal disease virus when the cells are 75-85% full, adsorbing for 1h in a cell culture box at 37 ℃, then supplementing a cell maintenance solution, continuously culturing in the cell culture box at 37 ℃, observing the pathological change condition of the cells day by day, repeatedly freezing and thawing the cells for three times after 60h, and collecting cell suspension to obtain the novel variant strain reverse genetic vaccine strain of the chicken infectious bursal disease virus.

Wherein, the reverse genetic vaccine strain of the novel chicken infectious bursal disease virus variant strain is preferably inoculated according to the amount of 0.1 MOI.

Wherein, preferably, the cell maintenance solution is DMEM medium containing 2% v/v fetal bovine serum.

Furthermore, the invention also provides the application of the novel variant reverse genetic vaccine strain of the chicken infectious bursal disease virus in the preparation of the chicken infectious bursal disease vaccine.

Compared with the prior art, the invention has the beneficial effects that:

(1) the vaccine strain (rGtVarVP2 strain) of the invention is the first international vaccine strain for IBDV novel variant strains, and is urgently needed for production practice.

(2) The phenotype of the vaccine strain (rGtVarVP2 strain) of the invention is attenuated (safe to chicken), and the main protective antigen gene is homologous with the IBDV novel variant strain (good in protection effect), so that the vaccine is safe and effective.

(3) The vaccine strain (rGtVarVP2 strain) of the invention can be propagated on DF1 cells (the wild virus of the IBDV novel variant strain can not adapt to DF1 cells) through mutation modification, thereby facilitating the production of vaccines.

Drawings

FIG. 1 is an amino acid sequence evolutionary tree of IBDV isolates;

(a) VP2 represents a segment; (b) VP1 represents a segment;

FIG. 2 is a whole genome sequence analysis of SHG 19;

(a) a polyprotein amino acid sequence clade; (b) VP1 amino acid sequence clade; (c) characteristic amino acid alignment of VP5, polyprotein, and VP1 Var: variant strains; VV: ultra-strong toxicity; AT: a low virulent strain;

FIG. 3 shows the pathogenicity evaluation of SHG19 strain IBDV on SPF chickens;

(a) body weight; (b) kinetic profile of BBIX; (c) spleen body weight ratio; (d) pathological change of bursal tissue (scale 100 μm);

FIG. 4 is an evaluation of the horizontal transmission ability of SHG19 strain IBDV;

(a) serum antibody titer; (b) viral RNA copy number in bursa of fabricius; (c) BBIX; (d) spleen body weight ratio;

FIG. 5 shows the immunosuppression of the novel IBDV variant against avian influenza vaccines;

FIG. 6 shows the immunoprotection evaluation of IBDV supervirulent vaccine against novel IBDV variant strains;

(a) IBDV antibody titer; (b) BBIX; (c) spleen body weight ratio; (d) bursa of fabricius; (e) change in bursal disease pathology (scale 100 μm);

FIG. 7 is a schematic representation of infectious clones of recombinant IBDV;

FIG. 8 is an identification of IFA of rGtVarVP2 infected DF1 cells;

FIG. 9 is a sequencing identification of rGtVarVP 2;

FIG. 10 is bursa weight index of immunized chickens 14 days after immunization;

FIG. 11 shows IBDV antibody titers from immunized chickens 14 days after immunization;

(a) an ELISA antibody; (b) neutralizing antibodies;

FIG. 12 shows the challenge protection test results;

(a) BBIX; (b) pathological section of bursa of Fabricius (scale 200 μm).

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

EXAMPLE 1 isolation and characterization of novel variant of infectious bursal disease Virus, SHG19

1. Materials and methods

1.1 clinical sample Collection and handling

In 2017, in 9 months, 36-day-old broilers in a chicken farm in Chuzhou city, Anhui province show suspected clinical symptoms of IBD. The sick chicken shows lassitude, and the bursa of Fabricius is seriously atrophied by the autopsy. Adding a proper amount of PBS into a tested diseased chicken bursa of Fabricius sample, grinding, repeatedly freezing and thawing for three times, centrifuging the prepared suspension for 5min at 4 ℃ at 5000g, and taking the supernatant for subsequent detection.

1.2SPF chickens, viruses and major agents

Specific-pathogen-free (SPF) chickens and SPF chick embryos are provided by the experimental animal center of harbourne veterinary institute, china agro-scientific institute, and SPF chickens are raised in negative pressure isolators. DT40 cells were maintained by the poultry immunosuppressive disease team (hereinafter referred to as the laboratory) of Harbin veterinary institute of Chinese academy of agricultural sciences.

IBDV very virulent (vvIBDV) representative strains in China, Gx (Wang et al, 2004) and HLJ0504(Qi et al, 2011), were isolated and identified in the laboratory. Single factor sera of these three viruses, as well as IBDV VP2 protein monoclonal antibody (strain 7D4) were prepared in the laboratory. The avian influenza bivalent inactivated vaccine (H5+ H7) is a product of Harbin Vitaceae biotechnology limited company.

RNAasso Plus is available from TAKARA; the M-MLV reverse transcription kit is purchased from Invitrogen company; PrimeSTARTM HS DNA Polymerase, Ex Taq Polymerase, pMD18-T vector, RNAioso Plus, DL2000DNA Marker are all products of Dalibao bioengineering, Inc. (Takara); the nucleic acid gel recovery kit and the small quality-improving particle kit are AxyPrep products. The fetal bovine serum is an AusBian product; EDTA-pancreatin digestive juice, penicillin two antibiotics for Harbin national biological science and technology products; DMEM, Opti-MEM, 1640 is Thermo Scientific product.

1.3 extraction of RNA and RT-PCR detection

200 μ L of the above-mentioned pathological suspension was taken, total RNA was extracted from the sample according to the instruction of RNAioso Plus, and cDNA was synthesized according to the procedure provided in the M-MLV reverse transcription kit. Detection of the representative segment of IBDV VP2 was performed using cDNA as template, with forward primer 2U and reverse primer 2L (Table 1). The PCR procedure was: at 95 ℃ for 5min, at 95 ℃ for 30s, at 56 ℃ for 30s, at 72 ℃ for 45s, for 35 cycles; 5min at 72 ℃. The expected amplification length is 930bp by detecting the RT-PCR result by using 1% agarose gel electrophoresis.

The VP2 amplified positive samples, further using B464U/B1718L as primers (Table 1), and amplifying VP1 gene representative segment by PCR, the reaction procedure is: 5min at 95 ℃; 35 cycles of 95 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 1 min; 10min at 72 ℃. The expected amplification length is 1255 bp.

The positive PCR product is sent to Jilin province Kuumei Biotechnology limited company for sequencing, and the effective sequence of VP2 is determined to be 777bp (bp 547-1323 of VP2 gene, corresponding amino acid is aa 183-441); the effective sequence of VP1 was determined to be 1152bp (bp 511-1662 of VP1 gene, corresponding to amino acid aa 134-517).

1.4 isolation of the Virus

Virus isolation was performed using the SPF chick embryo method. 200 mu L of the disease material suspension is inoculated to 9-day SPF chick embryos by the chorioallantoic membrane way, 5 chick embryos are inoculated to each generation, 3 chick embryos are compared, and 5 days are observed. Culturing in 37 deg.C incubator, observing the clinical symptoms and death condition of chick embryo every day, and discarding dead embryo within 24 h. And 5 days after inoculation, dissecting dead chick embryos and resistant chick embryos, collecting bursa of Fabricius, liver, allantoic membrane and allantoic fluid, mixing, grinding to obtain suspension, performing RT-PCR detection, and performing passage on new 9-day-old SPF chick embryos for three generations in a blind manner. Collecting the bursa of Fabricius, liver, allantoic membrane and allantoic fluid suspension of the third generation chick embryo, and identifying the specificity and purity, namely obtaining IBDV (chicken embryo virus) obtained by separation, which is named as SHG19 strain.

1.5 amplification and sequencing of the Virus Whole genome

To further characterize the molecular characteristics of SHG19, the present study amplified the viral genome. The IBDV genome A segment was amplified in two sections (two RT-PCR products overlapping each other) using primers AU/A1542L and A1421U2/AL2 (Table 1); the IBDV genome B-segment was amplified in two segments (two RT-PCR products overlapping each other) using primers BU/B1344L and B1344U/BL (Table 1). The RT-PCR products are respectively cloned into pMD18-T vectors after being purified, and the recombinant plasmids are sent to Jilin province Cumei biotechnology limited for sequencing.

TABLE 1 primers

1.6 analysis of the genetic evolution of the Virus

The SHG19 strain virus was subjected to sequence analysis using the software Clustal X program (version 2.0) (Larkin et al, 2007) and MEGA (version3.1) (Kuma et al, 2004). All reference strains of each type are shown in table 2. The new IBDV variant strains newly isolated in China (all isolated in the laboratory) are shown in Table 3, the isolation regions of the IBDV variant strains cover 13 provinces (cities) such as Heilongjiang, Liaoning, Hebei, Beijing, Shandong, Jiangsu, Anhui, Guangxi, Shanxi, Yunnan, Zhejiang, Fujian, Hubei and the like, and the epidemic of the IBDV variant strains is spreading continuously.

TABLE 2IBDV reference strains

TABLE 3 novel IBDV variant isolated recently in China

1.7 pathogenicity study of novel IBDV variant SHG19

To investigate the pathogenicity of the novel IBDV variant on chickens, 50 SPF chickens aged 16 days were randomly divided into 3 groups, the 1 st (10) and 2 nd (15) groups were infected, and the 3 rd (25) group was placeboSPF-chickens from

groups

1 and 2 infected 8 × 10 by nasal drip route at 16 days of age⁶Group 3 was given the same volume (200. mu.L) of sterile PBS and 3 chickens in each of

groups

2 and 3 were randomly dissected each day for 1-5 days after infection (day post-infection, d.i.) by the same route, the weights were weighed, bursa and spleen were collected and weighed, pathological changes of heart, liver, lung, kidney, thymus, leg and chest muscles were observed, and appropriate bursa and spleen samples were soaked in 10% formalin to prepare sections for histological observation<At 0.7, bursal atrophy was suggested (Lucio and Hitchner, 1979). The spleen body ratio was calculated from spleen weight and body weight, which was (spleen weight/body weight) × 1000. group 2 chickens were used for pathogenicity observation of SHG19 infection, and clinical symptoms were observed daily after infection (no gross examination), and clinical symptom index, morbidity, and mortality were counted for up to 25 days after infection, and body weights were weighed against surviving chickens and changes in body weight were observed.

To evaluate the horizontal transmission of the novel IBDV variants, 5 additional uninfected SPF chickens with the same background were co-housed with the existing 10 infected chickens in group 1 isolators and the remaining 10 chickens were dissected out in group 3 and used as controls. The clinical symptoms of the chickens were observed every day, after 25 days of co-residence, 5 chickens were randomly selected per group, the body weights were weighed, the BBIX and spleen body ratios were calculated, the pathological changes of bursa of Fabricius were observed, and the IBDV copy number in bursa of Fabricius was detected using fluorescent quantitative RT-PCR.

1.8 immunosuppressive Studies of the novel IBDV variant SHG19

30 SPF (specific pathogen free) laying hens aged 16 days are randomly divided into 3 groups, each group is 10, when the eggs are aged 16 days, the group 1 is infected with SHG19 by dropping nose and eyes, and the dosage is 8 × 10⁶viral RNAcopies/mouse.

Group

1 and 2 immunization of avian influenza bivalent inactivated vaccine by leg muscle injection route at 4d p.i(H5+ H7), 300. mu.L per chicken was immunized according to the product instructions. Group 3 is a blank control. At 0, 7 and 14 days after immunization, sera were collected from blood and examined for antibody titers against H5 and H7 by hemagglutination inhibition assay (HI).

1.9 immunoprotection test of IBDV Ultrasvery virulent vaccine against novel IBDV variants

In order to evaluate the immune protection effect of IBDV (vvIBDV) Vaccine on novel IBDV variant strains, three commercial vaccines aiming at vvIBDV are selected for immune protection test research, namely, attenuated Vaccine (Vaccine A), subunit Vaccine (Vaccine B) and multiple Vaccine (Vaccine C). 30 SPF chickens at age of 1 day are randomly divided into 5 groups, 6 of each group, according to the using instructions of the vaccines, the 1 st group is used for immunizing Vaccine A through a nose dropping eye way at age of 10 days, the 2 nd group and the 3 rd group are respectively used for immunizing Vaccine B and Vaccine C through a leg muscle injection way at age of 10 days, the 4 th group is used for inoculating PBS as a non-immune control group at age of 10 days, the 5 th group is used as a blank control, all experimental chickens are subjected to wing down infectious blood collection and are subjected to serum collection when the 17, 24 and 27 days are infected by a nose dropping eye way at age of 858G, serum is collected, and the antibody detection kit for detecting IBDV antibodies at age of 28 days is used for detecting the chickens at age of 1 to 4 days, and the 858 g dropping eye infection is used for 8584⁶viral RNAcopies/mouse. 5d p.i. and 10dp.i., 3 chickens per group were randomly necropsied, weighed, the pathological changes of heart, liver, spleen, lung, kidney, thymus and bursa of fabricius observed, bursa of fabricius and spleen weighed, and the BBIX and spleen body ratio calculated. And (3) soaking part of bursa of Fabricius of the cesary-examined chicken in 10% formalin solution, and observing pathological changes after HE staining. After treating the bursa of Fabricius sample, extracting RNA, performing reverse transcription to synthesize cDNA, and detecting the IBDV condition in the bursa of Fabricius by using an IBDV fluorescent quantitative PCR method.

1.10 Cross-neutralization assay of novel IBDV variants with ultra-virulent sera

To understand if there is an antigenic difference between the novel IBDV variant and the very virulent strain (vvIBDV), the present study performed in vitro serocross-neutralization assays using representative strains of IBDV, SHG19 and vvIBDV, Gx and HLJ0504, as well as the respective single-factor sera. Serum cross-neutralization assays were performed on DT40 cells.

TCID of IBDV₅₀And (3) determination: TCID of three strains of IBDV (SHG19, Gx, HLJ0504) on DT40 cells₅₀Detection was performed using IBDV monoclonal antibody-mediated indirect immunofluorescence assay (IFA). After inoculating 10-fold dilution of IBDV into DT40 cells and allowing to feel for 24h, the virus titer was determined by the IFA method. The specific operation steps are as follows: discarding the cell culture solution, adding appropriate amount of 4% paraformaldehyde, and fixing at room temperature for 20 min; discarding paraformaldehyde, washing cells with PBS 3 times, adding appropriate amount of IBDV VP2 protein murine monoclonal antibody (7D4, diluted 1: 500), and incubating at 37 deg.C for 1 h; discarding the monoclonal antibody, washing the cells for 3 times by PBS, adding a proper amount of FITC-labeled anti-mouse fluorescent secondary antibody (diluted 1: 200), and incubating for 1h in a wet box at 37 ℃ in the dark; the fluorescent secondary antibody was discarded, and the cells were washed 3 times with PBS, and finally 100. mu.L of PBS was added to each well and observed under an inverted fluorescent microscope. Those with green fluorescence signals are IBDV infection positive wells.

Serum cross-neutralization assay:

the neutralizing titer of SHG19 single factor serum against three strains of IBDV (SHG19, Gx, HLJ0504) was first determined. 2-fold dilution of SHG19 single factor serum; then 200TCID₅₀Respectively mixing the SHG19, Gx and HLJ0504 and diluted SHG19 serum uniformly, and incubating for 1h in a 37 ℃ incubator; 100 μ L of the virus serum mixture was added to DT40 cells cultured in a 96-well plate, and the cells were further cultured in a cell culture incubator at 37 ℃ for 24 hours, and the neutralization titer of SHG19 single-factor serum against three strains of IBDV was determined by the IFA method, respectively. In addition, the neutralizing titers of the Gx single-factor serum and the HLJ0504 single-factor serum against three strains of IBDV (SHG19, Gx, HLJ0504) were determined in a similar manner.

The cross-antigen correlations (R-values) of three single-factor sera to three strains of IBDV (SHG19, Gx, HLJ0504) were calculated using the method proposed by Archetti and Horsfall (1950) (Archetti and Horsfall, 1950). R value calculation method between two IBDVs: r2 ═ R1 x R2; heterologous neutralizing titer of virus 2/homologous neutralizing titer of virus 1; r2 ═ heterologous neutralizing titres of virus 1/homologous neutralizing titres of virus 2. A homologous R value is defined as 1, with an R value equal to 1 or close to 1 indicating antigenic similarity between the two test virus strains. The correlation between the R value and the antigenicity of the virus is as follows: 0-0.10, there is serotype difference between the two viruses; 0.11-0.70, the two viruses have subtype difference; above 0.70, there was no or less difference between the antigenicities of the two viruses (Chen et al, 2018; Jackwood and Saif, 1987).

2. Results

2.1 isolation and Gene cloning of SHG19

IBDV strain SHG19 was successfully isolated from the disease material. VP2 of SHG19 represents the segment and VP1 represents the segment GeneBank accession numbers MH879092 and MH879045, respectively; the genome A, B segments GeneBank accession numbers are MN393076 and MN393077, respectively. Sequencing results show that the full length of the A segment of the SHG19 is 3260bp, including 84bp of 5 'non-coding region, 450bp of VP5 protein gene, 3039bp of PP protein gene and 91bp of 3' non-coding region; the full length of the B segment of the SHG19 is 2829bp, which comprises 111bp of 5 'non-coding region, 2640bp of VP1 protein gene and 78bp of 3' non-coding region.

2.2 genetic evolution analysis of SHG19

The SHG19 strain was subjected to gene homology and genetic evolution analysis with 27 different types of reference strains and 81 newly isolated IBDV novel variant strains identified. The amino acid sequence evolutionary tree based on the VP2 gene representative segment shows that the serous type I IBDV is obviously divided into four branches, namely a classical strain, a super-virulent strain, a variant strain and a low virulent strain. Among the variant strains, the 81 IBDV novel variants were in two completely different subgroups from the early US variant; SHG19 was in the same subgroup as the 81 IBDV novel variant (FIG. 1 a). The amino acid sequence comparison of the novel IBDV variants SHG19 and 81 with the American early Variant shows that the homology rates with the early variants such as Variant E, E/Del, Variant A, 9109, GLS are respectively 95.7% -97.3%, 94.1% -95.7%, 95.2% -96.8%, and 92.5% -94.6%, and the novel IBDV variants SHG19 and 81 have 3 unique amino acid sites 217K, 252I and 299S in the high mutation region sequence of VP 2. The evolutionary tree based on the VP1 gene representative segment amino acid sequence shows that IBDV is obviously divided into two branches, namely a super-virulent strain branch and a non-super-virulent strain branch; the non-hyperviscous strains included variants, attenuated strains and classical strains, and the SHG19 and other novel IBDV variants identified in this study also belong to non-hyperviscous strains but form separate subgroups, and 147D and 508K are also different from the early American variants (FIG. 1 b). The above data indicate that SHG19 belongs to the novel IBDV variant and can be used as a representative strain of the novel IBDV variant.

To further explore the molecular characteristics of the novel variants, we cloned the entire genome of the SHG19 strain. Evolutionary trees based on the amino acid sequences of PP (FIG. 2a) and VP1 (FIG. 2b) showed that SHG19 is in the IBDV variant branch. However, SHG19 also exhibits unique molecular characteristics among IBDV variants. SHG19 has 10 different amino acid positions in PP compared to the U.S. reference IBDV variants, including 73I, 77D, 79S, 187V, 221K, 252I, 299S, 451L, 922Q, and 951L. For VP5, SHG19 has only 96.4% to 96.8% homology with us variants with eight different amino acid positions, 7R, 44P, 78L, 92R, 104G, 109R, 116V and 147E, which have a tetrapeptide (MLSL) deletion at the N-terminus of VP5, and no such deletion for SHG 19. In addition, VP1 of SHG19 also presents a unique amino acid position (508K) (fig. 2 c).

2.3 pathogenicity of novel variant IBDV strains

Within 25d of SHG19 infection, group 1 chickens did not die and no obvious clinical symptoms were observed, whereas body weight was significantly reduced at 25d p.i. (P <0.01) (fig. 3 a). Pathological lesions caused by SHG19 were further evaluated by necropsy, with 3 chickens in each of group 2 and group 3 being randomized by necropsy each day. The bursa of Fabricius was observed to have inflammatory exudation, bleeding and yellow staining in the chickens in group 2 at 3-5d p.i., with BBIX below 0.7 at 3d p.i., to fall to 0.24 at 5d p.i. (FIG. 3 b). In addition, the splenomegaly ratio of SHG19 infected chickens in group 2 was significantly higher than the control group, especially with a significant difference at 4d p.i. (fig. 3 c). Pathological section observation results show that the bursa of Fabricius of the infected chickens in the group 2 have obvious histopathological damage, starting from 1d p.i., the lymphocytes are reduced, macrophage infiltration is observed in the follicular, proliferation of fibrous tissues is observed around the follicular at 3d p.i., and severe atrophy of the follicular is observed at 5d p.i.; no lesions were found in the control group (fig. 3 d). These data demonstrate that the novel IBDV variant is highly pathogenic in chickens.

IBDV-specific antibodies were detected by ELISA 25 days after the concourse in chickens co-resident with the SHG 19-infected group (FIG. 4a), suggesting that horizontal transmission of novel IBDV variants occurred, the results of fluorescent quantitative RT-PCR 25 days after the concourse showed that the average titer of IBDV in bursa of Fabricius of the concourse chickens reached 7.9 × 10⁷viral RNAcopies/gram of tissue (FIG. 4b), further confirming the horizontal transmission of the novel IBDV variant. The results of 25 days post-mortem examination of the same chicken showed severe atrophy of the bursa of fabricius with an average BBIX of 0.29 (FIG. 4 c). Furthermore, the splenomes of the co-housed chickens were significantly lower than the control 25 days after co-housing (FIG. 4 d). This suggests that the novel IBDV variant may spread the infection by horizontal transmission.

2.4 immunosuppression of novel IBDV variant on chickens

To evaluate the immunosuppressive effect of IBDV variants on chickens, the effect of SHG19 on the immune efficacy of an avian influenza vaccine was examined after infection of SPF chickens with SHG 19. 16-day-old layers were infected with SHG19, and immunized against the avian influenza bivalent inactivated vaccine (H5+ H7) at 4d p.i.. At 14d post-immunization, sera were collected for Hemagglutination Inhibition (HI) antibody titers. The HI titers of 14d, H5(P <0.05) and H7(P <0.05) were significantly inhibited in the SHG 19-infected group after vaccination with avian influenza vaccine compared to the uninfected group (fig. 5).

2.5 immune protection evaluation results of IBDV super-virulent vaccine against novel IBDV variant

In order to evaluate the immune protection effect of the existing commercial vaccines on the novel IBDV variant, the present study detects the virus attack protection situation of three vaccines (attenuated Vaccine A, subunit Vaccine B and concatameric Vaccine C) against vvIBDV on the novel IBDV variant SHG 19. The results showed that all three vvIBDV vaccine immunization groups were seropositive for IBDV at 27 days of age (FIG. 6 a). At 28 days of age, three vvIBDV vaccine immunised groups were challenged with the IBDV novel variant SHG19, except group 5, which served as a blank control. Compared with a blank control group, the three immunity attacking groups show severe bursal damage at 5d p.i. and 10d p.i. and are marked by atrophy and yellow staining; the bursa of Fabricius in group 4 (non-immune challenge control) also exhibited severe atrophy and lesions similar to the immune challenge group (FIG. 6 d). The BBIX assay results also showed that the bursa of Fabricius of the three immuno-challenge groups were atrophic, the BBIX values at 5d p.i for the three groups of Vaccine A, Vaccine B, and Vaccine C were 0.453. + -. 0.188, 0.266. + -. 0.078, and 0.380. + -. 0.043, respectively, and the BBIX values at 10d p.i. were 0.606. + -. 0.114, 0.235. + -. 0.079, and 0.293. + -. 0.063, respectively (FIG. 6B). The fluorescent quantitative RT-PCR results also showed the presence of SHG19 was detected in diseased bursa of fabricius. In addition, spleen to body ratio results showed spleen swelling in Vaccine group C at 5d p.i. (figure 6C). Histopathological examination showed a decrease in bursa of fabricius lymphocytes, macrophage infiltration, follicular atrophy, and connective tissue proliferation in the three immunization groups compared to the control group at 5d p.i. (fig. 6 e). This indicates that the three vvIBDV vaccines have unsatisfactory challenge protection effect on IBDV novel variant SHG 19.

2.6 Cross-neutralization test results of novel IBDV variant and ultra-virulent serum

The antigenic association between a novel IBDV variant (SHG19) and a very virulent strain (Gx and HLJ0504) was explored by an in vitro serum cross-neutralization assay. The results of the study showed that the R value of the antigen correlation between the very virulent IBDV strain Gx and HLJ0504 was 1.05 (Table 4), indicating that there was no significant difference in antigenicity between the two. However, the R values of the IBDV novel variant SHG19 and Gx and HLJ0504 were 0.64 and 0.35 (Table 4), respectively, which indicates that SHG19 has a significant difference from the antigenicity of Gx and HLJ 0504.

The challenge protection test and the serum cross-neutralization test of the vaccine show that the antigenicity of the novel IBDV variant is obviously different from that of vvIBDV. The potential molecular basis was revealed by genomic alignment in this study. SHG19 showed a clear difference in both PP and VP1 compared to vvIBDV. In PP, the other 17 characteristic amino acids of SHG19 listed in FIG. 2C, except for

amino acid residues

253, 284, 299, 330, 451, 541, 981 and 1005, differ from vvIBDV, and these differences may be associated with antigenic variation. Of the 15 characteristic amino acids listed in FIG. 2C, VP1, 13 of SHG19 differed from vvIBDV, which may be associated with differences in virulence.

TABLE 4R values of the Cross-neutralization test of novel IBDV variants with superavirulent serum

Serum/strain	SHG19	Gx	HLJ0504
				SHG19	1.00
Gx	0.64	1.00
				HLJ0504	0.35	1.05	1.00

EXAMPLE 2 rescue and characterization of the novel IBDV variant reverse genetics vaccine Strain, rGtVarVP2

1. Materials and methods

1.1 plasmids and cells

Infectious clone plasmids pCAGGmtAHRT (CA 7 for short, Gt strain genome A segments with the two ends fused with a nuclease structure are cloned on pCAGGS plasmids) and pCAGGmGtBHRT (CBG 3 for short, Gt strain genome B segments with the two ends fused with a nuclease structure are cloned on pCAGGS plasmids) of IBDV attenuated strain Gt are constructed by the avian immunosuppressive disease team of Harbin veterinary research institute of Chinese agrology academy of sciences (hereinafter referred to as the laboratory). The DH5 alpha competent cell is a product of Beijing Tiangen Biochemical technology Co.

1.2 Main reagents and consumables

PrimeSTAR HS DNA polymerase and various restriction enzymes are products of Dalianbao bioengineering limited company; the gel recovery kit is an AxyPrep product; the plasmid extraction kit is a QIAGEN product; the homologous recombination kit is a product of Nanjing NuoZan Biotechnology Limited. The murine FITC fluorescent secondary antibody is a product of Shanghai Sigma Aldrich trade company Limited; monoclonal antibodies (7D4) against the IBDV VP2 protein were prepared in the laboratory. The fetal bovine serum is an AusBian product; EDTA-pancreatin digestive juice, penicillin two antibiotics for Harbin national biological science and technology products; DMEM, Opti-MEM, 1640, cell culture plates and cell culture flasks are Thermo Scientific products; the TransIT-X2 Dynamic Deliverysystem transfection reagent is a Mirusbio product.

1.3 design and Synthesis of primers

Based on the sequences of the plasmids CA7 and CBG3 and the sequence of the novel IBDV variant SHG19, primers required for construction of infectious clones of the reverse genetic vaccine strain of the novel IBDV variant were designed (Table 5). The primers were synthesized by Jilin province, Kuumei Biotechnology, Inc.

TABLE 5 primers required for infectious clone construction of vaccine strains

Primer and method for producing the same	Sequence (5 '-3')
		P1	AAAGAATTCGATCTCATCGATTGTTAAGCGTCTGAT
P2	GATCTTGCAGGTTTGTCATCGCTGCGATCGTTTGT
		P3	GACAAACGATCGCAGCGATGACAAACCTGCAAGATC
P4	GTCTTTGAAGCCGAATGCTCCTGCAATCTTC
		P5	GAAGATTGCAGGAGCATTCGGCTTCAAAGAC
P6	TAGCTCGAGCATGCCCGGGTACCCGCCCTCCCTTAGCC

1.4 construction of infectious clone of novel IBDV variant reverse genetic vaccine strain

The genome A segment infectious clone of the IBDV novel variant reverse genetic vaccine strain is constructed by adopting a homologous recombination technology. The method comprises the following specific steps:

amplifying target fragments F12 and F56 by taking a CA7 plasmid as a template and P1/P2 and P5/P6 as primers respectively, and carrying out reaction procedures: 5min at 95 ℃; 30s at 95 ℃, 30min at 56 ℃,20 s at 72 ℃ and 35 cycles; 10min at 72 ℃.

② amplifying VP2 gene of SHG19 strain, cloning it into pCAGGS plasmid to obtain recombinant plasmid pCASHG19VP 2.

③ using Dpn I mediated point mutation technology, using pCASHG19VP2 recombinant plasmid as template, and carrying out double-point mutation Q253H/A284T on VP2 gene of SHG19 strain. Using the plasmid after double-point mutation as a template and P3/P4 as primers to amplify the target fragment F34, and carrying out a reaction procedure: 5min at 95 ℃; 30s at 95 ℃, 30min at 56 ℃, 3min at 72 ℃ and 35 cycles; 10min at 72 ℃.

Fourthly, after the three overlapped PCR fragments F12, F56 and F34 are recovered by a glue recovery kit, fusion PCR is carried out, and the reaction is carried out in two steps. First, reaction system (without primer): see table 6; reaction procedure: 5min at 95 ℃; 30s at 95 ℃, 30min at 50 ℃, 1min at 72 ℃ and 12 cycles; 10min at 72 ℃. Secondly, 1 mu L of each primer P1/P6 is added into a reaction tube of the first PCR, and the temperature is 95 ℃ for 5 min; 30 cycles of 95 ℃ for 30s, 56 ℃ for 30min, 72 ℃ for 3 min; 10min at 72 ℃. The fusion PCR product is the recombinant Gt strain A segment which replaces the gene of SHG19 strain VP2, and is recovered by a gel recovery kit for later use.

Using Cla I and Kpn I to double-enzyme digest CA7 plasmid, using homologous recombination method to connect the fused recombinant A segment to the carrier, sending the recombinant plasmid to Jilin province, U.S. Biotechnology limited company for sequencing, and the correctly sequenced plasmid is named as pCAGtSHG19VP2 HRT. The recombinant A-segment infectious clone plasmid pCAGtSHG19VP2HRT and the Gt strain B-segment infectious clone plasmid pCAGGmGtBHTT are schematically shown in FIG. 7. The plasmid was extracted aseptically using QIAGEN plasmid extraction kit, and the concentration was diluted to 1. mu.g/. mu.L for use.

TABLE 6 fusion PCR reaction System

Reaction components	System of
		PrimerStar DNA Polymerase	1μL
5×Buffer	10μL
		dNTP	4μL
F12	1μL
		F56	1μL
F34	1μL
		ddH₂O	30μL
General System	48μL

1.5 rescue of novel IBDV variant reverse genetics vaccine Strain

The RNA polymerase II mediated IBDV reverse genetic operating system is used for saving IBDV novel variant reverse genetic vaccine strains. The method comprises the following specific steps:

the DF1 cells are subcultured in a 6-well plate and placed in a 5% CO2 cell culture box at 37 ℃. When the cells grew to 80% (about 12h after passage), the culture medium was discarded, the cells were washed three times with Opti-MEM, 1.5mL of fresh Opti-MEM culture medium was added to each well, and the wells were placed in a cell culture chamber for use.

② recombinant plasmids pCAGtSHG19VP2HRT and pCAGGmGtBHRT (concentration 1. mu.g/. mu.L, 2. mu.L of each plasmid) were added to 96. mu.L of Opti-MEM, and 12. mu.L of TransIT-X2 Dynamic Delivery system transfection reagent was added to 88. mu.L of Opti-MEM, each gently mixed and then allowed to stand for 5 min.

③ mixing and gently mixing the transfection reagent-containing Opti-MEM and the plasmid-containing Opti-MEM, and standing for 20min at room temperature.

Drop-by-drop adding the transfection liquid into the freshly treated DF1 cells, gently mixing the cells uniformly, and placing the cells in a cell culture box for continuous incubation; after 6h, the medium was discarded, the cells were washed three times with Opti-MEM, 2mL of DMEM containing 10% fetal bovine serum was added to each well, and the cells were placed in a cell incubator for further culture.

Fifthly, after 72 hours of transfection, the cells are repeatedly frozen and thawed for 3 times, the cell suspension is harvested, the cell suspension is centrifuged for 10min at 4 ℃ and 3000g, and the supernatant is taken to be continuously passaged on DF1 cells (no more than 5 generations) until cytopathic effect (CPE) is generated. In the transfection assay, a blank control (empty vector pCAGGS), a transfection reagent control and a normal cell control were set simultaneously.

Sixthly, harvesting cell suspension generating CPE, namely rescued recombinant virus, which is named as rGtVarVP2 and is placed in a refrigerator at minus 80 ℃ for standby.

1.6 identification of novel IBDV variant reverse genetic vaccine strains

1.6.1 Indirect Immunofluorescence (IFA) identification

Rescued IBDV was inoculated into DF1 cells, the cell culture was aspirated after 48h, the cells were washed 3 times with PBS, fixed with 4% formaldehyde for 30min, and then incubated with a monoclonal antibody against IBDV VP2 (1: 2000 dilution) for 1h at 37 ℃. The cells were subsequently washed 3 times with PBS and then incubated with FITC-labeled goat anti-mouse antibody (1: 200) at 37 ℃ for 1 hour in the dark. Finally, the cells were washed 3 times and the infection of the cells was observed using a fluorescence microscope.

1.6.2RT-PCR and sequencing identification

The IBDV genome A-segment was amplified in two sections (two RT-PCR products overlapping each other) using primers AU/A1542L and A1421U2/AL2 (Table 7); the IBDV genome B-segment was amplified in two segments (two RT-PCR products overlapping each other) using primers BU/B1344L and B1344U/BL (Table 7). The RT-PCR products are respectively cloned into pMD18-T vectors after being purified, and the recombinant plasmids are sent to Jilin province Cumei biotechnology limited for sequencing.

TABLE 7 primers for amplification of IBDV genomes

2. Results

The IBDV novel variant reverse genetic vaccine strain is successfully rescued and is named as rGtVarVP 2. Cell Pathology (CPE) of DF1 cells can be induced 48-60h after infection with rGtVarVP 2. The IFA detection result shows that the IBDV VP2 monoclonal antibody can recognize the virus and can detect green fluorescence (FIG. 8). The genome sequencing result shows that rGtVarVP2 is a recombinant IBDV with a framework of a low virulent strain Gt and VP2 replaced by a corresponding segment of a novel variant strain SHG19, and the SHG19VP2 of the recombinant IBDV is introduced with double-point mutations Q253H/A284T (the corresponding nucleotide mutations are A889C and G980A of an A segment) (FIG. 9).

The Gt strain is an IBDV attenuated vaccine strain; SHG19 is a representative strain of IBDV novel variant strain; VP2 is the main protective antigen of IBDV, and the introduction of the double-point mutation Q253H/A284T enables the propagation of recombinant strains on DF1 cells that would otherwise not be able to adapt to in vitro cell lines. Therefore, the rGtVarVP2 is a recombinant IBDV which takes a attenuated vaccine strain as a framework, has main protective antigen genes consistent with the novel IBDV variant strain, and can adapt to DF1 cell culture.

The obtained IBDV novel variant reverse genetic vaccine strain rGtVarVP2 is preserved in China General Microbiological Culture Collection center (CGMCC), the preservation number is CGMCC No.19383, and the preservation time is 3, 12 days in 2020.

EXAMPLE 3 evaluation of the immune Effect of the novel variant IBDV reverse genetics vaccine (rGtVarVP2 strain)

1. Materials and methods

1.1 Main reagents and consumables

The fetal bovine serum is an AusBian product; EDTA-pancreatin digestive juice, penicillin two antibiotics for Harbin national biological science and technology products; DMEM, Opti-MEM, 1640 culture medium and cell culture flasks are Thermo Scientific products. The IBDV antibody ELISA detection kit is purchased from IDEXX company; the multifunctional microplate reader is a product of PE company.

1.2 cells and viruses

DF1 cells and DT40 cells were maintained by the avian immunosuppressive disease team (hereinafter referred to as the laboratory) of Harbin veterinary institute of Chinese academy of agricultural sciences. Representative strain SHG19 of the novel IBDV variant was isolated and identified in the laboratory. A novel variant IBDV reverse genetics vaccine strain rGtVarVP2(CGMCC No.19383) was rescued and prepared as described in example 2.

1.3 test animals

Specific-pathogen-free (SPF) chickens were purchased from the laboratory animal center of Harbin veterinary institute, Chinese academy of agricultural sciences, and housed in negative pressure isolators at that center.

1.4 preparation of rGtVarVP2 Strain vaccine

DF1 cells are cultured in a cell culture bottle, when the cells are approximately 80 percent full, rGtVarVP2 is inoculated according to the quantity of 0.1MOI, the cells are adsorbed in a cell culture box at 37 ℃ for 1 hour, then cell maintenance fluid (DMEM culture medium containing 2 percent fetal calf serum) is supplemented, the cells are continuously placed in the cell culture box at 37 ℃ for culture, the cytopathic effect (CPE) condition is observed day by day, the cells are repeatedly frozen and thawed three times after 60 hours after inoculation, the collected cell suspension is rGtVarVP2 strain cytotoxin, the rGtVarVP2 which is expanded and propagated on DF1 cells is used for preparing the vaccine with the titer of 2.21 × 10, the titer of the vaccine is 2.21 ×⁷PFU/ml, no mycoplasma, no bacteria, no exogenous virus, good purity, split charging and storing in 80 deg.C refrigerator for use, IBDV new variant reverse genetic vaccine (rGtVarVP2 strain) antigen amount is about 2.2 × 10⁴PFU/plume.

1.5 animal test

32 1 day old SPF chickens were randomly divided into 3 groups, the 1 st group was a vaccine immunization group (n ═ 14), the 2 nd group was a non-immunization control group (n ═ 8), and the 3 rd group was a placebo group (n ═ 11). When 14 days old, the 1 st group of chickens immunize the vaccine rGtVarVP2 through a nose dropping and eye dropping way, and the dosage is 1 feather; group 2 identical volumes of PBS (200. mu.L/mouse). At 14d after immunization, collecting blood and separating serum of all chickens, and detecting IBDV serum antibody by using an avian infectious bursal disease virus antibody detection kit (IDEXX); at the same time, neutralizing antibodies in 14d serum after immunization were detected. And (5) carrying out a toxicity attack protection test 14d after immunization.

1.5.1 evaluation of safety

To test the safety of rGtVarVP2 against immunized chickens, 4 chickens were dissected at random from each of group 1 and group 3 at 14d after immunization (28 days old), body weight and Bursa weight were weighed, and Bursa weight ratio (Bursal of Fabricus weight/body weight ratio, F/B) and Bursa Index (BBIX) were calculated. F/B ═ (bursal weight/body weight) X1000; BBIX ═ test group chicken cyst ratio/blank control group chicken cyst ratio. The bursa of Fabricius was assessed comprehensively for lesions based on BBIX assays and pathology examinations. When IBBX is below 0.7, bursal atrophy is suggested. Meanwhile, a pathological section is prepared by fixing part of bursa of Fabricius with 10% formaldehyde solution for histopathological analysis.

1.5.2 detection of neutralizing antibodies

The neutralizing ability of immune chicken serum antibodies to SHG19 was tested on DT40 cells. Inactivating the serum to be detected in 56 deg.C water bath for 30min, and filtering for sterilization. The inactivated and sterilized serum to be detected is diluted 2 times by serum-free 1640 culture solution. SHG19 virus was diluted to 200TCID in serum-free 1640 medium₅₀And (4) virus liquid. Diluting the above 200 TCIDs₅₀The virus solution and the serum diluted by 2 times are respectively mixed in equal volume, then the mixture is put into an incubator at 37 ℃ for 1 hour, and the mixture is gently shaken and uniformly mixed once every 15 minutes during the period, so that the virus particles are fully contacted with the antibody in the serum. The culture medium in the 96-well culture plate fed with DT40 cells was aspirated completely, the mixed serum and virus mixture was added to each well, 100. mu.l was added to each well, and the mixture was cultured in a 5% CO2 cell culture chamber at 37 ℃ for 24 hours, and then the neutralization titer of the serum against SHG19 was calculated by detecting the neutralization of SHG19 by IBDV monoclonal antibody-mediated indirect immunofluorescence assay (IFA). And simultaneously setting negative and positive serum controls.

1.5.3 challenge protection test

The effectiveness of the vaccine was further evaluated using challenge-protection assays. When the chickens are 28 days old, the rest chickens in the 1 st group (n ═ 10) and the 2 nd group (n ═ 8) are detoxified by using SHG19 through eye drop and nose drop, and the dosage is 10BAD₅₀A/only. Clinical observation is carried out day by day after the toxin is attacked, and the disease condition is counted. All test chickens were dissected on day 7 (7d p.i.) after challenge, body weight and bursa weight were weighed, BBIX was calculated, and each group of chickens randomly selected 3 bursa partial tissues to be soaked in 10% formalin solution, and pathological analysis was performed after HE staining.

2. Results

2.1 vaccine safety evaluation results

At day 14 after the rGtVarVP2 vaccine immunization, 4 chickens were necropsied in each of the immunized group and the blank control group. As with the blank control group, the BBIX for the rgvatvp 2 vaccine immunized group was greater than 0.7 (fig. 10), and there was no lesion in bursa of fabricius. The results show that the IBDV novel variant reverse genetics vaccine (rGtVarVP2 strain) is safe.

2.2IBDV antibody titre assay results

On day 14 after the rGtVarVP2 vaccine immunization, higher IBDV serum ELISA antibodies (1497. + -. 836) were detected in the immunized group (FIG. 11 a); the serum was able to specifically neutralize the IBDV novel variant SHG19 with a neutralizing titer of 7. + -. 1.7 (FIG. 11 b). PBS control and blank control were negative. This indicates that the reverse genetics vaccine (rGtVarVP2 strain) immunization of the novel IBDV variant strain produces a good immune response.

2.3 protective Effect of vaccine against challenge

On day 14 after immunization, the challenge test with SHG19 was performed for the immunized group and the non-immunized control group. No obvious apparent clinical symptoms are found in all groups of chickens after challenge. 7d p.i. dissection, obviously shrinking bursa of Fabricius of all chickens in the non-immune group, wherein BBIX is less than 0.7; the bursa of Fabricius in the immunized group had no obvious lesions, and BBIX was greater than 0.7 (FIG. 12 a). Histopathological sections show atrophy of non-immune bursal follicles, reduction of massive necrosis of lymphocytes, and proliferation of connective tissues; there was no obvious abnormality in bursa of Fabricius in the immunized group and the normal control group (FIG. 12 b). This result indicates that the novel IBDV variant reverse genetics vaccine (rGtVarVP2 strain) is effective.

Claims

1. A reverse genetic vaccine strain of a novel variant strain of chicken infectious bursal disease virus is named as rGtVarVP2, and is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.19383 and the preservation time of 3, 12 and 2020.

2. A method for preparing the reverse genetic vaccine strain cytotoxicity of the novel chicken infectious bursal disease virus variant strain as claimed in claim 1, which comprises the following steps:

culturing DF1 cells in a cell culture bottle, inoculating the novel variant reverse genetic vaccine strain of the chicken infectious bursal disease virus of claim 1 when the cells are 75-85% full, adsorbing for 1h in a cell culture box at 37 ℃, then supplementing a cell maintenance solution, continuously culturing in the cell culture box at 37 ℃, observing the pathological changes of the cells day by day, repeatedly freezing and thawing the cells for three times after 60h, and collecting cell suspension, namely the cell virus of the novel variant reverse genetic vaccine strain of the chicken infectious bursal disease virus.

3. The method according to claim 2, wherein the novel variant strain of infectious bursal disease virus of chicken of claim 1 is inoculated with the reverse genetics vaccine strain at an MOI of 0.1.

4. The method of claim 2, wherein the cell maintenance solution is DMEM medium containing 2% v/v fetal bovine serum.

5. The use of the novel variant reverse genetics vaccine strain of chicken infectious bursal disease virus of claim 1 in the preparation of chicken infectious bursal disease vaccine.