CN109125719B - Immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof - Google Patents
Immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof Download PDFInfo
- Publication number
- CN109125719B CN109125719B CN201710464584.1A CN201710464584A CN109125719B CN 109125719 B CN109125719 B CN 109125719B CN 201710464584 A CN201710464584 A CN 201710464584A CN 109125719 B CN109125719 B CN 109125719B
- Authority
- CN
- China
- Prior art keywords
- porcine circovirus
- circovirus type
- immunogenic composition
- type
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
- C07K14/01—DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/10011—Circoviridae
- C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Abstract
The invention relates to an immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens, wherein the immunogenic composition comprises an immunizing amount of porcine circovirus type 3 antigens, an immunizing amount of porcine circovirus type 2new gene subtype antigens and a pharmaceutically acceptable carrier. The immunogenic composition has good immunogenicity, and mixed infection of porcine circovirus type 3 and porcine circovirus type 2 can be completely protected by one-time immunization.
Description
Technical Field
The invention belongs to the field of veterinary medicines, and particularly relates to an immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof.
Background
Porcine Circovirus (PCV) is a single-stranded circular DNA virus with a genome length of approximately 1.7kb that is one of the smallest animal DNA viruses. Two types of PCV have been identified, porcine circovirus type 1 (PCV1) and porcine circovirus type 2 (PCV 2). PCV1 was first identified in 1974 as a contaminant in PK cell cultures, which was not pathogenic to pigs. PCV2 was first reported in 1998 to cause Porcine circovirus-associated diseases (PCVAD) in pigs under clinical conditions, mainly causing postweaning multisystemic wasting syndrome, pneumonia, Porcine dermatitis and nephropathy syndrome and reproductive disorders, mainly manifested as respiratory, urinary, intestinal, lymphatic, cardiovascular, neurological, reproductive and cutaneous dysfunction, causing significant economic losses to live pig breeding worldwide.
Clinically, with the widespread application of PCV2 vaccines, the mutation rate of PCV2 is accelerated under the immunological pressure, a new gene subtype strain between PCV2b and PCV2d begins to prevail, and the virus is characterized in that ORF2 gene has mutation or is recombined from ORF2 genes of different gene subtypes. Due to the prevalence of the new PCV2 gene subtype strain, the antigen of the new PCV2 gene subtype strain is different from the existing gene subtype strain, but the existing commercial vaccines are all prepared by taking PCV2a or PCV2b as vaccine strains, and the newly prevalent PCV2 strain cannot be completely protected.
In the case of reproductive failure of a pig, a circovirus with a 2.0kb viral genome is isolated, and subsequent experiments prove that the circovirus has less than 50 percent homology with the known circovirus in nucleotide and amino acid sequences, and the virus of the same species in the genus of the circovirus has more than 75 percent of genomic nucleotide sequence homology and the Cap protein has more than 70 percent of amino acid sequence homology according to the standard of the International Committee for taxonomic Classification of virology, so that the virus is a new porcine circovirus (PCV 3).
The systemic disease caused by PCV2 was already sporadic early in 1985, leading to massive outbreaks in the end of the nineties due to failure to appreciate, while the new porcine circovirus has similar etiological properties to PCV2 in terms of PNDS and reproductive disorders, with very low protein homology between PCV2 and PCV3, and cross-protection with PCV2 vaccine failed to effectively prevent PCV 3.
The new mixed infection of the porcine circovirus and the PCV2 further aggravates the clinical PCV infection complex situation, so that the preparation of a new immunogenic composition aiming at the new clinical epidemic situation is very important for controlling the diseases in the pig farm.
Disclosure of Invention
In order to solve the defects of the prior art, the invention provides an immunogenic composition for preventing and/or treating porcine circovirus mixed infection, which can effectively protect the porcine circovirus type 2 and type 3 mixed infection and shows remarkable immune characteristics.
An object of the present invention is to provide an immunogenic composition for the prevention and/or treatment of mixed infections with different porcine circoviruses, said immunogenic composition comprising an immunogenic amount of porcine circovirus type 3 antigen, an immunogenic amount of porcine circovirus type 2 antigen and a pharmaceutically acceptable carrier.
An object of the present invention is to provide an immunogenic composition for preventing and/or treating a mixed infection of porcine circovirus type 2 and porcine circovirus type 3 of different gene subtypes.
The invention aims to provide an immunogenic composition for preventing and/or treating porcine circovirus type 2 and porcine circovirus type 3 mixed infection of different regional sources.
The invention aims to provide application of the immunogenic composition in preparing a medicament for preventing and/or treating diseases related to porcine circovirus.
The invention adopts the prior new porcine circovirus type 3 immunogenic protein antigen and the porcine circovirus type 2new gene subtype strain immunogenic protein antigen for the first time to prepare the immunogenic composition for preventing and/or treating the infection of the porcine circovirus, not only can carry out immune protection on the infection or mixed infection of the porcine circovirus type 2 and the porcine circovirus type 3, but also can carry out protection on the porcine circovirus type 2 strains with different gene subtypes.
The immunogenic composition can provide complete protection for mixed infection of porcine circovirus type 3 strains and porcine circovirus type 2 strains from different regional sources, and has broad-spectrum protection capability.
Detailed Description
Hereinafter, embodiments of the present invention will be described.
The porcine circovirus type 3 is a circovirus with a genome of 2.0kb, has homology of less than 50 percent with known circovirus, namely nucleotide or amino acid sequences, is a novel porcine circovirus, and can cause dermatitis nephrotic syndrome, proliferative necrotizing pneumonia, reproductive failure and inflammatory reaction of heart and multiple systems of pigs by mixed infection with various pathogens.
"porcine circovirus type 2new gene subtype" refers to a new PCV2 gene subtype, which has a mutation in ORF2 gene or is recombined from ORF2 gene of different gene subtypes, has PCV2b tag sequence, but constitutes an independent branch in genetic evolution analysis, and has clinical characteristics after pig is infected with only strain of the gene subtype: persistent high temperature, anorexia, mental depression, coarse and disordered hair, emaciation and slow growth speed, and lung consolidation, lymphadenectasis and kidney necrosis.
The invention relates to an immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens, wherein the immunogenic composition comprises an immunizing dose of porcine circovirus type 3 Cap protein antigen, an immunizing dose of porcine circovirus type 2new gene subtype Cap protein antigen and a pharmaceutically acceptable carrier; the porcine circovirus type 3 Cap protein antigen is porcine circovirus type 3 Cap protein or a live vector recombined with the porcine circovirus type 3 Cap protein gene, and the porcine circovirus type 2new gene subtype Cap protein antigen is porcine circovirus type 2new gene subtype Cap protein or a live vector recombined with the porcine circovirus type 2 Cap protein gene.
The immunogenic composition of the invention can completely protect the antigen components against respective pathogens after one-time immunization, and protect pigs from mixed infection of porcine circovirus type 3 and porcine circovirus type 2.
The immunogenic composition can generate complete protection against the mixed infection of the porcine circovirus type 3 and the porcine circovirus type 2 with different gene subtypes.
The immunogenic composition can protect the pig from completely protecting the mixed infection of the porcine circovirus type 3 virus and the porcine circovirus type 2 virus from different regional sources.
The term "immunogenic composition" refers to a pharmaceutical composition comprising porcine circovirus type 3, porcine circovirus type 2 immunogenicity that induces, stimulates or enhances an immune response in a pig against porcine circovirus type 3, porcine circovirus type 2 virus only.
The term "immunizing amount" shall be understood as an "immunologically effective amount," also referred to as an immunoprotective amount or an amount effective to produce an immune response, of antigen effective to induce an immune response in a recipient, sufficient to prevent or ameliorate the signs or symptoms of disease, including adverse health effects or complications thereof. The immune response may be sufficient for diagnostic purposes or other testing, or may be suitable for use in preventing signs or symptoms of disease, including adverse health consequences or complications thereof caused by infection by a pathogen. Humoral immunity or cell-mediated immunity or both can be induced. The immune response of an animal to an immunogenic composition can be assessed indirectly, for example, by measuring antibody titers, lymphocyte proliferation assays, or directly by monitoring signs or symptoms after challenge with a wild-type strain, while the protective immunity provided by an immunogenic composition can be assessed by measuring, for example, clinical signs of the test animal, such as a decrease in healthy parity, an increase in the number of stillbirths, the overall physiological condition of the test animal, and overall health and performance. The immune response may include, but is not limited to, induction of cellular and/or humoral immunity.
The porcine circovirus type 3 Cap protein antigen and the porcine circovirus type 2 Cap protein antigen can be recombinant expression Cap protein subunit antigens, and expression systems thereof can be prokaryotic expression systems, eukaryotic expression systems, and synthetic peptide antigens artificially synthesized; or can be a live vector recombined with the porcine circovirus Cap protein gene.
"subunit antigen" refers to an antigen produced by cloning a protective antigen gene of a pathogen into a prokaryotic or eukaryotic expression system by genetic engineering and expressing it efficiently. It is less likely to cause side reactions than whole virus antigens.
"synthetic peptide antigen" refers to a small peptide containing only an immunodeterminant component, i.e., an antigen prepared by artificially synthesizing a protective short peptide from the amino acid sequence of a natural protein, linking the protective short peptide to a carrier, and adding an adjuvant.
"live vector" refers to a non-pathogenic microorganism which can be bacteria and virus, and the virus which is often used as a vector of viral live vectors is vaccinia virus, fowlpox virus, herpesvirus of turkeys, adenovirus, pseudorabies virus, retrovirus, lentivirus, by using a genetic engineering method to carry and express a gene of a certain antigen or antigenic determinant to generate immunogenicity; the bacterial live vector can be attenuated salmonella, bacillus calmette-guerin, attenuated listeria monocytogenes, attenuated vibrio cholerae, attenuated shigella, lactococcus lactis, acidophilus endosperm, streptococcus gaucher.
As an embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the protein of the porcine circovirus type 3 Cap is a protein encoded by the sequence seq.id No.1, and the protein of the porcine circovirus type 2new gene subtype Cap is a protein encoded by the sequence seq.id No. 2.
The immunogenic protein of the invention has good immunogenicity, and can provide complete protection by one-time immunization.
As an embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the coding gene of the porcine circovirus type 3 Cap protein has a nucleotide sequence shown in seq id No.1 or a degenerate sequence thereof, and the coding gene of the porcine circovirus type 2 Cap protein has a nucleotide sequence shown in seq id No.2 or a degenerate sequence thereof.
As an embodiment of the invention, in the immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens, the content of the porcine circovirus type 3 Cap protein is more than or equal to 20 mug/ml; the protein content of the porcine circovirus type 2new gene subtype Cap is more than or equal to 20 mug/ml.
In the immunogenic composition, when the content of the antigen is as low as 20 mu g/ml, the immunogenic composition can stimulate the immune system to generate immune response, and only can completely protect pigs.
As a preferred embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the content of the porcine circovirus type 3 Cap protein is 20 μ g/ml to 100 μ g/ml; the content of the Cap protein of the porcine circovirus type 2new gene subtype is 20 to 100 mu g/ml.
As a more preferred embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the content of the porcine circovirus type 3 Cap protein antigen is 20 μ g/ml to 50 μ g/ml; the content of the Cap protein of the porcine circovirus type 2new gene subtype is 20 to 50 mu g/ml.
As a more preferred embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the content of the porcine circovirus type 3 Cap protein antigen is 30 μ g/ml to 50 μ g/ml; the content of the Cap protein of the porcine circovirus type 2new gene subtype is 30 to 50 mu g/ml.
In the immunogenic composition, the content of the porcine circovirus type 3 Cap protein antigen can also be selected from the content range of 20 to 30 mug/ml, 30 to 100 mug/ml or 50 to 100 mug/ml.
In the immunogenic composition, the content of the porcine circovirus type 2new gene subtype Cap protein antigen can also be selected from the content range of 20 to 30 mu g/ml, 30 to 100 mu g/ml or 50 to 100 mu g/ml.
In the immunogenic composition of the invention, the content of the porcine circovirus type 3 Cap protein antigen and the content of the porcine circovirus type 2new gene subtype Cap protein antigen can be independently selected from any one of the content ranges described above.
As an embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the live vector in which the Cap protein gene of porcine circovirus type 3 is recombinant attenuated salmonella, recombinant newcastle disease virus, recombinant poxvirus, or recombinant adenovirus; the live vector recombined with the porcine circovirus type 2new gene subtype Cap protein gene is recombinant attenuated salmonella, recombinant Newcastle disease virus, recombinant poxvirus or recombinant adenovirus.
As an embodiment of the present invention, in the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention, the gene of the porcine circovirus type 3 Cap protein and the gene of the porcine circovirus type 2new subtype Cap protein are recombined in the same live vector, and the live vector is recombinant attenuated salmonella, recombinant newcastle disease virus, recombinant poxvirus, or recombinant adenovirus.
The live carrier immunogenic composition has the advantages of both inactivated vaccine and live vaccine, can ensure the protection of pigs in terms of immune efficacy, has stronger immune efficacy, and can be added with no adjuvant.
In one embodiment of the invention, the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the invention comprises an adjuvant, wherein the adjuvant comprises white oil, derek oil, and animal oil, vegetable oil, or mineral oil; or aluminum hydroxide, aluminum phosphate and metal salts; or MontanideTMGel, carbomer, squalane or squalene, ISA206 adjuvant, saponin, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion.
In a preferred embodiment of the present invention, the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention comprises an adjuvant MontanideTMGel。
The amount of adjuvant suitable for use in the compositions of the present invention is preferably an effective amount. By "effective amount" is meant the amount of adjuvant necessary or sufficient to exert their immunological effect in a host when administered in combination with the antigen of the invention without causing undue side effects. The precise amount of adjuvant to be administered will vary depending on a variety of factors such as the ingredients used and the type of disease being treated, the type and age of the animal to be treated, the mode of administration, and the other ingredients in the composition.
In one embodiment of the invention, the immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens comprises 5-20V/V% of the adjuvant.
In a preferred embodiment of the present invention, the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of the present invention comprises 10V/V% of the adjuvant.
The immunogenic compositions of the invention can be formulated using available techniques, preferably together with pharmaceutically acceptable carriers. For example, the oil may help stabilize the formulation and additionally serve as a vaccine adjuvant. The oil adjuvant can be natural source or obtained by artificial synthesis.
The term "adjuvant" refers to a substance added to the composition of the present invention to increase the immunogenicity of the composition. Known adjuvants include, but are not limited to: (1) aluminium hydroxide, saponin (saponin) (e.g. QuilA), alfuzidine, DDA, (2) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivatives, (3) vaccines can be made in the form of oil-in-water, water-in-oil or water-in-oil-in-water emulsions, or (4) MontanideTMGel。
In particular, the emulsion may be based on light liquid paraffin oil, isoprenoid oil, such as squalane or squalene; oils resulting from the oligomerization of olefins, in particular isobutene or decene, esters of acids or alcohols with linear alkyl groups, more in particular vegetable oils, ethyl oleate, propylene glycol di (caprylate/caprate), glycerol tri (caprylate/caprate), propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used with an emulsifier to form an emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of polyoxyethylated fatty acids (e.g.oleic acid), sorbitan, mannitol (e.g.anhydromannitol oleate), glycerol, polyglycerol, propylene glycol and optionally ethoxylated oleic acid, isostearic acid, ricinoleic acid, hydroxystearic acid, ethers of fatty alcohols and polyols (e.g.oleyl alcohol), polyoxypropylene-polyoxyethylene block copolymers, in particular Pluronic R, especially L121 (see Hunter et al, 1995, "The Theory and Practical applications of Advances" (Steward-Tull, D.E.S. eds.) John Wiley and sons, NY, 51-94; Todd et al, Vaccine, 1997, 15, 564 + 570).
In particular, the acrylic or methacrylic acid polymers are crosslinked by polyalkenyl ethers of sugars or polyols. These compounds are known as carbomers.
Preferably, the adjuvant selected by the invention is MontanideTMGel。
The immunogenic compositions of the invention may further comprise other agents added to the compositions of the invention. For example, the compositions of the present invention may also comprise agents such as: drugs, immunostimulants (e.g., alpha-interferon, beta-interferon, gamma-interferon, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), and interleukin 2(IL2)), antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives. To prepare such compositions, methods well known in the art may be used.
The immunogenic compositions according to the invention may be formulated as oral or non-oral dosage forms.
Preferred are non-oral dosage forms that can be administered by intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, or epidural routes.
The invention also relates to application of the immunogenic composition in preparing a medicament for preventing and/or treating porcine circovirus-related diseases, wherein the porcine circovirus-related diseases are related diseases caused by PCV2 and porcine circovirus type 3 single infection or mixed infection of the porcine circovirus type 3 single infection and the porcine circovirus type 3 mixed infection.
As an embodiment of the invention, the application of the preparation of the medicine for preventing and/or treating the diseases related to the porcine circovirus is the application of the preparation of the medicine for preventing and/or treating postweaning piglet multisystemic wasting syndrome, porcine dermatitis nephrotic syndrome, proliferative necrotizing pneumonia, reproductive disorders and cardiac and multisystemic inflammatory responses.
The term "porcine circovirus-associated disease" as used herein is intended to mean a disease caused by a mixed infection of porcine circovirus type 3 and type 2. Non-exhaustive examples include but are not limited to postweaning multisystemic wasting syndrome, porcine dermatitis nephrotic syndrome, reproductive disorders and cardiac and multisystemic inflammatory responses.
The term "preventing and/or treating" when referring to a mixed infection of porcine circovirus type 3 and type 2 means inhibiting replication of porcine circovirus type 3 and type 2, inhibiting transmission of porcine circovirus type 3 and type 2, or preventing colonization of porcine circovirus type 3 and type 2 in their host, and alleviating a symptom of a disease or disorder infected with porcine circovirus type 3 and type 2. Treatment is considered to be therapeutically effective if the viral load is reduced, the condition is reduced and/or the food intake and/or growth is increased.
The invention also relates to application of the immunogenic composition in preparing a medicament for preventing and/or treating porcine circovirus mixed infection.
In an embodiment of the invention, in the application of the invention in preparing a medicament for preventing and/or treating porcine circovirus mixed infection, the PCV2 gene subtype is PCV2a, PCV2b, PCV2d or PCV2new gene subtype.
The immunogenic composition can provide effectiveness for different PCV2 gene subtypes and PCV3, expands the application range of vaccines, and can prevent and/or treat single infection and mixed infection of PCV2 different gene subtypes and PCV 3.
The immunogenic composition has good immunogenicity, can prevent diseases related to the porcine circovirus, and can relieve clinical representation of pigs infected with the porcine circovirus, namely has a treatment effect.
The present invention will be further described with reference to specific embodiments, and advantages and features of the present invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.
The chemical reagents used in the examples of the present invention are all analytical reagents and purchased from the national pharmaceutical group.
In order that the invention may be more readily understood, reference is now made to the following examples which are intended to illustrate the invention. The experimental methods are conventional methods unless specified otherwise; the biomaterial is commercially available unless otherwise specified.
Example 1 isolation and identification of porcine circovirus type 3
1. Sources of pathological materials
Compared with the historical average value, the mortality of the sows is increased by 9.4%, the conception rate is reduced by 1.2%, and the mummy fetus is increased by 8.2% in a commercial pig farm in China. Clinically, affected sows show anorexia, and symptoms of multifocal papules, blotches, and surface dermatitis. Mummified fetuses of different gestational ages were contained in the litters of the miscarriage, consistent with symptoms of PCV 2-associated miscarriage. Although the overall clinical manifestations and abortion symptoms observed in sows were consistent with the reproductive disorders caused by porcine circovirus type 2, different tissues of all sows, including kidney, lymph nodes, lung, skin and stillborn fetuses, were negative for PCV2, PRRSV, PPV, CSFV, mycoplasma hyopneumoniae detection by immunohistochemistry and quantitative PCR. To further check the cause, various tissue disease materials are selected for pathogen separation.
2. Isolation and culture of viral strains
The disease material is mixed according to the proportion of 1: 10 (volume ratio) adding DMEM culture solution, grinding and preparing tissue suspension; repeatedly freezing and thawing the tissue suspension for 3 times, centrifuging at 12000r/min for 15min, and collecting supernatant; filtering the supernatant with 0.22 μm filter membrane, passaging the filtrate on PK15 cells, culturing at 37 deg.C for 1h, adding 2% calf serum-containing DMEM culture solution, and culturing at 37 deg.C for 5 days. And (4) harvesting a culture solution containing the virus, and after the culture solution is frozen and thawed for 2 times, harvesting the virus.
3. Identification of viral species by PCR and sequencing analysis
And (3) taking the virus culture obtained in the step (1), extracting nucleic acid of a virus sample by using a nucleic acid extraction kit, and performing PCR amplification identification by using a circovirus species specific primer, wherein the result shows that a 2000bp target band is amplified by PCR. And (3) sending the PCR product to a sequencing company for nucleotide sequence determination, and carrying out genetic evolution analysis on a sequence determination result. The results show that the genome sequence and amino acid sequence of the virus strain are less than 50% homologous with other reported circovirus, and according to the standard of the international committee for virology classification, the virus of the same species in the circovirus genus should have > 75% homology of genome nucleotide sequence and the Cap protein has > 70% homology of amino acid sequence, so that the virus strain is a new porcine circovirus and is also the third circovirus found on the pig body at present.
Example 2 construction of pET28a-PCV3-Cap expression vector
1. Extraction of PCV3 viral DNA
The plasmid extraction kit is purchased from a Tiangen organism; t4DNA Ligase was purchased from BioLab; the pET28a plasmid was purchased from Novagen; the agarose gel recovery kit is purchased from Tianze biology, and other reagents are analytically pure.
According to the instruction of the virus DNA extraction kit, 0.2ml of porcine circovirus type 3 virus liquid is taken in a sterile 1.5ml centrifuge tube, 0.4ml of VB is added in the virus liquid, vortex mixing is carried out, and standing is carried out for 10 minutes at room temperature. Add 0.45ml AD buffer to the virus solution and mix vigorously. Putting a VB column into a 2ml collecting tube, adding 0.6ml of the virus liquid mixed with the reagent into the VB column, centrifuging for 1 minute at 14000g, adding the rest virus liquid mixed with the reagent into the VB column, centrifuging for 1 minute at 14000g, discarding the 2ml collecting tube, putting the VB column into a new 2ml collecting tube, adding 0.4ml of W1buffer and centrifuging for 30 seconds at 14000g, adding 0.6ml of Wash buffer into the VB column, centrifuging for 30 seconds at 14000g, then emptying and centrifuging for 3 minutes without the buffer, putting the VB column into a new 1.5ml EP tube, adding 50 mu.l of RNase free water into the tube, putting the tube in the center of a membrane, standing for 3 minutes, centrifuging for 1 minute at 14000g, and centrifuging the liquid centrifuged from the EP tube to obtain the porcine circovirus type 3 virus DNA genome solution.
2. Cap Gene amplification
Oligonucleotide primers were synthesized based on the conserved region sequences at the 5 'and 3' ends of the Cap gene, and PCR was performed. Primer sequences are shown in Table 1.
TABLE 1 porcine circovirus type 3 Cap gene amplification primers
| PCV3-Cap-F | CCA CAG AAG GCG CTA TGT C |
| PCV3-Cap-R | CCG CAT AAG GGT CGT CTT G |
And (3) sending the PCR product to Invitrogen company for sequencing, and carrying out codon optimization on the Cap gene according to a sequencing result, wherein the sequence of the optimized Cap gene is shown as a sequence table SEQ ID NO. 1.
3. Expression vector construction
The optimized Cap gene was sent to Suzhou Hongxn Biotech GmbH for full sequence synthesis and ligated to pET28a plasmid. The connected plasmid and molecular chaperone plasmid pG-Tf2 are co-transformed into Escherichia coli BL21(DE3), a single clone is selected to be cultured in LB culture medium containing 100 mu g/ml kanamycin and 20 mu g/ml chloramphenicol overnight, the plasmid is extracted and then subjected to sequencing analysis, the synthetic sequence is determined to be correct, and the positive clone is pET28a-PCV3-Cap/pG-Tf2 expression strain pET28a-PCV3-Cap/pG-Tf2/E.Coli BL21(DE 3).
Example 3 expression of porcine circovirus type 3 Cap protein
The pET28a-PCV3-Cap/pG-Tf2/E.coli BL21(DE3) strain prepared in example 2 was inoculated into LB medium containing 50-100. mu.g/ml kanamycin and 20. mu.g/ml chloramphenicol, while the LB medium contained 5-10ng/ml tetracycline for inducible expression of chaperone protein in an amount of 1% (V/V), and cultured with shaking at 37 ℃. When OD is reached600When the temperature is 0.4 to 0.6, the mixture is left at 28 ℃ for 30 minutes. Isopropyl-. beta. -D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 to 1.0mM, and the mixture was cultured with shaking at 28 ℃ for 24 hours. After the culture was completed, the cells were collected, resuspended in PBS (PBS component: 8g of sodium chloride, 0.2g of potassium chloride, 1.44g of disodium hydrogen phosphate, and 0.24g of potassium dihydrogen phosphate, pH was adjusted to 7.4, and volume was fixed to 1L), disrupted by sonication, and the supernatant was obtained by centrifugation of the disrupted liquid after sonication. The expression product has high content of soluble target protein, the expression amount can reach 25% of the total mycoprotein amount, and the endotoxin content is 0.28X 105EU/ml。
Example 4 Escherichia coli expression of porcine circovirus type 3 Cap protein endotoxin Elimination
0.5ml of the supernatant solution containing the soluble Cap protein to be treated and Triton X-114(Triton X-114) at a final concentration of 1% (v/v) (addition 5. mu.l) were added to a 1.5ml centrifuge tube and vortexed. The mixed sample was placed on ice for 5 minutes with vortex shaking. After the sample was cooled, the centrifuge tube was immediately placed in a 37 ℃ water bath for 5min to allow a new two phase to develop. The sample was then centrifuged at 37 ℃ for 60 s. After centrifugation, the target protein will remain in the upper layer, and the endotoxin-containing nonionic surfactant will remain in the form of oil droplets at the bottom of the centrifuge tube, separating the two phases. The above whole endotoxin removal operation was repeated 3 times. The final purified product is determined that the protein purity is not reduced and the endotoxin content is reduced to 0.008 multiplied by 105EU/ml; meanwhile, PCV3 disease fixed on a carbon-sprayed copper mesh and negatively stained with 5% phosphotungstic acid is observed by a 200KV transmission electron microscope with the magnification of 60000 timesThe result shows that a large amount of virus-like particles are uniform in size and are in a hollow particle state.
The experimental result shows that Triton X-114 can remove residual endotoxin in the recombinant protein and has no influence on the purity of the protein; meanwhile, the forming and stable shape of the PCV3 virus-like particles are not influenced.
Example 5 isolation and identification of porcine circovirus type 2
1. Origin of disease material
In a domestic pig farm for immunizing commercial PCV2 vaccine, the phenomena of sow abortion and mummy fetus increase occur sporadically. Affected sows showed anorexia and contain mummified fetuses of different gestational ages in the litters of the miscarriage, consistent with symptoms of PCV 2-related miscarriage. PCV2 was positive as detected by immunohistochemistry and quantitative PCR. PCV2 is still detected from diseased pig tissues after immunization of PCV2 commercial vaccine, the reason is worthy of deep study, and in order to further clarify the reason, each tissue pathogen is selected for pathogen isolation.
2. Isolation and culture of viral strains
The disease material is mixed according to the proportion of 1: 10 (volume ratio) adding DMEM culture solution, grinding and preparing tissue suspension; repeatedly freezing and thawing the tissue suspension for 3 times, centrifuging at 12000r/min for 15min, and collecting supernatant; filtering the supernatant with 0.22 μm filter membrane, passaging the filtrate on PK15 cells, culturing at 37 deg.C for 1h, adding 2% calf serum-containing DMEM culture solution, and culturing at 37 deg.C for 5 days. And (4) harvesting a culture solution containing the virus, and after 2 times of freeze thawing, harvesting the virus.
3. Identification of viruses by PCR and sequencing analysis
And (3) taking the virus culture harvested in the step (1), extracting nucleic acid of a virus sample by using a nucleic acid extraction kit, and performing PCR amplification identification by using PCV2 specific primers, wherein the result shows that a 1.7kb band is amplified by PCR. And (3) sending the PCR product to a sequencing company for nucleotide sequence determination, and carrying out genetic evolution analysis on a sequence determination result. The results show that the whole genome sequence of the virus strain has less than 96 percent of homology with other reported PCV2, the amino acid sequence is less than 94 percent, and further whole genome sequence analysis shows that the virus strain is between PCV2b and PCV2d, and ORF2 gene has mutation or is recombined by ORF2 gene of different gene subtypes, and the virus strain belongs to a new PCV2 gene subtype determined by genetic evolution analysis.
Example 6 construction of pET28a-PCV2-Cap expression vector
1. Extraction of PCV2 viral DNA
The plasmid extraction kit is purchased from a Tiangen organism; t4DNA Ligase was purchased from BioLab; the pET28a plasmid was purchased from Novagen; the agarose gel recovery kit is purchased from Tianze biology, and other reagents are analytically pure.
According to the instruction of the virus DNA extraction kit, 0.2ml of a new porcine circovirus type 2 virus solution is taken to extract a DNA genome according to the method of example 2.
2. Amplification of porcine circovirus type 2 Cap Gene
Oligonucleotide primers were synthesized based on the conserved region sequences at the 5 'and 3' ends of the Cap gene, and PCR was performed. Primer sequences are shown in Table 2.
TABLE 2 porcine circovirus type 2 Cap gene amplification primers
| PCV2-Cap-F | CCCATGCCCTGAATTTCCA |
| PCV2-Cap-R | CAGCGCACTTCTTTCGTTTTCAG |
And (3) sending the PCR product to Invitrogen company for sequencing, wherein the result shows that compared with the Cap protein amino acid sequence of PCV2 in the prior art, the amino acid sequence coded by the Cap gene generates gene mutation or recombination at 52-64, 106-108 and 131-137, the Cap gene is subjected to codon optimization according to the sequencing result, and the sequence of the optimized Cap gene is shown as the sequence table SEQ ID NO. 2.
3. Expression vector construction
The optimized Cap gene was sent to Suzhou Hongxn Biotech GmbH for full sequence synthesis and ligated to pET28a plasmid. The connected plasmid and molecular chaperone plasmid pG-Tf2 are co-transformed into Escherichia coli BL21(DE3), a single clone is selected to be cultured in LB culture medium containing 100 mu g/ml kanamycin and 20 mu g/ml chloramphenicol overnight, the plasmid is extracted and then subjected to sequencing analysis, the synthetic sequence is determined to be correct, and the positive clone is pET28a-PCV2-Cap/pG-Tf2 expression strain pET28a-PCV2-Cap/pG-Tf2/E.Coli BL21(DE 3).
Example 7 expression of porcine circovirus type 2 Cap protein
pET28a-PCV2-Cap/pG-Tf2/E. coli BL21(DE3) strain prepared in example 6 was subjected to protein-induced expression with reference to example 3. The expression product has high content of soluble target protein, the expression amount can reach 50% of the total amount of mycoprotein, and the endotoxin content is 0.26 × 105EU/ml。
Example 8 Escherichia coli expression Cap protein endotoxin removal
The supernatant solution containing the soluble Cap protein expressed in example 7 was subjected to endotoxin removal with reference to example 4. The protein purity is not reduced and the endotoxin content is reduced to 0.008 multiplied by 10 by determination5EU/ml; meanwhile, PCV2 virus-like particles which are negatively stained with 5% phosphotungstic acid and fixed on a carbon-sprayed copper mesh are observed through a 200KV transmission electron microscope with the magnification of 60000 times, and the result shows that a large number of virus-like particles are uniform in size and are in a hollow particle state.
The result shows that Triton X-114 can clear residual endotoxin in the recombinant protein and has no influence on the purity of the protein; meanwhile, the forming and stable shape of the PCV2 virus-like particles are not influenced.
Example 9 preparation of immunogenic compositions of porcine circovirus type 3 and porcine circovirus type 2
The porcine circovirus type 3 Cap protein purified according to the example 4 and the porcine circovirus type 2 Cap protein purified according to the example 8 are mixed according to a proportion and then slowly added into a water-soluble adjuvant Gel adjuvant (Saebick, France), and an emulsifying machine with the rotating speed of 800rpm is continuously used for stirring for 12min in the adding process, and the mixture is uniformly mixed. Specific formulations of the immunogenic compositions are shown in table 3.
TABLE 3 immunogenic composition ratio containing porcine circovirus type 3 and porcine circovirus type 2 antigens
Example 10 immunogenicity test of immunogenic compositions containing porcine circovirus type 3 and porcine circovirus type 2 antigens
60 healthy piglets which are detected by ELISA for PCV2 and PCV3 at the age of 28-30 days and are negative to antibodies are randomly divided into 12 groups and 5 groups, and the porcine circovirus type 3 and type 2 immunogenic compositions prepared in the immune example 9 are immunized. The groups 1-2, 3-4, 5-6, 7-8, 9-10, 5-6 and 11-12 are respectively used as control groups for counteracting the virus. Each immunization group was injected with 2 ml/head of the immunogenic composition, and the control group was inoculated with 2 ml/head of DMEM medium. Attacking virus is carried out 28 days after immunization, and Porcine Circovirus type 3 SG strains (Portone Circovirus type 3, Strain SG, preserved in China center for type culture Collection with the preservation number of CCTCC NO: V201712, the preservation date of 2017, 3 months and 23 days, and the preservation address of Wuhan, Wuhan university, China) and 10 types of Porcine Circovirus type SG strains (Portone Circovirus type 3, Strain SG, 10 types of China) are attacked and poisoned5.0TCID50Group 2, group 4, group 6, group 8, group 10, group 12, group 2, group 6, group 8, group 10, group 12, Porcine Circovirus type 2 HH3 Strain (Portone Circovirus type 2, Strain HH3, deposited in China center for type culture Collection with CCTCC NO: V201726, deposited date of 2017, 6 months and 4 days, and deposited address: Wuhan university of Wuhan, China), 105.0TCID50And/or continuously observing each piglet after the virus attack, and judging according to the clinical symptoms, pathological changes and virus detection results of each piglet, wherein the specific results are shown in table 4.
TABLE 4 immunogenicity test results for immunogenic compositions containing porcine circovirus type 3 and type 2 antigens
The result shows that the immunogenic composition containing the porcine circovirus type 3 and type 2 antigens can provide 100 percent (5/5) protection for piglets after being immunized for one time, and the piglets of the challenge control group are all attacked after challenge. The immunogenic composition containing porcine circovirus type 3 and type 2 antigens provided by the invention has good protective effect. And the immunogenic compositions containing the porcine circovirus type 3 and type 2 antigens with different contents can not detect the virus in a pig body after immune challenge, which shows that after the immunogenic compositions are immunized, the development and growth of the pig and the feed fattening of the pig can not be influenced even if the immunized pig is infected by the wild virus.
Example 11 broad-spectrum protection assay for immunogenic compositions comprising porcine circovirus type 3 and porcine circovirus type 2 antigens
100 healthy piglets which are 28-30 days old and have PCV2 and PCV3 antigen detected by ELISA and have negative antibody are randomly divided into 20 groups, 5 groups/group, 13-22 groups, immunize the immunogenic composition 1 prepared in the example 9, and 23-32 groups are not immunized and used as challenge control groups. Each immunization group was injected with 2 ml/head of the immunogenic composition, and the challenge control group was inoculated with 2 ml/head of DMEM medium. Performing virus challenge 28 days after immunization, and performing virus challenge on group 13 and group 23 with virulent strains of porcine circovirus 2a gene subtype HN06 strain newly isolated from Henan province of China; the 14 th group and the 24 th group are attacked by virulent strains of porcine circovirus 2b gene subtype JS04 strain newly separated from Jiangsu province in China; the 15 th group and the 25 th group are attacked by virulent strains of porcine circovirus 2d gene subtype JL13 which are newly separated from Jilin province in China; the 16 th group and the 26 th group use a virulent strain CQ14 strain of a porcine circovirus 2new gene subtype newly separated from Chongqing city of China to challenge; the 17 th group and the 27 th group are attacked by virulent strains of a newly separated porcine circovirus 2new gene subtype GD15 strain in Guangdong province in China; 18 th and 28 th groupsUsing a virulent strain of porcine circovirus type 3 HN12 strain newly separated from Henan province in China to challenge; the 19 th group and the 29 th group were challenged with virulent strain of porcine circovirus type 3 JS08 newly isolated from Jiangsu province, China; the 20 th group and the 30 th group are attacked by virulent strains of porcine circovirus type 3 JL11 strain newly separated from Jilin province in China; the 21 st group and the 31 th group are attacked by virulent strains of porcine circovirus type 3 CQ04 strains newly separated from Chongqing city of China; the 22 nd and 32 th groups use a virulent strain of porcine circovirus type 3 GD05 strain newly separated from Guangdong province in China to challenge; the dose of the antidote is 105.0TCID50And/or continuously observing each piglet after the challenge, and judging according to clinical symptoms, pathological changes and virus detection of each piglet, wherein specific results are shown in tables 5-6.
TABLE 5 broad-spectrum protection test results of immunogenic compositions containing porcine circovirus type 3 and type 2 antigens against PCV2 infection
The results show that the 23 rd to 27 th groups of virus attacking control groups have clinical symptoms of more than 40.5 ℃ of body temperature rise in different degrees after virus attacking, the clinical symptoms last for 3 to 5 days, such as anorexia, depression, rough and disordered hair, emaciation, slow growth speed and the like, pathological changes of lung excess, lymphadenectasis and necrotic spots in kidney in different degrees are all generated in the autopsy, and porcine circovirus type 2 virus can be separated again by performing PCR detection on each organ tissue; and the 13 th to 17 th immune groups have no abnormal clinical symptoms after being attacked, have no abnormality in tissues and organs after being subjected to autopsy, and show that PCV2 is negative when PCR detection is carried out on all organ tissues. Experimental results show that the immunogenic composition containing the porcine circovirus type 3 and type 2 antigens provided by the invention can provide effective and complete immune protection for porcine circovirus type 2 virus challenge of different regional sources and different gene subtypes by one-time immunization, and the challenged PCV2 cannot be detected from all visceral organs.
TABLE 6 broad-spectrum protection test results of immunogenic compositions containing porcine circovirus type 3 and type 2 antigens against PCV3 infection
The results show that the 28 th to 32 th groups of the virus attacking control groups have different degrees of body temperature rise of more than 40.5 ℃ after virus attacking, the clinical symptoms such as anorexia, depression, rough and disordered hair, emaciation, slow growth speed and the like are continued for 3 to 5 days, pathological changes of lung consolidation, lymphadenectasis and necrotic spots in kidney are all detected by autopsy, and porcine circovirus type 3 virus can be separated again by performing PCR detection on each organ tissue; and the 18 th to 22 th immune groups have no abnormal clinical symptoms after being attacked by the toxin, have no abnormality in tissues and organs after being subjected to the autopsy, and show that PCV3 is negative when PCR detection is carried out on the tissues of organs. Experimental results show that the immunogenic composition containing the porcine circovirus type 3 and type 2 antigens can provide effective and complete immune protection for pigs against porcine circovirus type 3 viruses from different regions, and PCV3 strains which are attacked cannot be detected from organ tissues. The immunogenic composition provided by the invention has broad-spectrum immunogenicity, and can completely protect against epidemic porcine circovirus type 3 and type 2 wild viruses. And after the immunogenic composition is immunized, even if the immunized pig is infected by the wild virus, the development, growth and feeding and fattening of the pig are not affected.
EXAMPLE 12 Mixed infection protection test with immunogenic compositions containing porcine circovirus type 3 and type 2 antigens
20 healthy piglets which are detected by ELISA for PCV2 and PCV3 at the age of 28-30 days and are negative to antibodies are randomly divided into 4 groups and 5 groups. Immunogenic composition 1 prepared in Immunity example 9 of group 33, immunogenic composition 5 prepared in Immunity example 9 of group 34, and Immunity experiment of group 35The immunogenic composition 6 prepared in example 9, group 36 was not immunized as challenge control. Each immunization group was injected with 2 ml/head of the immunogenic composition, and the control group was inoculated with 2 ml/head of DMEM medium. The virus is attacked 28 days after immunization, and the virus attacking dose of the mixed virus liquid of the porcine circovirus type 3 SG strain and the porcine circovirus type 2 HH3 strain is 105.0TCID50And/or continuously observing each piglet after the challenge, and judging according to the clinical symptoms and pathological change results of each piglet, wherein the specific results are shown in table 7.
TABLE 7 protection test results of mixed infection with immunogenic compositions containing porcine circovirus type 3 and type 2 antigens
The results show that the 36 th group of the toxicity attacking control group has the clinical symptoms of the body temperature rise of more than 40.5 ℃ in different degrees after toxicity attacking, anorexia, depression, rough and disorderly fur, emaciation, slow growth speed and the like lasting for 5 days, and the pathological changes of lung consolidation, lymphadenectasis and kidney dead point in different degrees are all generated in the autopsy; the 33 th immune group has no abnormal clinical symptoms after virus attack, and has no abnormality after the autopsy of each tissue and organ; the 34 th and 35 th immune groups can not effectively prevent mixed infection of PCV2 and PCV3 and still have a disease state. Experimental results show that the immunogenic composition containing the porcine circovirus type 3 and type 2 antigens provided by the invention can provide effective and complete immune protection for pigs against PCV2 and PCV3 combined virus attack only by one-time immunization.
Example 13 application test of immunogenic compositions containing porcine circovirus type 3 and type 2 antigens
Compared with the historical average value, the mortality of the sows is increased by 9.8%, the conception rate is reduced by 1.2%, and the mummy fetus is increased by 8.6% in a commercial pig farm in China. Clinically, affected sows show anorexia, with symptoms of multifocal papules, blotches, and surface dermatitis. In the aborted litter containing mummified fetuses of different gestational ages, 32 pregnant sows selected from the sows with clinical manifestations were randomly divided into two groups, group a, group B, 16/group, group a being immunogenic composition vaccinated group, group a being immunogenic composition 1 prepared in immunization example 9, group B being placebo group. The immunization group was injected with 2 ml/head of the immunogenic composition, and the blank control group was inoculated with 2 ml/head of DMEM medium. Statistics is carried out on the child production conditions of the two groups of sows, and the results are shown in a table 8.
TABLE 8 statistical results of sow born in immunization group and placebo group
The results show that the sows in the immune group have no abnormal birth, healthy piglets are born at 11.7 heads/litter on average, the health rate is as high as 99.5 percent, the blank control group has obvious mummy fetus and weak piglet conditions, the healthy piglets are born at 6.9 heads/litter on average, the health rate is 59.0 percent, three sows have abortion, the mummy fetus in the whole litter is born, and the difference between the immune group and the blank control group is obvious.
The results in table 8 demonstrate that the immunogenic composition containing porcine circovirus type 3 and type 2 antigens of the invention has good immunoprotection effect on sows infected with porcine circovirus, and can protect, i.e. have therapeutic effect, sows infected with PCV.
Meanwhile, piglets born in the group B control group were individually housed in separate litters, 13 litters were divided into two groups, group B1 (including from B-1 to B-11 litters, and 10 litters in total except for B-5 litters with no complete litters), group B2 (including from B-12 to B-16 litters, and 3 litters in total except for B-14 and B-16 litters with no complete litters), group B1, immunogenic composition 1 prepared in example 9 before eating breast milk, and group B2, were blank controls. The immunization group was injected with 2 ml/head of the immunogenic composition, and the blank control group was inoculated with 2 ml/head of DMEM medium. Each piglet was continuously observed and judged according to clinical symptoms, pathological changes and virus detection of each piglet, and the specific results are shown in table 9.
TABLE 9 immunoprotection test of piglets with immunogenic compositions containing porcine circovirus type 3, type 2 antigens
The results show that the immunized piglets have no abnormal clinical symptoms, the random necropsy has no abnormality in each tissue organ, the PCV3 and PCV2 are negative when PCR detection is carried out on each visceral organ tissue of the necropsy pigs, the piglets of the blank control group have clinical symptoms of temperature rise of more than 40.5 ℃ in different degrees and lasting for 5 days, anorexia, mental depression, rough fur, emaciation, growth speed reduction and the like, part of the piglets die, the necropsy has pathological changes of lung change, lymphadenectasis and kidney necrosis points in different degrees, and the porcine circovirus type 3 virus and the porcine circovirus type 2 virus can be separated again by carrying out PCR detection on each visceral organ tissue.
Since PCV is vertically transmissible in a swine herd, the results in table 9 demonstrate that the immunogenic composition containing porcine circovirus type 3 and type 2 antigens according to the present invention has a good immunoprotection effect on piglets infected with mixed porcine circovirus type 3 and type 2, and can protect piglets infected with mixed PCV3 and PCV2 viruses, i.e., have a therapeutic effect, with a protection rate of 100%.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.
SEQUENCE LISTING
<110> Australia Biotechnology (Suzhou) Ltd, Puleco bioengineering GmbH
<120> an immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and uses thereof
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 645
<212> DNA
<213> porcine circovirus type 3
<400> 1
atgcgtcacc gtgctatctt ccgtcgtcgt ccgcgtccgc gtcgtcgtcg tcgtcaccgt 60
cgtcgttacg ctcgtcgtaa actgttcatc cgtcgtccga ccgctggtac ctactacacc 120
aaaaaatact ctaccatgaa cgttatctct gttggtaccc cgcagaacaa caaaccgtgg 180
cacgctaacc acttcatcac ccgtctgaac gaatgggaaa ccgctatctc tttcgaatac 240
tacaaaatcc tgaaaatgaa agttaccctg tctccggtta tctctccggc tcagcagacc 300
aaaaccatgt tcggtcacac cgctatcgac ctggacggtg cttggaccac caacacctgg 360
ctgcaggacg acccgtacgc tgaatcttct acccgtaaag ttatgacctc taaaaaaaaa 420
cactctcgtt acttcacccc gaaaccgctg ctggctggta ccacctctgc tcacccgggt 480
cagtctctgt ctttcttctc tcgtccgacc ccgtggctga acacctacga cccgaccgtt 540
cagtggggtg ctctgctgtg gtctatctac gttccggaaa aaaccggtat gaccgacttc 600
tacggtacca aagaagtttg gatccgttac aaatctgttc tgtaa 645
<210> 2
<211> 702
<212> DNA
<213> porcine circovirus type 2new gene subtype
<400> 2
atgacctacc cgcgtcgtcg ttaccgtcgt cgtcgtcacc gtccgcgttc tcacctgggt 60
cagatcctgc gtcgtcgtcc gtggctggtt cacccgcgtc accgttaccg ttggcgtcgt 120
aaaaacggta tcttcaacac ccgtctgtct cgttctttcg gttacaccgt tgttacctct 180
accgttaccc cgccgtcttg ggctgttgac atgatgcgtt tcaacatcaa cgacttcctg 240
ccgccgggtg gtggttctaa cccgcgttct gttccgttcg aatactaccg tatccgtaaa 300
gttaaagttg aattcttcgc tcgttctccg atcacccagg gtgaccgtgg tgttggttct 360
tctgctgtta tcctggacga caacttcgtt aacaaaacca acgctctgtc ttacgacccg 420
tacgttaact actcttctcg tcacaccatc acccagccgt tctcttacca ctctcgttac 480
ttcaccccga aaccggttct ggactctacc atcgactact tccagccgaa caacaaacgt 540
aaccagctgt ggctgcgtct gcagaccacc ggtaacgttg accacgttgg tctgggtacc 600
gctttcgaac actctatcta cgaccaggct tacaacatcc gtgttaccat gtacgttcag 660
ttccgtgaat tcaacctgaa agacccgccg ctgaacccgt aa 702
Claims (10)
1. An immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens, wherein the immunogenic composition comprises an immunizing amount of porcine circovirus type 3 Cap protein antigen, an immunizing amount of porcine circovirus type 2new gene subtype Cap protein antigen and a pharmaceutically acceptable carrier; the protein antigen of the porcine circovirus type 3 Cap protein is porcine circovirus type 3 Cap protein or a live vector recombined with the porcine circovirus type 3 Cap protein gene, and the protein antigen of the porcine circovirus type 2new gene subtype Cap protein is porcine circovirus type 2new gene subtype Cap protein or a live vector recombined with the porcine circovirus type 2new gene subtype Cap protein gene; the porcine circovirus type 3 Cap protein is a protein coded by SEQ ID NO.1, and the porcine circovirus type 2new gene subtype Cap protein is a protein coded by SEQ ID NO. 2.
2. The immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens according to claim 1, wherein the porcine circovirus type 3 Cap protein content is more than or equal to 20 μ g/ml; the protein content of the porcine circovirus type 2new gene subtype Cap is more than or equal to 20 mug/ml.
3. The immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens according to claim 1, wherein the porcine circovirus type 3 Cap protein content is between 20 and 100 μ g/ml; the content of the Cap protein of the porcine circovirus type 2new gene subtype is 20 to 100 mu g/ml.
4. The immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens according to claim 1, wherein the porcine circovirus type 3 Cap protein content is between 20 and 50 μ g/ml; the content of the Cap protein of the porcine circovirus type 2new gene subtype is 20 to 50 mu g/ml.
5. The immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens according to claim 1, wherein the porcine circovirus type 3 Cap protein content is between 30 and 50 μ g/ml; the content of the Cap protein of the porcine circovirus type 2new gene subtype is 30 to 50 mu g/ml.
6. The immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens according to claim 1, wherein the porcine circovirus type 3 Cap protein gene and the porcine circovirus type 2new gene subtype Cap protein gene are recombined in the same live vector, and the live vector is recombinant attenuated Salmonella, recombinant Newcastle disease virus, recombinant poxvirus or recombinant adenovirus.
7. The immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens according to claim 1, wherein the pharmaceutically acceptable carrier comprises an adjuvant which is a Gel adjuvant; the content of the adjuvant is 5-20V/V%.
8. The immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens of claim 7, wherein the adjuvant content is 10V/V%.
9. Use of the immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens according to any one of claims 1 to 8 in the preparation of a medicament for the prevention of diseases associated with porcine circovirus.
10. The use according to claim 9, wherein the porcine circovirus-associated disease comprises postweaning multisystemic wasting syndrome, porcine dermatitis nephrotic syndrome, proliferative necrotizing pneumonia, reproductive disorders and cardiac and multisystemic inflammatory responses.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710464584.1A CN109125719B (en) | 2017-06-19 | 2017-06-19 | Immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof |
| JP2020519165A JP6882602B2 (en) | 2017-06-19 | 2017-12-26 | Immunogenic compositions containing porcine circovirus type 3 and porcine circovirus type 2 antigens and their uses. |
| PCT/CN2017/118696 WO2018233264A1 (en) | 2017-06-19 | 2017-12-26 | Immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710464584.1A CN109125719B (en) | 2017-06-19 | 2017-06-19 | Immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109125719A CN109125719A (en) | 2019-01-04 |
| CN109125719B true CN109125719B (en) | 2022-06-14 |
Family
ID=64737516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710464584.1A Active CN109125719B (en) | 2017-06-19 | 2017-06-19 | Immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof |
Country Status (3)
| Country | Link |
|---|---|
| JP (1) | JP6882602B2 (en) |
| CN (1) | CN109125719B (en) |
| WO (1) | WO2018233264A1 (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109010818B (en) * | 2017-06-09 | 2021-11-09 | 普莱柯生物工程股份有限公司 | Bivalent vaccine composition for preventing and/or treating porcine circovirus infection and preparation method and application thereof |
| CN109762052B (en) * | 2019-01-18 | 2022-03-08 | 南京农业大学 | Porcine circovirus type 3 Cap recombinant protein and coding gene and application thereof |
| CN114222579A (en) * | 2019-04-04 | 2022-03-22 | 勃林格殷格翰动物保健美国有限公司 | Porcine circovirus type 3 (PCV3) vaccine and production and use thereof |
| CN110174510A (en) * | 2019-04-26 | 2019-08-27 | 华南农业大学 | A kind of preparation method of the fluorescence immune chromatography detection card of PCV3 |
| CN111187781B (en) * | 2019-09-12 | 2023-09-15 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Optimized porcine circovirus type 3 capsid protein gene and application thereof in preparation of virus-like particles |
| CN110981945B (en) * | 2019-12-08 | 2021-10-19 | 中牧实业股份有限公司 | Expression preparation and application of porcine circovirus type 2 recombinant Cap protein |
| PE20211141A1 (en) * | 2019-12-19 | 2021-06-25 | Farm Veterinarios S A C | SALMONELLA ENTERITIDIS RECOMBINANTE AND ITS USE AS A SWINE VACCINE |
| CN111558037A (en) * | 2020-06-08 | 2020-08-21 | 武汉科前生物股份有限公司 | Bivalent subunit vaccine and preparation method and application thereof |
| CN115819567B (en) * | 2022-11-19 | 2023-09-01 | 深圳盛源生物技术有限公司 | Monoclonal antibody and application thereof in detection kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240264A (en) * | 2008-03-21 | 2008-08-13 | 南京农业大学 | Porcine circovirus 2 type inactivated vaccine |
| CN101768218A (en) * | 2010-03-02 | 2010-07-07 | 福建省农业科学院畜牧兽医研究所 | Preparation method for PCV-II Cap protein monoclonal antibody, antibody and application |
| CN102080074A (en) * | 2010-11-29 | 2011-06-01 | 北京大北农科技集团股份有限公司 | Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains |
| CN104334186A (en) * | 2012-04-04 | 2015-02-04 | 硕腾有限责任公司 | PCV/mycoplasma hyopneumoniae combination vaccine |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110090711A (en) * | 2010-02-04 | 2011-08-10 | 녹십자수의약품(주) | Novel porcine circovirus type 2 and use thereof |
| CN102174086B (en) * | 2011-03-07 | 2014-04-02 | 南京农业大学 | Porcine circovirus type 2 recombinant cap protein and subunit vaccine |
| KR101527861B1 (en) * | 2011-12-30 | 2015-06-12 | 대한민국 | Utilization method of porcine circovirus ２ capsid protein |
| CN105039405A (en) * | 2015-05-20 | 2015-11-11 | 吉林和元生物工程有限公司 | Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine |
| WO2017066772A1 (en) * | 2015-10-16 | 2017-04-20 | Kansas State University Research Foundation | Porcine circovirus type 3 immunogenic compositions and methods of making and using the same |
| CN107233566B (en) * | 2017-01-13 | 2022-05-27 | 浙江海隆生物科技有限公司 | Swine fever-porcine circovirus bivalent subunit vaccine and preparation method and application thereof |
-
2017
- 2017-06-19 CN CN201710464584.1A patent/CN109125719B/en active Active
- 2017-12-26 JP JP2020519165A patent/JP6882602B2/en active Active
- 2017-12-26 WO PCT/CN2017/118696 patent/WO2018233264A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240264A (en) * | 2008-03-21 | 2008-08-13 | 南京农业大学 | Porcine circovirus 2 type inactivated vaccine |
| CN101768218A (en) * | 2010-03-02 | 2010-07-07 | 福建省农业科学院畜牧兽医研究所 | Preparation method for PCV-II Cap protein monoclonal antibody, antibody and application |
| CN102080074A (en) * | 2010-11-29 | 2011-06-01 | 北京大北农科技集团股份有限公司 | Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains |
| CN104334186A (en) * | 2012-04-04 | 2015-02-04 | 硕腾有限责任公司 | PCV/mycoplasma hyopneumoniae combination vaccine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109125719A (en) | 2019-01-04 |
| JP2020524182A (en) | 2020-08-13 |
| WO2018233264A1 (en) | 2018-12-27 |
| JP6882602B2 (en) | 2021-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109125719B (en) | Immunogenic composition containing porcine circovirus type 3 and porcine circovirus type 2 antigens and application thereof | |
| EP3166634B1 (en) | Novel vaccine compositions for porcine epidemic diarrhea virus | |
| CN108785667B (en) | Porcine circovirus type 3 immunogenic composition, preparation method and application | |
| US10130702B2 (en) | Vaccine composition and preparation method and use thereof | |
| CN108653724B (en) | Vaccine composition for preventing egg drop syndrome of poultry, and preparation method and application thereof | |
| CN106148287B (en) | Porcine epidemic diarrhea virus strain and vaccine composition, preparation method and application thereof | |
| CN108653725B (en) | Vaccine composition for preventing egg drop syndrome of poultry, and preparation method and application thereof | |
| CN109306360B (en) | Method for expressing foreign protein by using baculovirus and application thereof | |
| CN110540579B (en) | Avibacterium paragallinarum antigen protein, vaccine composition containing avibacterium paragallinarum antigen, and preparation method and application thereof | |
| CN109134619B (en) | Porcine circovirus type 2 antigen, immunogenic composition prepared from same, preparation method and application | |
| CN108660115B (en) | Porcine circovirus type 3 strain, vaccine composition thereof, preparation method and application | |
| CN107523556B (en) | Avian adenovirus strain, vaccine composition and application thereof | |
| CN109010818B (en) | Bivalent vaccine composition for preventing and/or treating porcine circovirus infection and preparation method and application thereof | |
| CN109125720B (en) | Immunogenic composition containing porcine circovirus type 3 antigen and application thereof | |
| CN108126192B (en) | Vaccine composition and application thereof | |
| CN107287168B (en) | Newcastle disease virus rescue method and application thereof | |
| CN109022368B (en) | Porcine circovirus type 2 strain, vaccine composition, preparation method and application thereof | |
| CN114573708A (en) | Avibacterium paragallinarum HA fusion protein and tripolymer thereof, vaccine composition prepared from avibacterium paragallinarum HA fusion protein, preparation method and application of vaccine composition | |
| CN110343670B (en) | Recombinant porcine pseudorabies virus attenuated strain for expressing porcine circovirus Cap protein gene, and preparation method and application thereof | |
| CN109010817B (en) | Vaccine composition for preventing and/or treating porcine circovirus type 3 infection and preparation method and application thereof | |
| CN112679585A (en) | Vaccine composition containing avian egg drop syndrome virus genetic engineering subunit vaccine and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |