CN110343670A - The virus attenuated strain of recombinant porcine pseudorabies of expression pig circular ring virus Cap protein gene, and its preparation method and application - Google Patents
The virus attenuated strain of recombinant porcine pseudorabies of expression pig circular ring virus Cap protein gene, and its preparation method and application Download PDFInfo
- Publication number
- CN110343670A CN110343670A CN201810301212.1A CN201810301212A CN110343670A CN 110343670 A CN110343670 A CN 110343670A CN 201810301212 A CN201810301212 A CN 201810301212A CN 110343670 A CN110343670 A CN 110343670A
- Authority
- CN
- China
- Prior art keywords
- virus
- group
- porcine pseudorabies
- antigen
- pig
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
- C12N2710/16721—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
- C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of virus attenuated strain of recombinant porcine pseudorabies, which has the immunogenicity of porcine pseudorabies virus antigen and the immunogenicity of pig circular ring virus antigen simultaneously.The vaccine composition of the virus attenuated strain preparation of the recombinant porcine pseudorabies can not only provide the complete protection to porcine pseudorabies virus and pig circular ring virus simultaneously；It can also be protected completely for the pig circular ring virus in different geographical source, and protecting effect is better than corresponding subunit vaccine.
Description
Technical field
The present invention relates to a kind of virus attenuated strains of recombinant porcine pseudorabies for expressing pig circular ring virus Cap protein gene, system
Preparation Method and the vaccine composition prepared using the recombinant virus, belong to veterinary biologics field.
Background technique
Pig circular ring virus (Porcine circovirus, PCV) belongs to circovirus section Circovirus, is so far
It was found that the smallest vertebrate viruse.PCV is divided into PCV1, PCV2 according to pathogenic, antigenic and nucleotide sequence difference
With tri- kinds of genotype of PCV3.Wherein PCV1 is widely present in swinery but to its no pathogenicity, genome length 1759bp.PCV2
With pathogenic, genome length is 1767bp or 1768bp.PCV3 is to separate simultaneously in the breeding difficulty case of pig recently
Confirm the pig circular ring virus of infective pathogen, genome length 2.0kb.
Porcine pseudorabies virus (Pseudorabies virus, PRV) mainly causes the serious nervous symptoms of pig, respiratory tract disease
Disease and dysgenesia.The pseudoabies of pig is widely present in China, and harm is serious, is the main epidemic disease for restricting large-scale pig farm production
One of disease.New feature has occurred in porcine pseudorabies popular recently, and outstanding behaviours is that the pig at any age can all infect, can be
Swinery horizontal transmission, incubation period is short (1~2 day), and disease incidence reaches as high as 100%, and the morbid pig death rate reaches as high as 100%,
It can cause pig high fever (40~42 DEG C, continue 3 days or more) after infection.It cannot be supported completely after the vaccine immunity pig of the prior art
Anti- wild poison attack, still will appear high fever, spiritual depressed, the symptoms such as loss of appetite or abolish, infection rate is more than 80%, disease incidence
More than 30%, the death rate is between 10%~20%.
Clinically, mixed infection situation is often presented in PCV2, PCV3 and PRV, so that epidemic situation be made to become more serious.State at present
The inside and outside vaccine that can control PCV2, PCV3, PRV infection simultaneously a kind of not yet, more can control nearest prevalence without a kind of simultaneously
PCV2, PCV3, new PRV infection vaccine, therefore, to cope with clinically news, urgent need provide it is a kind of can a needle solution
The vaccine of certainly these types of epidemic disease outburst.
Summary of the invention
To solve the above problems, the present invention is by the genetic recombination of pig circular ring virus Cap protein into the weak poison of porcine pseudorabies virus
Strain, the recombinant porcine pseudorabies Strain of building expression pig circular ring virus Cap protein gene.
The present invention provides a kind of virus attenuated strain of recombinant porcine pseudorabies, wherein the recombinant porcine pseudorabies virus is weak
Strain genome recombination has pig circular ring virus Cap protein, can express pig circular ring virus Cap protein, the pig circular ring virus Cap egg
White gene is porcine circovirus 2 type and/or 3 type Cap protein genes.
The virus attenuated strain of recombinant porcine pseudorabies of the invention can express pig circular ring virus Cap protein, therefore not only have
The immunogenicity of porcine pseudorabies virus antigen, also with the immunogenicity of pig circular ring virus antigen.
As one embodiment of the present invention, the pig in the virus attenuated strain source of recombinant porcine pseudorabies of the present invention is pseudo-
Hydrophobin low virulent strain is the low virulent strain of porcine pseudorabies virus variant.
As a kind of preferred embodiment of the invention, the low virulent strain of the porcine pseudorabies virus be HN1201 plants or
HN1202 plants of low virulent strain.
As a kind of more preferable embodiment of the invention, the porcine pseudorabies virus low virulent strain is HN1201-R plants.
As one embodiment of the present invention, in the virus attenuated strain of recombinant porcine pseudorabies of the invention, the pig circle
2 type Cap protein gene of circovirus virus is porcine circovirus 2 type new gene hypotype Cap protein gene.
It is described in the virus attenuated strain of recombinant porcine pseudorabies of the invention as a kind of preferred embodiment of the invention
Porcine circovirus 2 type new gene hypotype Cap protein gene is the pig circular ring virus 2 shown in SEQ ID.NO.1 or its degenerate sequence
Malicious 3 type Cap protein genes are shown in SEQ ID.NO.2 or its degenerate sequence.
The invention further relates to a kind of vaccine compositions, wherein the vaccine composition includes the above-mentioned recombination of immune amount
Porcine pseudorabies virus low virulent strain and freeze drying protectant.
Vaccine composition of the invention can provide the complete protection for porcine pseudorabies virus and pig circular ring virus, only exempt from
Epidemic disease once can provide protection completely for porcine pseudorabies virus and pig circular ring virus, and vaccine composition of the invention can be right
2 porcine circovirus a, 2b, 2d gene hypotype can effective protections.
Vaccine composition of the invention can not only provide protection completely for the pig circular ring virus in a variety of region sources, protect
Shield effect is also advantageous over corresponding pig circular ring virus subunit vaccine (virus sample particle vaccines): vaccine composition of the invention is not only
It provides within the 21st day after being immunized after immune for pig circular ring virus and protects completely, and corresponding pig circular ring virus subunit vaccine
(virus sample particle vaccines) provide protection completely in 28th day after immune, can inhibition earlier compared with pig circular ring virus subunit vaccine
The state of an illness；It is suitable with corresponding porcine pseudorabies virus attenuated vaccine for the protecting effect of porcine pseudorabies virus.
As one embodiment of the present invention, in vaccine composition of the present invention, the recombinant porcine pseudorabies
Virus attenuated strain content is >=106.0TCID50/ml。
As a kind of preferred embodiment of the invention, in vaccine composition of the present invention, the Recombinant Swine puppet is mad
The virus attenuated strain content of dog disease is 106.0TCID50/ml。
As one embodiment of the present invention, vaccine composition of the present invention further includes following antigen: swine fever virus
Antigen, porcine reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, mycoplasma hyopneumoniae antigen, pig parvoviral
Antigen, and/or Latex agglutination test antigen.
The virus attenuated strain of recombinant porcine pseudorabies of the invention can also collectively constitute epidemic disease with other one or more antigens
Seedling composition.For example, live vaccine of the invention can be resisted using to prepare including pig with other inactivation pathogen or antigen combination
The combined vaccine or combination vaccine of the various diseases of pseudorabies virus and Infection of Porcine circovirus.
Other viruses or viral antigen can be pathogen antigen living in the vaccine composition of the invention, be also possible to
Inactivate pathogen antigen or subunit antigen；When other antigenic components are inactivation pathogen antigen or subunit antigen, the present invention
The virus attenuated strain antigen component of the recombinant porcine pseudorabies with others inactivation pathogen antigens or subunit antigen can divide
Open preservation, storage or transport.
As a kind of preferred embodiment of the invention, vaccine composition of the present invention further includes following antigen: swine fever
Viral antigen, porcine reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, and/or mycoplasma hyopneumoniae antigen.
As a kind of preferred embodiment of the invention, vaccine composition of the present invention further includes adjuvant, the adjuvant
Including (1) aluminium glue adjuvant, saponin(e, Avridine, DDA；(2) water-in-oil emulsion, oil in water emulsion, W/O/W emulsion；Or
(3) polymer, maleic anhydride of acrylic or methacrylic acid and the copolymer of alkenyl derivative；And RIBI adjuvant
System, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli are intolerant to warmheartedness
One or more of toxin, cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant.
The adjuvant component further included in the vaccine composition of the invention can promote inactivation antigen and subunit anti-
Former immune efficacy.
The invention further relates to the vaccine compositions in preparation prevention pig circular ring virus and porcine pseudorabies virus infection
Drug in application.
The present invention uses pseudorabies variant for carrier for the first time, expression 3 type Cap protein base of pig circular ring virus new at present
Because and/or the new gene hypotype Cap protein gene of porcine circovirus 2 type, preparation and reorganization viral lived vaccine can not only be to pseudo- mad dog
Variant is protected, moreover it is possible to for 3 type of pig circular ring virus, different genes hypotype porcine circovirus 2 type and its their mixing
Infection is protected.Live vaccine of the present invention can provide effective protection for different PCV2 gene hypotypes and PCV3, expand
The application range of vaccine can prevent the independent infection and mixed infection of PCV2 different genes hypotype and PCV3.
Specific embodiment
Hereinafter, embodiments of the present invention will be described.
Pseudorabies variant
" pseudorabies variant " is also referred to as highly pathogenic pseudorabies strain, refers to: showing as the pig at any age all
It can infect, can be in swinery horizontal transmission, incubation period is short (1~2 day), and disease incidence reaches as high as 100%, morbid pig death rate highest
Up to 100%, pig high fever (40~42 DEG C, continue 3 days or more) can be caused after infection.
Preferably, the mad dog variant of puppet is the separated porcine pseudorabies virus variant, when reproduction institute
When stating the infection of porcine pseudorabies virus variant, still it will cause after the pseudo- mad dog attenuated vaccine of gene delection in the prior art has been immunized
There is high fever, spiritual depressed, the strain of loss of appetite or abolish symptom in pig.
Preferably, the mad dog variant of puppet is to be immunized when reappearing porcine pseudorabies virus variant infection
After the mad dog attenuated vaccine of puppet for lacking one in gE, TK and gI gene and more than one gene in the prior art, the pig according to
So infection porcine pseudorabies, and the porcine pseudorabies virus variant have have make 9-10 age in days piglet spirit it is depressed and food
The strain to be declined.
It is highly preferred that the mad dog variant of puppet of the present invention is porcine pseudorabies virus JS-2012 plants, pseudorabies HeN1
Strain, NVDC-PRV-BJ plants, NVDC-PRV-HEB plants and NVDC-PRV-SD plants, TJ plants of PRV, porcine pseudorabies virus variant
PRV-ZJ01, HN1201 plants of porcine pseudorabies virus variant, HN1202 plants of porcine pseudorabies virus variant.The above-mentioned mad dog variation of puppet
Strain all has good immunogenicity, can be used as the parent plant of vaccine strain.
JS-2012 plants of porcine pseudorabies virus strain be disclosed in it is immune after fall ill the separation and identification of Pseudorabies virus in piglet
[J] is virgin military, Zhang Qingzhan, Zheng Hao etc., Chinese zoonosis journal 2013,21 (3): 1-7)；It HeN1 plants of pseudorabies, protects
Hiding number is CGMCCNO.6656, is disclosed in patent application CN102994458A；NVDC-PRV-BJ plants, NVDCPRV-HEB plants and
NVDC-PRV-SD plants are disclosed in Pathogenic PseudorabiesVirus, Xiuling Yu, Zhi Zhou, Dongmei
Hu, et al.China, 2012EmergingInfectious Diseases, www.cdc.gov/eid ol.20, No.1,
January 2014；PRV TJ strain (PRV TJ) strain, is disclosed in Chun-Hua Wang, Jin Yuan, Hua-Yang
Qin, et al, A novel gE-deleted pseudorabies virus (PRV) provides rapid
andcomplete protection from lethal challenge with the PRV variant emerging in
In Bartha-K61-vaccinated swine population in China Vaccine 32 (2014) 3379-3385；
Porcine pseudorabies virus variant PRV-ZJ01, deposit number are CGMCC NO.8170, are disclosed in patent application
CN103627678A；HN1201 plants of porcine pseudorabies virus (Pseudorabies virus, strain HN1201), preservation are compiled
Number be CCTCC NO.V201311, be disclosed in patent application CN104004774A；HN1202 plants of porcine pseudorabies virus
(Pseudorabies virus, strain HN1202), deposit number are CCTCC NO.V201335, are disclosed in patent Shen
It please CN104328090A.
Pseudorabies variant low virulent strain
Pseudorabies variant low virulent strain is manually to cause to obtain after weak or cause is weak naturally using pseudorabies variant as parent plant
The strain of the reservation immunogenicity and bioactivity that arrive, remain the virulent parent plant of pseudorabies variant immunogenicity and
Self-reproduction ability, but toxicity substantially reduces.
Preferably, in live vaccine rPRV-Cap of the present invention, the PRV is porcine pseudorabies virus HN1201 plants
Tetra- gene delection weakening strain of gI, gE, 11K, 28K.
It is highly preferred that tetra- gene delection weakening strain of gI, gE, 11K, 28K of the present invention is nature Attenuation
HN1201-R plants.
Tetra- gene of gI, gE, 11K, 28K that HN1201 plants of porcine pseudorabies virus lacks HN1201-R plants of public affairs of weakening strain naturally
It opens in patent application CN105087506A.
Immune amount
" immune amount " should be understood as " immune effective dose ", also known as the effective quantity of immunoprotection amount or generation immune response,
For the amount of antigen that can effectively induce immune response in recipient's body, which is enough to prevent or improve the S or S of disease,
Including unfavorable health effect or its complication.The immune response may be sufficient to diagnostic purpose or other tests, or can
Can suitable for the sign or symptom of prevention disease, including caused by being infected as caused by pathogen unfavorable healthy result or
Its complication.Humoral immunity can be induced by cell-mediated immunity or this two.Animal is to IMMUNOGENIC COMPOSITION
The immune response of object can be for example, by measurement antibody titer, lymphocyte proliferation assays and indirect assessment, or with wild type poison
It is directly assessed after strain attack by monitoring sign or symptom, and measurement example can should be passed through by the protective immunity that vaccine provides
Such as the clinical symptom such as reduction of the death rate, disease incidence, temperature value, subject's general physiological state and the general health of subject
It is assessed with performance.The immune response may include but be not limited to inducing cell and/or humoral immunity.
3 type of pig circular ring virus
" 3 type of pig circular ring virus " is the circovirus of genome 2.0kb, with known circovirus either nucleotide
Or the homology of amino acid sequence is respectively less than 50%, is a kind of new pig circular ring virus, can be with a variety of cause of disease mixed infections
Cause the inflammatory reaction of the dermatitis nephrotic syndrome of pig, Hypertrophic necrotizing pneumonia, breeding difficulty and heart and multisystem.
Porcine circovirus 2 type new gene hypotype
" porcine circovirus 2 type new gene hypotype " refers to a kind of new PCV2 gene hypotype, exists in ORF2 gene prominent
It is recombinated between change or the ORF2 gene through different genes hypotype, the sequence label with PCV2b, but in phylogenetic analysis
One individual branches of middle composition, pig, which infects the Clinical signs occurred after the strain of the gene hypotype, to be had: duration high temperature, appetite
Decline, the depressed, coat of spirit are thick disorderly, the thin and speed of growth slows down, dissect occur different degrees of pulmonary consolidation, lymph enlargement,
Kidney has downright bad point.
Preferably, porcine circovirus 2 type new gene hypotype not only has for porcine circovirus 2 type new gene hypotype poison
The immunogenicity of strain, also retains the immunogenicity for porcine circovirus 2 type 2a, 2b, 2d hypotype.
Adjuvant
Adjuvant is nonspecific immunity strengthening agent, when injecting together with antigen or being previously implanted body, can enhance body
Immune response or change type of immune response to antigen.
The recombinant porcine pseudorabies poison of work according to the present invention is not necessarily required to this adjuvant to realize effect, but especially
The corresponding recombinant porcine pseudorabies poison comprising work according to the present invention and the antigenic object from another Causative virus or microorganism
The combination-vaccine of matter, by worth addition adjuvant.Adjuvant is the nonspecific stimulation agent of immune system, they enhance host to vaccine
Immune response.The example of adjuvant as known in the art be Freund completely and Freund's incomplete adjuvant, vitamin E, nonionic block
Polymer, muramyl dipeptide, ISCOMs (immune-stimulating complexes, see, for example European patent EP 1,099 42), saponin(e, mineral
Oil, vegetable oil and Carbopol.
Preferably, adjuvant includes (1) aluminium glue adjuvant, saponin(e, Avridine, DDA；(2) water-in-oil emulsion, oil-in-water cream
Agent, W/O/W emulsion；Or the polymer, maleic anhydride and alkenyl derivative of (3) acrylic or methacrylic acid
Copolymer；And RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine
One or more of adjuvant, E.coli LT, cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant.
Carrier pharmaceutically
Carrier pharmaceutically refers to the other compositions being added in vaccine composition, not stimulate body not hinder to use
The biological activity of compound and the carrier of characteristic or diluent.
For example, carrier pharmaceutically may include other examples of pharmaceutical acceptable carrier or diluent for use in the present invention
Including stabilizer, such as SPGA, carbohydrate (for example, sorbierite, mannitol, starch, sucrose, glucose, glucan), protein, such as
Albumin perhaps casein, the substance containing protein such as cow's serum or skimmed milk and buffer (for example, phosphate-buffered
Liquid).
Especially when vaccine is added in this stabilizer, vaccine is very suitable for being freeze-dried.Therefore, in the embodiment
In preferred form, live vaccine is the form of freeze-drying.
Combined vaccine and combination vaccine
Term used herein " combined vaccine " is used to refer to from recombinant virus of the invention and at least one different virus
Virus mixture preparation vaccine.
Term used herein " combination vaccine " refers to the vaccine prepared from virus and bacterium.For example, weight of the invention
Group virus can be mixed or be combined with swine fever virus, porcine reproductive and respiratory syndrome virus and/or haemophilus parasuis, mycoplasma.
Porcine pseudorabies virus infection
Porcine pseudorabies virus infection can refer to that the pig for showing as any age can all infect, can in swinery horizontal transmission,
Incubation period is short (1~2 day), and disease incidence is between 10%~100%, and (piglet is dead between 10%~100% for the morbid pig death rate
100%) rate of dying may be up to, can cause after infection pig high fever (40~42 DEG C, continue 3 days or more), expiratory dyspnea, diarrhea, asthma,
Cough, sneezing, hindlimb paralysis, dog sit, fall down to the ground suddenly, twitch, can not lie on one's side, opisthotonos, swimming shape strike, last failure and
Extremely, and herd boar semen quality can be caused to decline, farrowing sow is miscarried (up to 35%), premature labor, stillborn foetus, weak (weak young 14 days young
It is all dead before age) etc. breeding difficultys symptom, but not limited to this.Above-mentioned symptom and common pseudorabies have been infected in the prior art
The symptom difference generated after virus is: Adult Pig (weight is in 50kg or more pig) can cause after will cause infection after having infected
Pig high fever (40~42 DEG C, continue 3 days or more), expiratory dyspnea, diarrhea are breathed heavily, and are coughed, sneezing, hindlimb paralysis, and dog sits, and are dashed forward
It so falls down to the ground, twitches, can not lie on one's side, opisthotonos, swimming shape is struck, and is finally died of exhaustion；Piglet within newborn and 4 week old is unexpected
Morbidity, occurs large quantities of death, and the death rate is up to 90% or more；Morbidity piglet is mainly shown as that body temperature rises up to 41 DEG C or more, appetite
Abolish, with apparent nervous symptoms and diarrhea；Pre-and Post-Weaning Piglets are mainly Respiratory symptoms, performance expiratory dyspnea, cough
It coughs, have a running nose.
Infection of Porcine circovirus
Infection of Porcine circovirus can refer to as porcine circovirus 2 type and/or 3 types individually infect or mixed infection caused by disease
Disease.Porcine circovirus type 2 infection includes the infection of PCV2a, PCV2b, PCV2d, PCV2new gene hypotype.It is caused after infecting
Disease can include pmws, the dermatitis nephrotic syndrome of pig, Hypertrophic gangrenosum acne with nonexhaustive
The inflammatory reaction of pneumonia, breeding difficulty and heart and multisystem, but not limited to this.
The invention will now be further described with reference to specific embodiments, and the advantages and features of the present invention will be with description more
It is clear.But examples are merely exemplary for these, and it is not intended to limit the scope of the present invention in any way.Those skilled in the art
It should be understood that without departing from the spirit and scope of the invention can details to technical solution of the present invention and form carry out
Modifications or substitutions, but these modifications and replacement are fallen within the protection scope of the present invention.
Used chemical reagent is that analysis is pure in the embodiment of the present invention, is purchased from Chinese medicines group.
To keep the present invention easier to understand with reference to specific embodiments the present invention is further explained.It is of the present invention
Experimental method, if being conventional method without specified otherwise；The biomaterial, if without specified otherwise, it can be from business way
Diameter obtains.
The separation identification and the measurement of Cap protein gene of 1 porcine circovirus 2 type of embodiment
1, pathological material of disease source
, sporadicly there is the phenomenon that Sow abortion, the mummification of fetus increase in the pig farm of an immune commercialization PCV2 vaccine at home.
Impacted sow shows anorexia, related to PCV2 containing the mummified fetus of different gestational age in the nest of miscarriage
The symptom of miscarriage is consistent.By immunohistochemistry and quantitative PCR detection, PCV2 is positive.After immune PCV2 commercialized vaccine still
It detects that PCV2, cause value must go into seriously from morbidity porcine tissue, further to investigate thoroughly reason, chooses each tissue pathological material of disease and carry out cause of disease
Separation.
2, the separation and culture of Strain
DMEM culture solution is added with 1:10 (volume ratio) in pathological material of disease, grinding prepares tissue suspension；Tissue suspension is through repeatedly 3
After secondary freeze thawing, it is centrifuged 15min in 12000r/min, collects supernatant；Again through 0.22 μm of filter membrane filter, filtrate exists supernatant
It is passed on PK15 cell, in 37 DEG C of culture 1h, the DMEM culture solution for containing 2% calf serum is added in replacement, is cultivated 5 in 37 DEG C.
The culture solution containing virus is harvested, after 2 freeze thawing, harvest virus.
3, PCR and sequencing analysis identification virus
The viral cultures for taking above step to harvest extract the nucleic acid of viral sample with nucleic acid extraction kit, use
PCV2 specific primer carries out PCR amplification identification, the results show that PCR amplification goes out 1.7kb purpose band.PCR product send sequencing public
Department carries out nucleotide sequencing, and sequencing results carry out phylogenetic analysis.The Strain full-length genome sequence as the result is shown
Column are with it has been reported that the homology of other PCV2 crossed is less than 96%, and amino acid sequence is less than 94%, further full genome
Group sequence between PCV2b and PCV2d, in ORF2 gene analysis shows there is mutation or through different genes hypotype in the strain
It is recombinated between ORF2 gene, is determined through phylogenetic analysis, belong to a new PCV2 gene hypotype.
4, Cap protein gene magnification
Oligonucleotide primer is synthesized according to the conserved region sequence of Cap protein gene 5 ' and 3 ' ends, carries out PCR.Primer
Sequence is shown in Table 1.
1 carrying Cap gene of porcine circovirus type 2 gene magnification primer of table
| PCV2-Cap-F | CCCATGCCCTGAATTTCCA |
| PCV2-Cap-R | CAGCGCACTTCTTTCGTTTTCAG |
PCR product is sent to Invitrogen for sequencing, as the result is shown with the Cap protein amino of PCV2 in the prior art
Acid sequence is compared, and the amino acid sequence of Cap protein gene coding is in 52~64,106~108,131~137 generation bases
Because being mutated or recombinating, codon optimization is carried out to Cap protein gene according to sequencing result, the Cap protein gene order after optimization
As shown in sequence table SEQ ID NO.1.
The separation identification and the measurement of Cap protein gene of 2 pig circular ring virus of embodiment, 3 type
1, pathological material of disease source
There is the sow death rate and increases by 9.4% compared with history average in a commercialization pig farm at home, pregnancy rate drop
Low 1.2%, the phenomenon that the mummification of fetus increases by 8.2%.In clinical manifestation, impacted sow shows anorexia, in multifocal
Papule, the symptom of spot and surface dermatitis.Containing the mummified fetus of different gestational age in the nest of miscarriage, with PCV2 related streams
The symptom of production is consistent.Although the overall clinical performance and miscarriage symptom observed in sow cause with porcine circovirus 2 type
Breeding difficulty disease it is consistent, but different tissues of all sows, including kidney, lymph node, lung, skin and stillborn foetus, by exempting from
Epidemic disease group and quantitative PCR are feminine gender to PCV2, PRRSV, PPV, CSFV, mycoplasma hyopneumoniae detection.Further to investigate thoroughly original
Cause chooses each tissue pathological material of disease and carries out pathogen separation.
2, the separation and culture of Strain
DMEM culture solution is added with 1:10 (volume ratio) in pathological material of disease, grinding prepares tissue suspension；Tissue suspension is through repeatedly 3
After secondary freeze thawing, it is centrifuged 15min in 12000r/min, collects supernatant；Again through 0.22 μm of filter membrane filter, filtrate exists supernatant
It is passed on PK15 cell, in 37 DEG C of culture 1h, the DMEM culture solution for containing 2% calf serum is added in replacement, is cultivated 5 in 37 DEG C.
The culture solution containing virus is harvested, culture solution is after 2 freeze thawing, harvest virus.
3, PCR and sequencing analysis identify viral species
The viral cultures for taking above step extract the nucleic acid of viral sample with nucleic acid extraction kit, use annulus disease
Seed culture of viruses Genus-specific primers carry out PCR amplification identification, the results show that PCR amplification goes out 2000bp purpose band.PCR product send survey
Sequence company carries out nucleotide sequencing, and sequencing results carry out phylogenetic analysis.The Strain full genome as the result is shown
Group sequence and amino acid sequence are with it has been reported that the homology for other circovirus crossed is less than 50%, and according to international virus
The standard of the credit class committee, same virus should have the genome nucleotide sequence of > 75% in Circovirus
Homology, the homology of amino acid sequence of the Cap protein with > 70%, can affirm accordingly, it is a kind of new pig annulus
Virus, and the third circovirus found on pig body at present.
4, Cap protein gene magnification
Oligonucleotide primer is synthesized according to the conserved region sequence of Cap protein gene 5 ' and 3 ' ends, carries out PCR.Primer
Sequence is shown in Table 2.
2 pig circular ring virus of table, 3 type Cap protein gene magnification primer
| PCV3-Cap-F | CCA CAG AAG GCG CTA TGT C |
| PCV3-Cap-R | CCG CAT AAG GGT CGT CTT G |
PCR product is sent to Invitrogen for sequencing, it is excellent to carry out codon to Cap protein gene according to sequencing result
Change, the Cap protein gene order after optimization is as shown in sequence table SEQ ID NO.2.
The building of 3 carrying Cap gene of porcine circovirus type 2 genetic recombination porcine pseudorabies virus live vector of embodiment
1, the building of recombinant vector pUC-gIA-US2B-PCV2-Cap
Tetra- gene of gI, gE, 11K, 28K that HN1201 plants of porcine pseudorabies virus lacks weakening strain HN1201-R naturally, with
HN1201-R strain virus nucleic acid is template, respectively with gIF and gIR primer, US2F and US2R primer amplification gIA and US2B homology arm
Gene order is cloned on pUC19 carrier by digestion mode respectively, constructs recombinant vector pUC-gIA；By pUC-gIA and
US2B with connecting after SalI and HindIII digestion processing, obtains pUC-gIA-US2B respectively；
Using the isolated PCV2 genome of embodiment 1 as template, obtained with PCV2-Cap-F and PCV2-Cap-R primer amplification
The Porcine circovirus type 2 Cap gene that size is about 702bp is handled it with NheI and BamHI digestion, and through NheI and BamHI digestion
The pAc-GFP-C1 plasmid of processing connects, and obtains the Porcine circovirus type 2 Cap gene plasmid pAc-PCV2-Cap containing CMV promoter；With
PAc-PCV2-Cap plasmid is template, obtains the CMV-PCV2-Cap that size is about 1482bp with CMVF and SV40R primer amplification
It is handled with SmalI and SalIsI digestion, connect with the pUC-gIA-US2B of same digestion processing, identify through digestion by segment
Obtain pUC-gIA-US2B-PCV2-Cap plasmid.
Primer sequence is shown in Table 3.
3 construction of recombinant vector the primer of table
| CMVF | gcatGAAGAC gc gtcgTAGTTATTAATAGTAATCAATTACG |
| SV40R | cttctgtccgcaCTAGAATGCAGTGAAAAAAATGC |
| gIF | ccgGAATTCgcaggtggaccggctgctgaacgag |
| gIR | Cgc ggatcc Cttctg tacgacgccggtactgcggaggctacggaccg |
| US2F | Acgcgtcgac cttctgag tgcggacgcggtccgaccccacgg |
| US2R | CCC AAGCTT gacgaggaagaggaggacgaggaag |
2, the building of pCas9/gRNA gene knockout carrier
It is gIgRNAF and gIgRNAR primer sequence (being shown in Table 4) is artificial synthesized, and made annealing treatment, and with EcoRV enzyme
The connection of pCas9/gRNA carrier is cut, connection product converts competent escherichia coli cell DH5 α.Picking single bacterium colony is identified
Size is 190bp, is named as pCAS-gRNA-gI plasmid.
Table 4pCas9/gRNA gene knockout carrier constructs the primer
3, the acquisition of the Pseudorabies virus of genetic recombination containing Porcine circovirus type 2 Cap
According to 2000 specification of Lipofectamine, 3 μ g PRV HN1201-R strain virus genomes and 5 μ g pUC- are taken
GIA-US2B-PCV2-Cap, pCAS-gRNA-gI cotransfection Vero cell.When cytopathy reaches 90% after to be transfected, harvest
And purified, the recombinant virus for obtaining the gene containing Porcine circovirus type 2 Cap is named as rPRV-gI-/gE-/11K-/28K--PCV2-
Cap (abbreviation recombinant virus 1).
Through the pseudo- mad dog of recombination for obtaining insertion Porcine circovirus type 2 Cap gene known to PCR detection recombinant virus infection cell conditioned medium
Virus.
The building of 4 pig circular ring virus of embodiment, 3 type Cap protein genetic recombination porcine pseudorabies virus live vector
Using the isolated PCV3 genome of embodiment 2 as template, obtained with PCV3-Cap-F and PCV3-Cap-R primer amplification
The PCV3Cap protein gene that size is about 645bp is handled it with NheI and BamHI digestion, and through NheI and BamHI digestion
The pAc-GFP-C1 plasmid of processing connects, and obtains the PCV3Cap protein gene plasmid pAc-PCV3-Cap containing CMV promoter；With
PAc-PCV3-Cap plasmid is template, obtains the CMV-PCV3-Cap that size is about 1425bp with CMVF and SV40R primer amplification
It is handled with SmalI and SalIsI digestion, connect with the pUC-gIA-US2B of same digestion processing, identify through digestion by segment
Obtain pUC-gIA-US2B-PCV3-Cap plasmid.
According to 3 method of embodiment by PRV HN1201-R strain virus genome and pUC-gIA-US2B-PCV3-Cap,
The porcine pseudorabies virus of pCAS-gRNA-gI cotransfection Vero cell, building 3 type Cap protein gene of recombinant porcine circovirus is living
Carrier, the identified recombinant virus for obtaining the protein gene containing PCV3Cap are named as rPRV-gI-/gE-/11K-/28K--PCV3-
Cap (abbreviation recombinant virus 2).
The building of 5 porcine circovirus 2 type of embodiment, 3 type Cap protein genetic recombination porcine pseudorabies virus live vectors
Using the isolated PCV2 genome of embodiment 1 as template, obtained with PCV2-Cap-F and PCV2-Cap-R primer amplification
The Porcine circovirus type 2 Cap gene that size is about 702bp is handled it with NheI and BamHI digestion, and through NheI and BamHI digestion
The pAc-GFP-C1 plasmid of processing connects, and obtains the Porcine circovirus type 2 Cap gene plasmid pAc-PCV2-Cap containing CMV promoter；
Using the isolated PCV3 genome of embodiment 2 as template, obtained with PCV3-Cap-F and PCV3-Cap-R primer amplification
The PCV3Cap protein gene that size is about 645bp is handled its BsaI digestion, with the pAc-PCV2- handled through BamHI digestion
The connection of Cap plasmid, obtains Porcine circovirus type 2 Cap gene and PCV3Cap protein gene plasmid pAc-PCV2- containing CMV promoter
Cap-PCV3-Cap；
Using pAc-PCV2-Cap-PCV3-Cap plasmid as template, obtaining size with CMVF and SV40R primer amplification is about
It is handled with SmalI and SalIsI digestion, is handled with same digestion by the CMV-PCV2-Cap-PCV3-Cap segment of 2127bp
PUC-gIA-US2B connection, through digestion identify obtain pUC-gIA-US2B-PCV2-Cap-PCV3-Cap plasmid.
According to 3 method of embodiment by PRV HN1201-R strain virus genome and pUC-gIA-US2B-PCV2-Cap-
PCV3-Cap, pCAS-gRNA-gI cotransfection Vero cell, building porcine circovirus 2 type, 3 type Cap protein genetic recombination pigs are pseudo-
Hydrophobin live vector, identified recombinant virus of the acquisition containing PCV2, PCV3Cap protein gene are named as rPRV-gI-/gE-/
11K-/28K-- PCV2-Cap-PCV3-Cap (abbreviation recombinant virus 3).
The preparation of 6 porcine circovirus 2 type of embodiment, 3 type Cap protein virus sample particle vaccines
Send PCV2, PCV3Cap protein gene shown in sequence table SEQ ID NO.1, sequence table SEQ ID NO.2 to Soviet Union respectively
The biotech inc Zhou Hongxun carries out complete sequence synthesis, and is connected on pET28a plasmid.Plasmid after connection and
Molecular chaperones plasmid pG-Tf2 cotransformation e. coli bl21 (DE3) constructs E. coli expression strains pET28a-PCV2-
Cap/pG-Tf2/E.Coli BL21 (DE3), pET28a-PCV3-Cap/pG-Tf2/E.Coli BL21 (DE3), and carry out mesh
Solubility expression of protein.PCV2, PCV3Cap albumen of expression 60000 times of amplification factor, are observed by 200KV transmission electron microscope
Through 5% phosphotungstic acid negative staining, PCV2, PCV3 virus-like particle for being fixed on the copper mesh of spray carbon, a large amount of virus-like as the result is shown
Particle, and it is uniform in size, it is rendered as hollow granule state.
Water-soluble adjuvant is added slowly to after the Porcine circovirus type 2 Cap of above-mentioned preparation, PCV3Cap albumen are mixed in proportion
In Gel adjuvant (France match BIC Corp), with revolving speed it is constantly 800rpm mulser stirring 12min during adding, mixes.
The specific formula of PCV2, PCV3Cap prion sample particle vaccines is shown in Table 5.
Table 5PCV2, PCV3Cap prion sample particle vaccines proportion
| Component | Vaccine 1 | Vaccine 2 |
| PCV2-Cap albumen (μ g/ml) | 100 | - |
| PCV3-Cap albumen (μ g/ml) | - | 100 |
| Gel adjuvant (V/V%) | 10% | 10% |
The Study On Immunogenicity of 7 recombinant virus of embodiment
1, the part PCV2
28~30 ages in days are divided at random through the sodium selenite 40 of ELISA detection PRV, PCV2, PCV3 antigen, negative antibody
At 8 groups, 5/group.The recombinant virus 1 that 1st~2 group of immune embodiment 3 constructs, the recombination that the 3rd~4 group of immune embodiment 5 constructs
Vaccine 1 prepared by the immune embodiment 6 of the 3, the 5th~6 group of virus, the 7th~8 group not immune as attacking malicious control group.Recombinant virus is exempted from
Epidemic disease group injects 1ml/ and (contains 106.0TCID50), 1 immune group of vaccine injects 2ml/ head, attacks malicious control group inoculation DMEM culture medium
2ml/ head.1st group, the 3rd group, the 5th group it is immune after attack poison together with attacking the 7th group of malicious control group within 21st, the 2nd group, the 4th group, the 6th group is exempted from
Poison is attacked together with attacking the 8th group of malicious control group within 28 days after epidemic disease, attacking poison strain is porcine circovirus 2 type HH3 plants of (Porcine
Circovirus type 2, Strain HH3 are preserved in China typical culture collection center, and deposit number is CCTCC NO:
V201726, the deposit date is on June 4th, 2017, preservation address: Wuhan, China Wuhan University), attacking toxic dose is
105.0TCID50Each piglet is observed continuously after attacking poison in/head, according to each piglet clinical symptoms, pathological change and viral diagnosis result into
Row determines that concrete outcome is shown in Table 6, table 7.
PCV2 protest test result on the 21st after table 6 is immune
PCV2 protest test result on the 28th after table 7 is immune
The results show that after pig is immunized 100% protection can be obtained in 21st in recombinant virus, all pigs are not examined after attacking poison
Measure virus；2/5 pig viral diagnosis on the 21st is positive after pig is immunized in virus sample particle vaccines 1.Show that recombinant virus is immune
After pig, antibody is generated faster, compared with virus sample particle vaccines, provides the complete protection for being directed to PCV2 at least in advance 1 week.
2, the part PCV3
28~30 ages in days are divided at random through the sodium selenite 40 of ELISA detection PRV, PCV2, PCV3 antigen, negative antibody
At 8 groups, 5/group.The recombinant virus 2 that 9th~10 group of immune embodiment 4 constructs, what the 11st~12 group of immune embodiment 5 constructed
Malicious control group is attacked in vaccine 2 prepared by the 3, the 13rd~14 group of recombinant virus immune embodiment 6, the 15th~16 group of not immune conduct.Weight
Group virus immunity group injects 1ml/ and (contains 106.0TCID50), 2 immune group of vaccine injects 2ml/ head, attacks malicious control group inoculation DMEM
Culture medium 2ml/ head.9th group, the 11st group, the 13rd group it is immune after attack poison together with attacking the 15th group of malicious control group within 21st, the 10th group, the
12 groups, the 14th group it is immune after attack poison together with attacking the 16th group of malicious control group within 28th, attacking poison strain is SG plants of 3 type of pig circular ring virus
(Porcine Circovirus type 3, Strain SG, are preserved in China typical culture collection center, and deposit number is
CCTCC NO:V201712, the deposit date is on March 23rd, 2017, preservation address: Wuhan, China Wuhan University), attack toxic agent
Amount is 105.0TCID50Each piglet is observed continuously after attacking poison in/head, according to each piglet clinical symptoms, pathological change and viral diagnosis
As a result determined, concrete outcome is shown in Table 8, table 9.
PCV3 protest test result on the 21st is immunized in table 8
PCV3 protest test result on the 28th after table 9 is immune
The results show that after pig is immunized 100% protection can be obtained in 21st in recombinant virus, all pigs are not examined after attacking poison
Measure virus；2/5 pig viral diagnosis on the 21st is positive after pig is immunized in virus sample particle vaccines 2.Show that recombinant virus is immune
After pig, antibody is generated faster, compared with virus sample particle vaccines, provides the complete protection for being directed to PCV3 at least in advance 1 week.
3, the part PRV
9 ages in days are randomly divided into 10 through ELISA detection PRV, PCV2, PCV3 antigen, sodium selenite 50 of negative antibody
Group, 5/group.The recombinant virus 1 that 17th~18 group of immune embodiment 3 constructs, the weight that the 19th~20 group of immune embodiment 4 constructs
The recombinant virus 3 that the immune embodiment 5 of the 2, the 21st~22 group of group virus constructs, the 23rd~24 group of immune porcine pseudorabies virus
HN1201-R plants, malicious control group is attacked in the 25th~26 group of not immune conduct.Recombinant virus immune group is injected 1ml/ and (is contained
106.0TCID50), HN1201-R plants of immune groups inject 1ml/ and (contain 106.0TCID50), attack malicious control group inoculation DMEM culture medium
1ml/ head.17th group, the 19th group, the 21st group, the 23rd group it is immune after attack poison together with attacking the 25th group of malicious control group within 21st, the 18th group,
20th group, the 22nd group, the 24th group it is immune after attack poison together with attacking the 26th group of malicious control group within 28th, attacking poison strain is porcine pseudorabies disease
HN1201 plants malicious, attacking toxic dose is 107.0TCID50/ head is observed continuously clinical symptoms and death condition after attacking poison, the results are shown in Table
10, table 11 are attacked after poison and measure piglet body temperature daily and observe clinical symptoms.
PRV protest test result on the 21st after table 10 is immune
PRV protest test result on the 28th after table 11 is immune
The results show that after recombinant virus and HN1201-R plants of porcine pseudorabies virus immune piglets, either immune rear 21
Attack day poison or it is immune after attack poison within 28th, can blocking virus infection (clinical symptoms occur), 100% (5/ can be provided for piglet
5) it protects, and compares piglet and attack all death on the 5th after poison.After showing that pig is immunized in recombinant virus, immune well protect is shown
Shield, the foreign gene of recombination do not influence the immunogenicity of the low virulent strain in source.
8 recombinant virus broad spectrum activity protection test of embodiment
1, the part PCV2
28~30 ages in days are divided at random through the sodium selenite 75 of ELISA detection PRV, PCV2, PCV3 antigen, negative antibody
At 15 groups, 5/group.The recombinant virus 1 that 27th~31 group of immune embodiment 3 constructs, the 32nd~36 group of immune embodiment 5 construct
The 3, the 37th~41 group of recombinant virus it is not immune as attacking malicious control group.Recombinant virus immune group is injected 1ml/ and (is contained
106.0TCID50), attack malicious control group inoculation DMEM culture medium 1ml/ head.27th group, the 32nd group it is immune after 21 days together with attacking malicious control
The 37th group of group with attacking poison from HN06 plants of velogen strains of 2 porcine circovirus a gene hypotype of Henan, China separation recently, the 28th group,
33rd group is used the 2 porcine circovirus b gene separated recently from Jiangsu Province, China together with attacking the 38th group of malicious control group in immune latter 21 days
JS04 plants of velogen strains of hypotype attack poison, and the 29th group, the 34th group is used together with attacking the 39th group of malicious control group recently from China for immune latter 21 days
JL13 plant velogen strains of 2 porcine circovirus d gene hypotype of Jilin Province's separation attack poison, the 30th group, the 35th group it is immune afterwards 21 days together with
The 40th group of malicious control group is attacked with attacking recently from CQ14 plants of velogen strains of 2 porcine circovirus new gene hypotype that Chinese Chongqing City separates
Poison, the 31st group, the 36th group is used the pig annulus separated recently from Guangdong province, China together with attacking the 41st group of malicious control group in immune latter 21 days
GD15 plants of velogen strains of viral 2new gene hypotype attack poison, and attacking toxic dose is 105.0TCID50Each son is observed continuously after attacking poison in/head
Pig is determined that concrete outcome is shown in Table 12 according to each piglet clinical symptoms, pathological change and viral diagnosis result.
12 recombinant virus of table infects broad spectrum activity protection test result for PCV2
The results show that the 37th~41 group is attacked malicious control group and attacked after poison and occur 40.5 DEG C of body temperature raising or more in various degree,
Continue 3~5 days, appetite stimulator, the depressed, coat of spirit are thick disorderly, the thin and speed of growth slows down etc., and clinical symptoms, dissect occur
The pathological change that different degrees of pulmonary consolidation, lymph enlargement, kidney have necrosis to put, carries out PCR detection by each organs and tissues, can be again
It is separated to porcine circovirus 2 type virus；And the 27th~36 group of immune group attacks clinical symptoms without exception after poison, each histoorgan of dissect
Also without exception, PCR detection is carried out by each organs and tissues, shows PCV2 feminine gender.Show recombinant virus one provided by the invention
It is secondary 21 days immune, that is, it may make pig to attack poison for the porcine circovirus 2 type in different geographical source, different genes hypotype and be provided with
Effect, complete immunoprotection, and the PCV2 for attacking poison cannot be detected from each organs and tissues.
2, the part PCV3
28~30 ages in days are divided at random through the sodium selenite 75 of ELISA detection PRV, PCV2, PCV3 antigen, negative antibody
At 15 groups, 5/group.The recombinant virus 2 that 42nd~46 group of immune embodiment 4 constructs, the 47th~51 group of immune embodiment 5 construct
The 3, the 52nd~56 group of recombinant virus it is not immune as attacking malicious control group.Recombinant virus immune group is injected 1ml/ and (is contained
106.0TCID50), attack malicious control group inoculation DMEM culture medium 1ml/ head.42nd group, the 47th group it is immune after 21 days together with attacking malicious control
The 52nd group is organized with poison is attacked from pig circular ring virus HN12 plants of velogen strains of 3 type that Henan, China separates recently, the 43rd group, the 48th group is exempted from
The pig circular ring virus JS08 plants of velogen strains of 3 type separated recently from Jiangsu Province, China are used together with attacking the 53rd group of malicious control group within 21 days after epidemic disease
Poison is attacked, the 44th group, the 49th group is used the pig circle separated recently from Chinese Jilin Province together with attacking the 54th group of malicious control group in immune latter 21 days
Circovirus virus JL11 plants of velogen strains of 3 type attack poison, the 45th group, the 50th group it is immune after 21 days together with attack the 55th group of malicious control group with recently from
Pig circular ring virus CQ04 plant velogen strains of 3 type of Chongqing in China city separation attack poison, the 46th group, the 51st group it is immune afterwards 21 days together with attacking poison
The 56th group of control group, with poison is attacked from pig circular ring virus GD05 plants of velogen strains of 3 type that Guangdong province, China separates recently, it is equal to be attacked toxic dose
It is 105.0TCID50Each piglet is observed continuously after attacking poison in/head, according to each piglet clinical symptoms, pathological change and viral diagnosis result
Determined, concrete outcome is shown in Table 13.
13 recombinant virus of table infects broad spectrum activity protection test result for PCV3
The results show that the 52nd~56 group is attacked malicious control group and attacked after poison and occur 40.5 DEG C of body temperature raising or more in various degree,
Continue 3~5 days, appetite stimulator, the depressed, coat of spirit are thick disorderly, the thin and speed of growth slows down etc., and clinical symptoms, dissect occur
The pathological change that different degrees of pulmonary consolidation, lymph enlargement, kidney have necrosis to put, carries out PCR detection by each organs and tissues, can be again
It is separated to pig circular ring virus 3 type virus；And the 42nd~51 group of immune group attacks clinical symptoms without exception after poison, each histoorgan of dissect
Also without exception, PCR detection is carried out by each organs and tissues, shows PCV3 feminine gender.Show recombinant virus one provided by the invention
It is secondary to be immunized 21, that is, it may make pig to attack poison offer for 3 type of pig circular ring virus in different geographical source and be immunized effectively, completely
Protection, and the PCV3 for attacking poison cannot be detected from each organs and tissues.
The above results show that recombinant virus provided by the invention has the immunogenicity of wide spectrum, for popular pig annulus
The wild poison of viral 3 types, 2 types can provide protection completely.And after recombinant virus of the invention is immunized, even if wild virus infection is immune
Pig, will not development growth to pig, feed getting fat have an impact (viral diagnosis positive rate is 0).
9 recombinant virus mixed infection protection test of embodiment
9 ages in days are randomly divided into 7 through ELISA detection PRV, PCV2, PCV3 antigen, sodium selenite 35 of negative antibody
Group, 5/group.The recombinant virus 1 that 57th group of immune embodiment 3 constructs, the recombinant virus 2 that the 58th group of immune embodiment 4 constructs,
59th group is immunized the recombinant virus 3 that embodiment 5 constructs, vaccine 1 prepared by the 60th group of immune embodiment 6, the 61st group of immune implementation
Vaccine 2 prepared by example 6, the 62nd group porcine pseudorabies virus HN1201-R plants immune, and malicious control group is attacked in the 63rd group of not immune conduct.
Recombinant virus and HN1201-R plants of immune groups inject 1ml/ and (contain 106.0TCID50), vaccine 1 and 2 immune group of vaccine inject 2ml/
Head attacks malicious control group inoculation DMEM culture medium 2ml/ head.57th group and the 60th group it is immune after attack poison within 21st, attacking poison strain is that pig is pseudo-
HN1201 plants of hydrophobin and porcine circovirus 2 type HH3 plants of hybrid virus liquid；58th group and the 61st group is immunized rear attack for 21st
Poison, attacking poison strain is porcine pseudorabies virus HN1201 plants and SG plants of hybrid virus liquid of 3 type of pig circular ring virus；59th group and the 62nd
Poison was attacked together with attacking the 63rd group of malicious control group in 21st after group is immune, attacking poison strain is porcine pseudorabies virus HN1201 plants, pig annulus
HH3 plants of viral 2 type and SG plants of hybrid virus liquid of 3 type of pig circular ring virus；It is 10 that HN1201 plants, which are attacked toxic dose,7.0TCID50/ head, HH3
It is 10 that toxic dose is attacked in strain5.0TCID50/ head, it is 10 that SG plants, which are attacked toxic dose,5.0TCID50/ head；Attack after poison be observed continuously clinical symptoms and
Death condition is shown in Table 14, attacks after poison and measures piglet body temperature daily and observe clinical symptoms.
14 recombinant virus mixed infection protection test result of table
The results show that the 63rd group is attacked malicious control group and attacks all death on the 4th after poison；57th group, the 58th group, the 59th group of recombination disease
After the immune piglet of poison, attack poison within 21st after immune, can blocking virus infection (clinical symptoms do not occur), can be provided for piglet
100% (5/5) protection；And the 60th group, the 61st group, the 62nd group of immune group not can effectively prevent the mixed of PRV and PCV2 and/or PCV3
Infection is closed, still in morbidity or dead state.Show that recombinant virus primary immunization provided by the invention can be directed to pig
PRV, PCV2, PCV3, which combine, attacks effective, the complete immunoprotection of poison offer.
The above is only the preferred embodiment of the present invention, not does limitation in any form to the present invention, though
So the present invention is disclosed above with preferred embodiment, and however, it is not intended to limit the invention, any technology people for being familiar with this profession
Member, in the range of not departing from technical solution of the present invention, when the technology contents using the disclosure above make a little change or repair
Decorations are the equivalent embodiment of equivalent variations, but anything that does not depart from the technical scheme of the invention content, technology according to the present invention are real
Matter any simple modification, equivalent change and modification to the above embodiments, still fall within the range of technical solution of the present invention
It is interior.
SEQUENCE LISTING
<110>Pulaike Biological Engineering Co., Ltd.
<120>express pig circular ring virus Cap protein gene the virus attenuated strain of recombinant porcine pseudorabies, and preparation method thereof and
Using
<160> 2
<170> PatentIn version 3.3<211> 702
<210> 1
<211> 702
<212> DNA
<213>porcine circovirus 2 type new gene hypotype (Porcine Circovirus type 2, new subtype)
<400> 1
atgacctacc cgcgtcgtcg ttaccgtcgt cgtcgtcacc gtccgcgttc tcacctgggt 60
cagatcctgc gtcgtcgtcc gtggctggtt cacccgcgtc accgttaccg ttggcgtcgt 120
aaaaacggta tcttcaacac ccgtctgtct cgttctttcg gttacaccgt tgttacctct 180
accgttaccc cgccgtcttg ggctgttgac atgatgcgtt tcaacatcaa cgacttcctg 240
ccgccgggtg gtggttctaa cccgcgttct gttccgttcg aatactaccg tatccgtaaa 300
gttaaagttg aattcttcgc tcgttctccg atcacccagg gtgaccgtgg tgttggttct 360
tctgctgtta tcctggacga caacttcgtt aacaaaacca acgctctgtc ttacgacccg 420
tacgttaact actcttctcg tcacaccatc acccagccgt tctcttacca ctctcgttac 480
ttcaccccga aaccggttct ggactctacc atcgactact tccagccgaa caacaaacgt 540
aaccagctgt ggctgcgtct gcagaccacc ggtaacgttg accacgttgg tctgggtacc 600
gctttcgaac actctatcta cgaccaggct tacaacatcc gtgttaccat gtacgttcag 660
ttccgtgaat tcaacctgaa agacccgccg ctgaacccgt aa 702
<210> 2
<211> 645
<212> DNA
<213>3 type of pig circular ring virus (Porcine Circovirus type 3)
<400> 2
atgcgtcacc gtgctatctt ccgtcgtcgt ccgcgtccgc gtcgtcgtcg tcgtcaccgt 60
cgtcgttacg ctcgtcgtaa actgttcatc cgtcgtccga ccgctggtac ctactacacc 120
aaaaaatact ctaccatgaa cgttatctct gttggtaccc cgcagaacaa caaaccgtgg 180
cacgctaacc acttcatcac ccgtctgaac gaatgggaaa ccgctatctc tttcgaatac 240
tacaaaatcc tgaaaatgaa agttaccctg tctccggtta tctctccggc tcagcagacc 300
aaaaccatgt tcggtcacac cgctatcgac ctggacggtg cttggaccac caacacctgg 360
ctgcaggacg acccgtacgc tgaatcttct acccgtaaag ttatgacctc taaaaaaaaa 420
cactctcgtt acttcacccc gaaaccgctg ctggctggta ccacctctgc tcacccgggt 480
cagtctctgt ctttcttctc tcgtccgacc ccgtggctga acacctacga cccgaccgtt 540
cagtggggtg ctctgctgtg gtctatctac gttccggaaa aaaccggtat gaccgacttc 600
tacggtacca aagaagtttg gatccgttac aaatctgttc tgtaa 645
Claims (10)
1. a kind of virus attenuated strain of recombinant porcine pseudorabies, wherein the virus attenuated pnca gene group weight of recombinant porcine pseudorabies
Group has pig circular ring virus Cap protein, can express pig circular ring virus Cap protein, and the pig circular ring virus Cap protein gene is pig circle
2 type of circovirus virus and/or 3 type Cap protein genes.
2. the virus attenuated strain of recombinant porcine pseudorabies according to claim 1, wherein the recombinant porcine pseudorabies virus
The porcine pseudorabies virus low virulent strain in low virulent strain source is the low virulent strain of porcine pseudorabies virus variant；Preferably, the pig
The low virulent strain that pseudorabies virus low virulent strain is HN1201 plants or HN1202 plants；It is highly preferred that the porcine pseudorabies virus is weak
Strain is HN1201-R plants.
3. the virus attenuated strain of recombinant porcine pseudorabies according to claim 1, wherein the porcine circovirus 2 type Cap egg
White gene is porcine circovirus 2 type new gene hypotype Cap protein gene.
4. the virus attenuated strain of recombinant porcine pseudorabies according to claim 3, wherein the porcine circovirus 2 type new base
Because subtype C ap protein gene is shown in SEQ ID.NO.1 or its degenerate sequence.
5. the virus attenuated strain of recombinant porcine pseudorabies according to claim 1, wherein the 3 type Cap egg of pig circular ring virus
White gene is shown in SEQ ID.NO.2 or its degenerate sequence.
6. a kind of vaccine composition, wherein the vaccine composition includes that the Claims 1 to 5 of immune amount is described in any item
The virus attenuated strain of recombinant porcine pseudorabies and freeze drying protectant.
7. vaccine composition according to claim 6, wherein the virus attenuated strain content of the recombinant porcine pseudorabies is
≥106.0TCID50/ml；Preferably, the virus attenuated strain content of the recombinant porcine pseudorabies is 106.0TCID50/ml。
8. vaccine composition according to claim 6, wherein the vaccine composition further includes following antigen: hog cholera
Malicious antigen, porcine reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, mycoplasma hyopneumoniae antigen, the tiny disease of pig
Malicious antigen, and/or Latex agglutination test antigen；Preferably, the vaccine composition further includes following antigen: swine fever virus is anti-
Original, porcine reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, and/or mycoplasma hyopneumoniae antigen.
9. vaccine composition according to claim 8, wherein the vaccine composition further includes adjuvant；The adjuvant packet
Include (1) aluminium glue adjuvant, saponin(e, Avridine, DDA；(2) water-in-oil emulsion, oil in water emulsion, W/O/W emulsion；Or (3)
The copolymer of the polymer of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative；And RIBI adjuvant system
System, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli are intolerant to warmheartedness poison
One or more of element, cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant.
10. according to the described in any item vaccine compositions of claim 6~9 in preparation prevention pig circular ring virus and porcine pseudorabies
Application in the drug of virus infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810301212.1A CN110343670B (en) | 2018-04-04 | 2018-04-04 | Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810301212.1A CN110343670B (en) | 2018-04-04 | 2018-04-04 | Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110343670A true CN110343670A (en) | 2019-10-18 |
| CN110343670B CN110343670B (en) | 2022-08-30 |
Family
ID=68172814
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810301212.1A Active CN110343670B (en) | 2018-04-04 | 2018-04-04 | Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110343670B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115976108A (en) * | 2023-01-10 | 2023-04-18 | 四川农业大学 | Recombinant pseudorabies virus vector for expressing PCV2 and PCV3Cap proteins, construction method and application |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358182A (en) * | 2007-07-31 | 2009-02-04 | 中国农业科学院哈尔滨兽医研究所 | Recombinant baculovirus strain of porcine circovirus type 2 Cap protein expression, construction method and application thereof |
| CN101457215A (en) * | 2008-12-01 | 2009-06-17 | 华中农业大学 | Recombinant porcine pseudorabies virus-porcine propagate and breath complex virus-porcine circovirus genetic engineering strain and application |
| US20120164170A1 (en) * | 2010-12-22 | 2012-06-28 | Tsun-Yung Kuo | Porcine Circovirus Type 2 (PCV2), Immunogenic Composition Containing the Same, Test Kit, and Application Thereof |
| CN102618508A (en) * | 2012-04-09 | 2012-08-01 | 浙江省农业科学院 | Recombinant porcine pseudorabies virus, as well as construction method and application thereof |
| CN103920146A (en) * | 2013-01-14 | 2014-07-16 | 普莱柯生物工程股份有限公司 | Porcine circovirus II type-porcine pseudorabies double-combination vaccine, and preparation methods and application thereof |
| US20140322267A1 (en) * | 2013-04-30 | 2014-10-30 | Boehringer Ingelheim Vetmedica, Inc. | Orf2 protein of pcv2 subtype a (pcv2a) for use in cross-protection |
-
2018
- 2018-04-04 CN CN201810301212.1A patent/CN110343670B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358182A (en) * | 2007-07-31 | 2009-02-04 | 中国农业科学院哈尔滨兽医研究所 | Recombinant baculovirus strain of porcine circovirus type 2 Cap protein expression, construction method and application thereof |
| CN101457215A (en) * | 2008-12-01 | 2009-06-17 | 华中农业大学 | Recombinant porcine pseudorabies virus-porcine propagate and breath complex virus-porcine circovirus genetic engineering strain and application |
| US20120164170A1 (en) * | 2010-12-22 | 2012-06-28 | Tsun-Yung Kuo | Porcine Circovirus Type 2 (PCV2), Immunogenic Composition Containing the Same, Test Kit, and Application Thereof |
| CN102618508A (en) * | 2012-04-09 | 2012-08-01 | 浙江省农业科学院 | Recombinant porcine pseudorabies virus, as well as construction method and application thereof |
| CN103920146A (en) * | 2013-01-14 | 2014-07-16 | 普莱柯生物工程股份有限公司 | Porcine circovirus II type-porcine pseudorabies double-combination vaccine, and preparation methods and application thereof |
| US20140322267A1 (en) * | 2013-04-30 | 2014-10-30 | Boehringer Ingelheim Vetmedica, Inc. | Orf2 protein of pcv2 subtype a (pcv2a) for use in cross-protection |
Non-Patent Citations (2)
| Title |
|---|
| XING LIU ET AL.: ""Phylogenetic analysis of porcine circovirus type 2 (PCV2) isolates from China with high homology to PCV2c"", 《ARCH VIROL》 * |
| 马萍 等: ""猪圆环病毒基因及其疫苗的研究进展"", 《猪业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115976108A (en) * | 2023-01-10 | 2023-04-18 | 四川农业大学 | Recombinant pseudorabies virus vector for expressing PCV2 and PCV3Cap proteins, construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110343670B (en) | 2022-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104862286B (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application | |
| CN103122352B (en) | Porcine circovirus II-type recombinant baculovirus as well as preparation method and application thereof | |
| TWI508974B (en) | Porcine circovirus type 2, immunogenic composition containing the same, test kit, and application thereof | |
| CN110387355A (en) | Express recombinant porcine pseudorabies Strain, the vaccine and its preparation method and application of pig circular ring virus Cap protein gene | |
| CN106148287B (en) | Porcine epidemic diarrhea virus strain and vaccine composition, preparation method and application thereof | |
| CN109125719A (en) | It is a kind of containing 3 type of pig circular ring virus, the immunogenic composition of porcine circovirus 2 type antigen and its application | |
| CN108220248B (en) | Porcine rotavirus strain, vaccine composition, preparation method and application thereof | |
| CN108126191A (en) | A kind of vaccine composition and its preparation method and application | |
| CN111560355A (en) | Porcine pseudorabies virus weakening method, porcine pseudorabies virus weakening virus strain, porcine pseudorabies virus vaccine composition and application of porcine pseudorabies virus weakening virus strain | |
| CN108653724A (en) | It is a kind of for prevent fowl egg drop syndrome vaccine composition, and its preparation method and application | |
| CN105018433B (en) | Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application | |
| CN111876391A (en) | Feline panleukopenia virus FPV BJ05 strain and application thereof | |
| CN106267182A (en) | The preparation method of a kind of porcine pseudorabies virus subunit vaccine and vaccine combination and application | |
| CN108653725A (en) | It is a kind of for prevent fowl egg drop syndrome vaccine composition, and its preparation method and application | |
| JP2020537651A (en) | Recombinant expression of PCV2b ORF2 protein in insect cells | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN102660578B (en) | PCV2 immunogenic composition and the method producing this compositions | |
| JP2022527627A (en) | Type 3 porcine circovirus (PCV3) vaccine, as well as its preparation and use | |
| CN108251382B (en) | Porcine pseudorabies virus weakening method, porcine pseudorabies virus weakening virus strain, porcine pseudorabies virus vaccine composition and application of porcine pseudorabies virus weakening virus strain | |
| CN108135993B (en) | Pestivirus vaccine for congenital tremor | |
| CN111635890A (en) | Dog parvovirus new CPV-2b strain and application thereof | |
| CN108785667A (en) | A kind of 3 type immunogenic composition of pig circular ring virus, preparation method and application | |
| CN101235363B (en) | Pig transmissible gastroenteritis virus vaccine strain and application thereof | |
| CN112294953A (en) | PCV2 type baculovirus vector, mycoplasma hyopneumoniae and haemophilus parasuis triple inactivated vaccine and preparation method thereof | |
| CN110343670A (en) | The virus attenuated strain of recombinant porcine pseudorabies of expression pig circular ring virus Cap protein gene, and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |