CN105039405A - Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine - Google Patents
Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine Download PDFInfo
- Publication number
- CN105039405A CN105039405A CN201510257530.9A CN201510257530A CN105039405A CN 105039405 A CN105039405 A CN 105039405A CN 201510257530 A CN201510257530 A CN 201510257530A CN 105039405 A CN105039405 A CN 105039405A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- bacsc
- expression vector
- dual
- seqidno
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to the technical fields of animal virology and genetic engineering and especially relates to a recombinant expression vector and a construction method thereof, a recombinant virus strain and an application thereof, a recombinant protein and a subunit vaccine. According to the invention, PCR amplification is successfully carried out for amplifying PRRSV-GP5 gene and PCV2-Cap gene and constructing a high-effective recombinant expression plasmid BacSC-Dual-GP5-Cap. In addition, the recombinant protein expressed by the recombinant virus strain is very high in product expression yield. The BacSC-Dual-GP5-Cap subunit vaccine product in the invention is safe to animal. An immune efficacy test result of the vaccine proves that PRRSV and PCV2 researched through a genetic engineering method have a strong immunogenicity. The subunit vaccine has a wide application prospect in the field of prevention and treatment of porcine reproductive and respiratory syndrome and porcine circovirus disease.
Description
Technical field
The present invention relates to animal virology and genetic engineering technical field, particularly recombinant expression vector and construction process, recombinant virus strain and application, recombinant protein and subunit vaccine.
Background technology
Porcine reproductive and respiratory syndrome (PRRS) is a kind of high degree in contact disease.Main manifestations is sow breeding difficulty and growing and fattening pigs and piggy expiratory dyspnea.GP5 is the important glycoprotein of PRRSV, can induce generation and the immunoprotection of neutralizing antibody.Therefore can be used as the principal target point of the recombinant vaccine of research antagonism PRRSV.Although deactivation and the living vaccine after modifying can utilize, its protectiveness is imperfect.Therefore the effective vaccine exploring and develop antagonism PRRSV infection is a very urgent task.
Porcine circovirus 2 type (Porcinecircovirustype2virus, be called for short PCV2) be cause multisystemic exhaustion syndrome (Post-weaningmultisystemicsyndrome after weaned piglet, PMWS) main pathogen, causes weanling pig generation progressive emaciation, cough, expiratory dyspnea etc.Current PCV2 extensively to exist and popular all over the world, causes huge financial loss to global pig industry.Porcine circovirus 2 type genome contains two main open reading frame, i.e. ORF1 and ORF2, wherein ORF2 is the main component forming viral capsid proteins (Cap), it is mainly positioned on cytoplasmic membrane, there is oneself and be assembled into virus like particle. and confirm after deliberation in ORF2 albumen containing the Neutralization and crystallization that can neutralize virus, therefore, be the preferred object gene designing new generation vaccine.
As RNA viruses, easily there is internality mistake when synthesizing in the gene of PRRSV, can suddenly change by appearance point; delete, add and gene recombination between strain; and the ability of inactivated vaccine inducing cellular immune is more weak, the provide protection of generation is shorter, and blue otopathy also exists " ADE ".Again because PCV2 can cause generation and the development of blue otopathy, so utilize gene engineering method to develop PRRSV and PCV2 divalence subunit vaccine will become the important directions of thorough anti-this disease of system.Therefore, this subunit vaccine pig blue-ear disease and pig circular ring virus 2 anti-processed in will have application prospect very widely.
Summary of the invention
In view of this, the invention provides recombinant expression vector and construction process, recombinant virus strain and application, recombinant protein and subunit vaccine.The present invention's success pcr amplification PRRSV-GP5 gene and PCV2-Cap gene and build high efficiency recombinant expressed plasmid BacSC-Dual-GP5-Cap.In addition, the recombinant protein expressed by recombinant strain of the present invention, its Product Expression output is very high.Safe with the BacSC-Dual-GP5-Cap subunit vaccine goods of development to this animal.Vaccine immunity efficacy test results shows, PRRSV and PCV2 utilizing gene engineering method to develop has good immunogenicity, this subunit vaccine pig blue-ear disease and pig circular ring virus 2 anti-processed in will have application prospect very widely.
In order to realize foregoing invention object, the invention provides following technical scheme:
The invention provides a kind of recombinant expression vector, forming by having the PRRSVGP5 gene fragment of nucleotide sequence as shown in SEQIDNo.1, the PCV2Cap gene fragment with nucleotide sequence as shown in SEQIDNo.2 and plasmid vector recombination to construct.
It is protein mediated by gp64 that baculovirus cell enters, after host cell expression, gp64 Protein S S is directly through cytolemma, and come across infected cell surface with trimerical form, after the expression of this fusion rotein and the glycoprotein gp64 of body start, proceed to plasma membrane, enter in baculovirus envelope.Method using false type baculovirus as a potential vaccine delivery system is widely used.
In some embodiments of the invention, recombinant expression vector has the gene fragment of the PRRSVGP5 of nucleotide sequence as shown in SEQIDNo.1 described in expression vector BacSC-Dual inserts between itself KpnI and SmaI restriction enzyme site, and described expression vector BacSC-Dual inserts the PCV2Cap gene fragment acquisition of nucleotide sequence shown in SEQIDNo.2 between itself PstI and EcoRI restriction enzyme site.
Concrete, recombinant expression vector inserts gp64CAD, gp64TM by expression vector BacSC-Dual between itself KpnI and SmaI restriction enzyme site, the PRRSVGP5 gene fragment of nucleotide sequence, His6, gp64ss as shown in SEQIDNo.1, and described expression vector BacSC-Dual inserts the PCV2Cap gene fragment of nucleotide sequence shown in gp64ss, His6, SEQIDNo.2 between itself BamHI and HindIII restriction enzyme site, gp64TM, gp64CAD obtain.
Present invention also offers a kind of construction process as above-mentioned recombinant expression vector, comprise the steps:
Step 1: amplification obtains the PRRSVGP5 gene fragment of nucleotide sequence as shown in SEQIDNo.1;
Step 2: amplification obtains the gene fragment of the PRRSVGP5 of nucleotide sequence as shown in SEQIDNo.1;
Step 3: by described expression vector BacSC-Dual through XhoI, XbaI, PstI and EcoR double digestion respectively, the PRRSVGP5 gene fragment of such as nucleotide sequence shown in SEQIDNo.1 and the such as gene fragment of the PRRSVGP5 of nucleotide sequence shown in SEQIDNo.1 are transformed and is connected, obtain described recombinant expression vector.
In embodiments more of the present invention, build recombinant expression plasmid BacSC-Dual-GP5-Cap and comprise:
1, the design of primers of PRRSV-GP5 gene and PCV2-Cap gene
Cap gene order according to porcine reproductive and respiratory syndrome GP5 protein gene and porcine circovirus 2 type designs Auele Specific Primer P1, P2, P3 and P4, and primer sequence is as follows:
GP5-P
1: as shown in SEQIDNo.4,5 ' GCTGCGCGCATGAATGGCATCTTC3 '
GP5-P
2: as shown in SEQIDNo.5,
5’GGGGCATGCAAGTGGGGGGTCTTTAAG3’，
Cap-P
3: as shown in SEQIDNo.6,5 ' GCTCTCGAGAGCAACAACAGCAG3 ',
Cap-P
4: as shown in SEQIDNo.7,5 ' GATCTGCAGGAGACGACCCCATTGTT3 ';
According to baculovirus BacSC-Dual carrier restriction enzyme site, add restriction enzyme site XhoI, XbaI, PstI and EcoR, above-mentioned primer synthesizes by Shanghai Sheng Gong bio-engineering corporation.Auele Specific Primer is designed with the complete genome sequence of the GP5 protein gene of pig blue ear T1 strain and the A strain of PCV2 Henan, and with recombinant plasmid pT-PCV for template (Cao Shengbo etc. the genome cloning of pig II type PCV-II Henan A strain and sequential analysis, with P1, P2, P3 and P4 for primer pair CP5 and Cap gene increase, amplification object clip size is respectively 507bp and 570bp.After reaction terminates, detect amplification with 1% agarose gel electrophoresis.
2, the structure of recombinant expression plasmid BacSC-Dual-GP5-Cap
The GP5 of pcr amplification and Cap protein gene fragment purifying are reclaimed, be converted in cloned plasmids, through XhoI, XbaI, PstI and EcoR double digestion respectively, after GP5 gene is connected with Cap gene, product cloning will be connected on expression vector BacSC-Dual, obtain the restructuring eucaryon plasmid BacSC-Dual-GP5-Cap of natural expression GP5-Cap gene.DH10Bac intestinal bacteria are separately converted to recombinant plasmid BacSC-Dual-GP5-Cap and non-recombinant plasmid BacSC-Dual.Non-recombinant plasmid BacSC-Dual is as negative control.Select, after blue/white selection bacterium colony of two-wheeled, from white colony, to be separated to recombinant plasmid according to the program of Invitrogen corporate policy.PCR checking is carried out with P1 and P4 Auele Specific Primer after recombinant clone.Recombinant baculovirus DNA is called after BacSC-Dual-GP5-Cap and BacSC-Dual respectively.
Present invention also offers a kind of recombinant virus strain, formed through packing cell packaging by above-mentioned recombinant expression vector.
In some embodiments of the present invention, the biological deposits of recombinant virus strain is numbered CGMCCNo.2389.
Present invention also offers above-mentioned recombinant baculovirus strain prevents and/or treats the pharmaceutical preparation of PRRSV infection relative disease and/or PCV2 infection relative disease application in preparation.
In some embodiments of the present invention, described PRRSV infection relative disease is porcine reproductive and respiratory syndrome; It is multisystemic exhaustion syndrome that described PCV2 infects relative disease.
Present invention also offers a kind of recombinant protein of expressing as above-mentioned recombinant virus strain.
In some embodiments of the present invention, the aminoacid sequence of recombinant protein is as shown in SEQIDNo.3.
In addition, present invention also offers a kind of subunit vaccine, comprise:
(I) the recombinant virus strain as above recombinant protein of expressing or reach the albumen of more than 80% with its homology;
And/or
(II) recombinant protein as above or reach the albumen of more than 80% with its homology.
The invention provides a kind of recombinant expression vector, forming by having the PRRSVGP5 gene fragment of nucleotide sequence as shown in SEQIDNo.1, the PCV2Cap gene fragment with nucleotide sequence as shown in SEQIDNo.2 and plasmid vector recombination to construct.The present invention's success pcr amplification PRRSV-GP5 gene and PCV2-Cap gene and build high efficiency recombinant expressed plasmid BacSC-Dual-GP5-Cap.In addition, the recombinant protein expressed by recombinant strain of the present invention, its Product Expression output is very high.Safe with the BacSC-Dual-GP5-Cap subunit vaccine goods of development to this animal.Vaccine immunity efficacy test results shows, when just exempting from 14 days, GP5-Cap specific antibody can be detected in the pig body of immune BacSC-Dual-GP5-Cap.After booster immunization, GP5-Cap specific antibody level rapidly increases to 1: 17.6.Therefore PRRSV and PCV2 utilizing gene engineering method to develop has good immunogenicity, this subunit vaccine pig blue-ear disease and pig circular ring virus 2 anti-processed in will have application prospect very widely.
Biological deposits explanation
Recombinant baculovirus BacSC-Dual-GP5-Cap.This culture presevation is at China Committee for Culture Collection of Microorganisms's common micro-organisms center, and address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, and deposit number is CGMCCNo.2389.
Accompanying drawing explanation
In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, be briefly described to the accompanying drawing used required in embodiment or description of the prior art below.
Fig. 1 shows that recombinant expression plasmid BacSC-Dual-GP5-CapPCR and enzyme cut qualification result; M1, M2:DNA molecular weight standard (DL2000, λ HindIII); L1, L2, L3: recombinant plasmid PCR qualification result, recombinant plasmid enzyme cut qualification result, recombinant plasmid;
Fig. 2 shows the structure collection of illustrative plates of recombinant expression plasmid BacSC-Dual-GP5-Cap; Show that PRRSV-GP5 and PCV2-Cap gene clone is to baculovirus BacSC-Dual (with gp64ss, His6, gp64TM and gp64CTD);
Fig. 3 shows the expression of results of restructuring GP5-Cap fusion rotein in insect sf-9 cell: L1. expresses 72h, L2. and expresses 36h, L3. empty carrier; M. middle molecular weight protein marker thing;
Fig. 4 shows the Westernblot analytical results of expression product;
Fig. 5 confocal microscope detected result;
Fig. 6 immunogold electron microscopic detection result: A: B appears anti-PRRSV gold grain, in the surface of baculovirus: C appears anti-PRRSV gold grain, in the surface of baculovirus: the surface of baculovirus does not occur gold grain.
Embodiment
The invention discloses recombinant expression vector and construction process, recombinant virus strain and application, recombinant protein and subunit vaccine, those skilled in the art can use for reference present disclosure, and suitable improving technique parameter realizes.Special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, they are all deemed to be included in the present invention.Method of the present invention and application are described by preferred embodiment, related personnel obviously can not depart from content of the present invention, spirit and scope methods and applications as herein described are changed or suitably change with combination, realize and apply the technology of the present invention.
The present invention specifically comprises following specific embodiments:
One, pcr amplification PRRSV-GP5 gene and PCV2-Cap gene and build recombinant expression plasmid BacSC-Dual-GP5-Cap
3, the design of primers of PRRSV-GP5 gene and PCV2-Cap gene
Cap gene order according to porcine reproductive and respiratory syndrome GP5 protein gene and porcine circovirus 2 type designs Auele Specific Primer P1, P2, P3 and P4, and primer sequence is as follows:
GP5-P
1：5’GCTGCGCGCATGAATGGCATCTTC3’
GP5-P
2：5’GGGGCATGCAAGTGGGGGGTCTTTAAG3’，
Cap-P
3：5’GCTCTCGAGAGCAACAACAGCAG3’，
Cap-P
4：5’GATCTGCAGGAGACGACCCCATTGTT3’
According to baculovirus BacSC-Dual carrier restriction enzyme site, add restriction enzyme site XhoI, XbaI, PstI and EcoR, above-mentioned primer synthesizes by Shanghai Sheng Gong bio-engineering corporation.Auele Specific Primer is designed with the complete genome sequence of the GP5 protein gene of pig blue ear T1 strain and the A strain of PCV2 Henan, and with recombinant plasmid pT-PCV for template (Cao Shengbo etc. the genome cloning of pig II type PCV-II Henan A strain and sequential analysis, with P1, P2, P3 and P4 for primer pair CP5 and Cap gene increase, amplification object clip size is respectively 507bp and 570bp.After reaction terminates, detect amplification with 1% agarose gel electrophoresis.
4, the structure of recombinant expression plasmid BacSC-Dual-GP5-Cap
The GP5 of pcr amplification and Cap protein gene fragment purifying are reclaimed, be converted in cloned plasmids, through XhoI, XbaI, PstI and EcoR double digestion respectively, after GP5 gene is connected with Cap gene, product cloning will be connected on expression vector BacSC-Dual, obtain the restructuring eucaryon plasmid BacSC-Dual-GP5-Cap of natural expression GP5-Cap gene.DH10Bac intestinal bacteria are separately converted to recombinant plasmid BacSC-Dual-GP5-Cap and non-recombinant plasmid BacSC-Dual.Non-recombinant plasmid BacSC-Dual is as negative control.Select, after blue/white selection bacterium colony of two-wheeled, from white colony, to be separated to recombinant plasmid according to the program of Invitrogen corporate policy.PCR checking is carried out with P1 and P4 Auele Specific Primer after recombinant clone.Recombinant baculovirus DNA is called after BacSC-Dual-GP5-Cap and BacSC-Dual respectively.
Two, recombinant expression plasmid transfection and plaque assay
Carrying out in steps according to product manual.To digest sf-9 monolayer cell, and proceed in 6 orifice plates, and treat that plating cells density will carry out transfection 80%, transfectional cell cultivates 5h in 27 DEG C, and the substratum of transfection replaces with fresh substratum.
Get transfectional cell culture supernatant and do Plaque Clone and shaker test.Plaque is tested: the viral cultures supernatant adopting 10 times of serial dilutions, inoculation meadow is coveted in noctuid 9 (sf-9) cell, 1h is made in 28 DEG C of senses, be that 1% agarose-GraceShi complete culture solution covers after (including 150 μ g/mLX-gal) solidifies and is inverted in 28 DEG C of incubators and cultivates 4 with final concentration after sucking-off inoculation liquid, day by day the appearance of dark blue plaque is observed, with glass capillary picking locus coeruleus, set to 0 in .5mL serum-free GraceShi nutrient solution and blow and beat, sf-9 cell is inoculated with this, repeatedly carry out the Plaque Clone screening of 3 recombinant baculovirus, obtain virus titer and press plaque forming unit (pfu/mL) calculating.
Three, the expression of recombinant protein and SDS-PAGE, Westernblot analyze
Get the new sf-9 cell cultivated, inoculum size is 0.1 infectious unit, gathers in the crops virocyte culture after inoculation 5 ~ 7 ages in days.During expression of recombinant proteins, inoculum size is 5 infectious units, collects cell culture by different time points 36h and 72h.The cell PBS centrifuge washing collected 3 times, adds SDS-PAGE sample buffer, and after boiling 5min process, 12.5% separation gel electrophoresis, coomassie brilliant blue R250 dyes.Be respectively for the antibody that three of detecting GP5-Cap albumen are main in Westrn-blot test: mouse-anti HIS6 monoclonal antibody, the anti-porcine reproductive and respiratory syndrome virus of pig (PRRSV) and PCV2 polyclonal antibody.IgG and HRP of the horseradish peroxidase-labeled of two anti-sheep anti mouses and rabbit conjugation.Utilize the visible protein band of ECL chemical luminescence reagent kit.
Four. confocal microscopy observation
Utilize confocal microscope can carry out protein positioning analysis intuitively.Sf-9 cell is cultivated at sterile cover slips (six orifice plates), and the MOI then infected is 10.Infection two days later in-20 DEG C use methanol/acetone (1: 1) fix 5 minutes, PBS clean, after stop 30 minutes in 37 DEG C with 2% bovine serum albumin.Then cell and primary antibody are hatched 1 hour at 37 DEG C, then wash three times with PBS.Control group cell processes with same step.
Five. Virus purification and immunogold electron microscopic detection
The MOI that recombinant baculovirus propagates the sf-9 cell infected is 0.1, then infects latter 4th day, and the production carrying out extensive baculovirus is reclaimed.Twice sucrose gradient centrifugation purified virus supernatant is carried out according to standard method.Recombinant baculovirus purity analysis is carried out by Immuno gold electron microscope.Immunoelectron microscope operates according to explanation.Briefly, pure carbon film to float in the baculovirus solution of 10 μ l purifying 1 hour, and 1%BSA closes and washs 3 about 5min with PBS after 1 hour, and anti-PRRSV and PCV2polyclonal antibody that is rear and pig cultivates 1 hour.PBS washs 3 times, and the gold grain of the mark rabbit anti-pig IgG antibody 10-nm of 30 minutes is exposed on grid.Wash 3 times with PBS, to dye to grid with 2% phospho-wolframic acid and check under being placed in transmission electron microscope.
Six, the immune efficacy inspection of weaned piglet multisystemic wasting syndrome subunit vaccine
Select the pig of 15 2 monthly age body weight 18 ~ 20 kilograms, after verifying and do not resist the antibody of PRRSV and PCV2 by virus neutralization tests in these pig bodies, around ear, carry out fundamental immunity, often organize 6, wherein PBS control group 3, respectively the 0th day and intramuscular injection immunity 1 × 10 in the 14th day
9the BacSC-Dual-GP5-Cap6 head pig, 1 × 10 of pfu
9the BacSC-Dual6 head pig of pfu (plaque forming unit) and PBS3 head pig.After fundamental immunity, when 14 and 28 days, gather serum specimen respectively carry out serological test.From whole blood during fundamental immunity 28 days, gather peripheral blood lymphocytes carry out lymphocyte proliferation assay.Serum is used for ELISA titration.
The beneficial effect that the present invention obtains comprises:
1. the present invention's success pcr amplification PRRSV-GP5 gene and PCV2-Cap gene and build high efficiency recombinant expressed plasmid BacSC-Dual-GP5-Cap;
2. the recombinant protein expressed by recombinant strain of the present invention, its Product Expression output is very high.
3. be safe with the BacSC-Dual-GP5-Cap subunit vaccine goods of development to this animal.Vaccine immunity efficacy test results shows, when just exempting from 14 days, GP5-Cap specific antibody can be detected in the pig body of immune BacSC-Dual-GP5-Cap.After booster immunization, GP5-Cap specific antibody level rapidly increases to 1: 17.6.Therefore PRRSV and PCV2 utilizing gene engineering method to develop has good immunogenicity, this subunit vaccine pig blue-ear disease and pig circular ring virus 2 anti-processed in will have application prospect very widely.
Wherein, embodiment part is as undeclared, then the biotechnological means such as all molecular clonings, conversion is all with reference to " Molecular Cloning: A Laboratory guide " (work such as J. Pehanorm Brooker, Science Press publishes, the third edition)
In recombinant expression vector provided by the invention and construction process, recombinant virus strain and application, recombinant protein and subunit vaccine, raw materials used and reagent all can be buied by market.
Below in conjunction with embodiment, set forth the present invention further:
Embodiment 1: the structure of recombinant expression plasmid BacSC-Dual-GP5-Cap and the expression of recombinant plasmid
1. materials and methods
1.1PCR amplification PRRSV-GP5 and PCV2-Cap gene
With the recombinant plasmid pT-PCV of the GP5 protein gene of pig blue ear T1 strain and PCV2 Henan A strain (Genebank accession number: AY035820) full-length genome for template, P1, P2, P3 and P4 are primer amplification PRRSV-GP5 and PCV2-ORF2 gene.
The structure of 1.2 eukaryotic expression recombinant plasmid BacSC-Dual-GP5-Cap
PCR primer is reclaimed and purifying, through XhoI, XbaI, PstI and EcoR be double digestion respectively, connect, and by connect product GP5-Cap be cloned into there is identical restriction enzyme site expression vector BacSC-Dual (purchased from American Invitrogen company) on, obtain the restructuring eucaryon plasmid BacSC-Dual-GP5-Cap of natural expression GP5-Cap gene (by PRRSV-GP5 and PCV2-Cap gene clone to the collection of illustrative plates of baculovirus BacSC-Dual carrier, see Fig. 2), confirm to build correctly by the qualification of XhoI and EcoR double digestion and PCR qualification, order-checking confirms to mismatch without base.The PCR of plasmid BacSC-Dual-GP5-Cap and enzyme are cut qualification result and are seen Fig. 1.
1.3 recombinant expression plasmid transfection and plaque assay
According to carrying out in steps of product manual (Invitrogen company).To digest sf-9 monolayer cell, and proceed in 6 orifice plates, and treat that plating cells density will carry out transfection 80%, transfectional cell cultivates 5h in 27 DEG C, and the substratum of transfection replaces with fresh substratum.
Get transfectional cell culture supernatant and do Plaque Clone and shaker test.Plaque is tested: the viral cultures supernatant adopting 10 times of serial dilutions, inoculation meadow covet noctuid 9 (sf-9) cell in, 1h is made in 28 DEG C of senses, be that 1% agarose-GraceShi complete culture solution covers after (including 150 μ g/mLX-gal) solidifies and is inverted in 28 DEG C of incubators and cultivates 4 with final concentration after sucking-off inoculation liquid, day by day the appearance of dark blue plaque is observed, with glass capillary picking locus coeruleus, set to 0 in .5mL serum-free GraceShi nutrient solution and blow and beat, sf-9 cell is inoculated with this, repeatedly carry out the Plaque Clone screening of 3 recombinant baculovirus, obtain virus titer and press plaque forming unit (pfu/mL) calculating.
The expression of 1.4 recombinant proteins and SDS-PAGE, Westernblot analyze
Get the new sf-9 cell cultivated, inoculum size is 0.1 infectious unit, gathers in the crops virocyte culture after inoculation 5 ~ 7 ages in days.During expression of recombinant proteins, inoculum size is 5 infectious units, collects cell culture by different time points 36h and 72h.The cell PBS centrifuge washing collected 3 times, adds SDS-PAGE sample buffer, and after boiling 5min process, 12.5% separation gel electrophoresis, coomassie brilliant blue R250 dyes.(1: 3000 dilution of mouse-anti HIS6 monoclonal antibody is respectively for the antibody that three of detecting GP5-Cap albumen are main in Westrn-blot test, Invitrogen company), (antibody 1: 200 times dilutes the anti-porcine reproductive and respiratory syndrome virus of pig (PRRSV) with pig annulus 2 type (PCV2) polyclonal antibody, thered is provided by CDC respectively, Qingdao, China).IgG and HRP (1: 3000 dilution, Invitrogen company) of the horseradish peroxidase-labeled of two anti-sheep anti mouses and rabbit conjugation.The visible protein band of ECL chemical luminescence reagent kit (Pharmacia company, New Territory, Hong Kong) is utilized to the results are shown in Figure 3,4.
1.5 confocal microscope
Utilize confocal microscope can carry out protein positioning (LSM510META, Zeiss, Germany) analysis intuitively.Sf-9 cell is cultivated at sterile cover slips (six orifice plates), then (infection multiplicity (MOI) calculates according to infection titer the MOI infected, namely the viral number of cells infected ability and the ratio of cell count is had, instead of total virus number.General MOI is 50 ~ 100.) be 10.Infection two days later in-20 DEG C use methanol/acetone (1: 1) fix 5 minutes, PBS clean, after stop 30 minutes in 37 DEG C with 2% bovine serum albumin.Then cell and primary antibody (the anti-PRRSV polyclonal antibody of pig, the extent of dilution of 1: 100 and the anti-PCV2 polyclonal antibody of pig, 1: 100 dilution) are hatched 1 hour at 37 DEG C, then wash three times with PBS.Control group cell processes with same step.The results are shown in Figure 5.
1.6 Virus purification and immunogold electron microscopic detection
The MOI that recombinant baculovirus propagates the SF-9 cell infected is 0.1, then infects latter 4th day, and the production carrying out extensive baculovirus is reclaimed.Twice sucrose gradient centrifugation purified virus supernatant is carried out according to standard method.Recombinant baculovirus purity analysis is carried out by Immuno gold electron microscope.Immunoelectron microscope operates according to explanation.Briefly, pure carbon film to float in the baculovirus solution of 10 μ l purifying 1 hour, and 1%BSA closes and washs 3 about 5min with PBS after 1 hour, and rear and anti-PRRSV and the PCV2polyclonal antibody of pig (dilute at 1: 100) cultivates 1 hour.PBS washs 3 times, and the gold grain (1: 50 dilution, Sigma company) of the mark rabbit anti-pig IgG antibody 10-nm of 30 minutes is exposed on grid.Wash 3 times with PBS, to dye to grid with 2% phospho-wolframic acid (Sigma company, St. Louis, the U.S.) and check under being placed in transmission electron microscope.(H-7500, Hitachi) the results are shown in Figure 6.
2 results
2.1PRRSV-GP5 and PCV2-ORF2 gene amplification and clone
The DNA product that pcr amplification obtains, size is consistent with desired design, shows recombinant plasmid the result with restriction enzyme and PCR, containing GP5-Cap gene inside the recombinant plasmid of structure, connects correct.Order-checking shows, amplification to goal gene fragment reach 96.3% with the gene homology to have delivered, show that this gene has very high conservative property.
2.2 recombinant expression plasmid plaque assay results
Through 3 circulation Plaque Clones, obtain that a strain is stablized, the recombinant baculovirus of high expression GP5-Cap gene, virus titer is 1.28 × 10
8pfu/ml, the plaque that recombinant virus produces, in blue reaction, contrasts the reaction that is creamy white.
The biological deposits of recombinant virus strain provided by the invention is numbered CGMCCNo.2389.
2.3 expression of recombinant proteins and SDS-PAGE, Westernblot analytical results
Recombinant baculovirus inoculation sf-9 cell, collects sample by different time and carries out SDS-PAGE electroresis appraisal.As shown in Figure 3, occur target protein band at about 52kDa place, inoculation 72h expression of recombinant proteins peaks.
Westernblot analyzes (Fig. 4) and shows, the cell infected by BacSC-Dual-GP5-Cap occurs that molecular weight is about the albumen of 52kDa, the monoclonal antibody of anti-His6 detected respectively, anti-PRRSV and PCV2 polyclonal antibody at it.The GP5-Cap albumen of result and prediction is in the same size.In contrast, in control group (BacSC-Dual), anti-PRRSV and PCV2 antibody is not detected.
2.4SF-9 the display of cell surface GP5-Cap albumen
In order to determine whether the GP5-Cap albumen that His marks correctly transfers to Sf-9 cell surface, sterilizing culture dish is cultivated, infect the BacSC-Dual of baculovirus BacSC-Dual-GP5-Cap or MOI10 respectively, and carry out immunofluorescence label/infect utilizing confocal microscopy in latter 2 days.As shown in Figure 5, confocal microscopy observation result shows, GP5-Cap albumen is shown in infected SF-9 surface of cell membrane.
The display of 2.5 baculovirus surface GP5-Cap albumen
In order to verify whether GP5-Cap albumen is successfully presented at baculovirus on the surface, BacSC-Dual-GP5-Cap and BacSC-Dual recombinant baculovirus carries out purifying by saccharose gradient ultracentrifuge method, and uses primary antibodie (anti-PRRSV and PCV2 antibody) and the anti-pig IgG two of rabbit to resist the combination with the gold grain of 10-nm with Immuno gold electron microscope observation.Fig. 6 shows, purified BacSC-Dual-GP5-Cap recombinant plasmid and BacSC-Dual carrier, be there is by Immuno gold electron microscope observation the gold grain (A) of anti-PRRSV, the gold grain (B) of anti-PCV2, and the surface of empty carrier BacSC-Dual there is not gold grain, show that GP5-Cap albumen is successfully presented at baculovirus surface.
Embodiment 2: weaned piglet multisystemic wasting syndrome subunit vaccine of the present invention is to the biological experiment of piglet immunological effect
1 experiment material
The ELISA titre of 1.1 immunity and mensuration GP5-Cap albumen
·
Zooperal complete be according to international animal benefits scales and meet international animal protection and laboratory animal use defined code.
1.2 virus neutralization tests
Carry out the mensuration of PRRSV and PCV2 Neutralization effect in porcine blood serum, use foregoing fluorescent confocal neutralization test method (people such as Wang, 2006) after primary vaccination the 14th and within 28 days, detect.Serum (50 μ l) doubling dilution, in DMEM substratum (pH7.0), is started with the extension rate of 1: 2.Add isopyknic PRRSV and PCV2 (200TCID50) solution to serum sample, cultivate 1h in 37 DEG C.Then be inoculated in 96 orifice plates by this mixture, it contains 40% to the 50% PK-15 cell converged.After cultivation 72h, add 90% acetone and fix culture plate, drying is also hatched with anti-PCV2 polyclonal antibody, and the anti-pig IgG antibody of the goat then utilizing FITC (fluorescein isothiocyanate) to mark (Invitrogen company) dyes.The mensuration of serum titration degree is according to the inverse of maximum serum dilution 70% or the minimizing observing larger fluorescence stove in cells infected under fluorescent microscope.
1.3. lymphocyte proliferation assay
The peripheral blood lymphocytes (PBMCs) of pig is used to carry out lymphocyte proliferation assay.Use lymphocyte separation medium (TBD, Shanghai, China) separating periphery blood monocytic cell from the whole blood of immune swine.After washing 3 times with HankShi damping fluid (pH7.2), with the RPMI-1640 nutrient solution suspension PBMCs about 5 × 10 adding 10% foetal calf serum
6individual cell/ml, is seeded in every hole 100 μ l on 96 hole flat undersides.Subsequently, every hole adds 20 μ gPRRSV and 20 μ gPCV2.Concanavalin A (5 μ g/ml, Sigma company) is as positive control.The sample of each peripheral blood lymphocytes is divided into three parts.The mtt assay of standard is utilized to measure cell-proliferation activity.Cultivate 68 hours at 37 DEG C of 5%CO2, every hole adds 20 μ l3-(4,5-lutidine-2-alkyl) 2,5-diphenyltetrazolium bromide (MTT, 5mg/ml, Sigma company, holy St. Louis, the U.S.) and cultivates 4h further.After 4h, add 100 μ l methyl-sulphoxide (DMSO) termination reactions.Measure optical density(OD) (OD value) at 490nm place, stimulation index (SI) is calculated as follows: the OD value of the mean OD value/unprovoked cell of the cell that SI=stimulates by PCV2.
2 results
2.1. the immunne response of recombinant baculovirus
This research studies its immunne response effect by pig ear intramuscular injection BacSC-Dual-GP5-Cap, BacSC-Dual and PBS.GP5-Cap specific ELISA antibody detection is carried out when just exempting from latter 14th day and 28 days.As shown in Figure 5, when just exempting from 14 days, in the pig body of immune BacSC-Dual-GP5-Cap, GP5-Cap specific antibody can be detected.After booster immunization, GP5-Cap specific antibody level rapidly increases to 1: 17.6.As expected, all GP5 and Cap specific antibody is not detected in all pig bodies of immune BacSC-Dual and PBS.Statistically significant difference (P < 0.05).These data show, insect baculovirus BacSC-Dual-GP5-Cap successfully can stimulate the generation of GP5 and Cap specific ELISA antibody.
2.2 virus neutralization tests results
Adopt the report such as wang (.Constructionandimmunogenicityofrecombinantadenovirusexp ressingthecapsidproteinofporcinecircovirus2 (PCV2) inmice.Vaccine such as wangX, 2006, the neutralizing antibody detection method of PRRSV and PCV2 24:3374-3380), detect the neutralizing antibody level of anti-PRRSV and PCV2 of specificity in serum, result shows that the initial immunity BacSC-Dual-GP5-Cap pig of the 14th day produces PRRSV and PCV2 antibody titer and is respectively 1: 3.6, 1: 12.8 is increased to further 28 days time.In PRRSV and PCV2 of this result and report and titre be 1: 14 (Panet people, the people such as 2008 Nian Fan, 2008) be consistent.In whole experimentation, the porcine blood serum of immune BacSC-Dual and PBS does not have Neutralization antibody.The virucidin's titre producing GP5 and Cap protein antibody is significantly higher than negative control group BacSC-Dual and PBS (P < 0.05, t-text).
2.3. lymphocyte proliferation assay result
Initial immunity was carried out lymphproliferation response inspection after 28 days.As shown in Figure 5, its SI value (3.54 ± 0.37) of pig of immune BacSC-Dual-GP5-Cap is apparently higher than the pig of immune BacSC-Dual (1.34 ± 0.11) and PBS (1.09 ± 0.06).Significant difference has statistical significance (P < 0.05).The SI value that concanavalin A (positive control) controls is 4.11 ± 0.24, concanavalin A efficient work. above result shows, gene recombination baculovirus BacSC-Dual-GP5-Cap can induce pig to produce significant cellullar immunologic response equally.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (10)
1. a recombinant expression vector, is characterized in that, forms by having the PRRSVGP5 gene fragment of nucleotide sequence as shown in SEQIDNo.1, the PCV2Cap gene fragment with nucleotide sequence as shown in SEQIDNo.2 and plasmid vector recombination to construct.
2. recombinant expression vector according to claim 1, it is characterized in that, it has the gene fragment of the PRRSVGP5 of nucleotide sequence as shown in SEQIDNo.1 described in expression vector BacSC-Dual inserts between itself KpnI and SmaI restriction enzyme site, and described expression vector BacSC-Dual inserts the PCV2Cap gene fragment acquisition of nucleotide sequence shown in SEQIDNo.2 between itself PstI and EcoRI restriction enzyme site.
It inserts gp64CAD, gp64TM by expression vector BacSC-Dual between itself KpnI and SmaI restriction enzyme site, the PRRSVGP5 gene fragment of nucleotide sequence, His6, gp64ss as shown in SEQIDNo.1, and described expression vector BacSC-Dual inserts the PCV2Cap gene fragment of nucleotide sequence shown in gp64ss, His6, SEQIDNo.2 between itself BamHI and HindIII restriction enzyme site, gp64TM, gp64CAD obtain.
3. a construction process for recombinant expression vector as claimed in claim 1 or 2, is characterized in that, comprises the steps:
Step 1: amplification obtains the PRRSVGP5 gene fragment of nucleotide sequence as shown in SEQIDNo.1;
Step 2: amplification obtains the gene fragment of the PRRSVGP5 of nucleotide sequence as shown in SEQIDNo.1;
Step 3: by described expression vector BacSC-Dual through XhoI, XbaI, PstI and EcoR double digestion respectively, the PRRSVGP5 gene fragment of such as nucleotide sequence shown in SEQIDNo.1 and the such as gene fragment of the PRRSVGP5 of nucleotide sequence shown in SEQIDNo.1 are transformed and is connected, obtain described recombinant expression vector.
4. a recombinant virus strain, is characterized in that, is formed through packing cell packaging by recombinant expression vector as claimed in claim 1 or 2.
5. recombinant virus strain according to claim 4, is characterized in that, its biological deposits is numbered CGMCCNo.2389 and CGMCCNo.2657.
6. the recombinant baculovirus strain according to claim 4 or 5 prevents and/or treats the application of the pharmaceutical preparation of PRRSV infection relative disease and/or PCV2 infection relative disease in preparation.
7. application according to claim 6, is characterized in that, described PRRSV infection relative disease is porcine reproductive and respiratory syndrome; It is multisystemic exhaustion syndrome that described PCV2 infects relative disease.
8. the recombinant protein of the recombinant virus strain expression as described in claim 4 or 5.
9. recombinant protein according to claim 8, is characterized in that, its aminoacid sequence is as shown in SEQIDNo.3.
10. a subunit vaccine, is characterized in that, comprises:
(I) recombinant protein that recombinant virus strain as described in claim 4 or 5 is expressed or reach the albumen of more than 80% with its homology;
And/or
(II) recombinant protein as claimed in claim 8 or reach the albumen of more than 80% with its homology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510257530.9A CN105039405A (en) | 2015-05-20 | 2015-05-20 | Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510257530.9A CN105039405A (en) | 2015-05-20 | 2015-05-20 | Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039405A true CN105039405A (en) | 2015-11-11 |
Family
ID=54446375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510257530.9A Pending CN105039405A (en) | 2015-05-20 | 2015-05-20 | Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039405A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018233264A1 (en) * | 2017-06-19 | 2018-12-27 | 普莱柯生物工程股份有限公司 | Immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens and use thereof |
-
2015
- 2015-05-20 CN CN201510257530.9A patent/CN105039405A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| KARNIYCHUK,U ET AL: "Porcine respiratory and reproductive syndrome virus GP5 gene, complete cds", 《GENBANK: EU926972.1》 * |
| TAKAHAGI,Y ET AL: "Porcine circovirus 2 cap gene for capsid protein, complete cds, strain: O6443", 《GENBANK: AB512135.1》 * |
| XIN-GANG XU ET AL: "Baculovirus as a PRRSV and PCV2 bivalent vaccine vector: Baculovirus virions displaying simultaneously GP5 glycoprotein of PRRSV and capsid protein of PCV2", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 扈鸿霞等: "PRRSV GP5 基因的原核表达及其免疫性分析", 《动物医学进展》 * |
| 许信刚等: "ＰＲＲＳＶ ＧＰ３蛋白和ＰＣＶ－２Ｃａｐ蛋白在杆状病毒囊膜表面的共展示及展示蛋白的小鼠免疫试验", 《中国兽医科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018233264A1 (en) * | 2017-06-19 | 2018-12-27 | 普莱柯生物工程股份有限公司 | Immunogenic composition comprising porcine circovirus type 3 and porcine circovirus type 2 antigens and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112076315A (en) | Nano antigen particle fused with new coronavirus S protein and ferritin subunit, new coronavirus vaccine, and preparation method and application thereof | |
| US5316910A (en) | Bioassay for influenza A and B nucleoprotein | |
| Stucker et al. | The role of evolutionary intermediates in the host adaptation of canine parvovirus | |
| CN110759973B (en) | Cell strain for expressing African swine fever virus CD2v protein and application thereof | |
| CN111848786B (en) | Monoclonal antibody, preparation method and application thereof | |
| CN111849923B (en) | Hybridoma cell 2D12 strain secreting monoclonal antibody against canine distemper virus H protein | |
| CN105331636A (en) | Recombination cell line for stable expression of classical swine fever virus E2 and application thereof | |
| Xu et al. | Baculovirus as a PRRSV and PCV2 bivalent vaccine vector: baculovirus virions displaying simultaneously GP5 glycoprotein of PRRSV and capsid protein of PCV2 | |
| CN109852622A (en) | A kind of solubility PCV3Cap albumen and its encoding gene and application | |
| CN109880838A (en) | A kind of recombinant virus and its preparation method and application of the O-shaped foot-and-mouth disease virus multi-epitope gene of secreting, expressing pig | |
| CN110317278A (en) | The fusion protein and its encoding gene of SVV and FMDV, expression vector, cell line, engineering bacteria and vaccine and application | |
| Premanand et al. | Induction of protective immune responses against EV71 in mice by baculovirus encoding a novel expression cassette for capsid protein VP1 | |
| CN102807970B (en) | Canine distemper virus (CDV) sensitive cell line and establishment method and application thereof | |
| CN109943592A (en) | Recombinant baculovirus transfer vector, recombinant baculovirus and the preparation method and application of the protein gene of gD containing porcine pseudorabies virus | |
| CN109134667A (en) | Fusion protein and preparation method thereof, application, expression system and vaccine | |
| Abid et al. | Generation and immunogenicity of a recombinant pseudorabies virus co-expressing classical swine fever virus E2 protein and porcine circovirus type 2 capsid protein based on fosmid library platform | |
| CN114874995B (en) | Swine fever virus 2E rns Monoclonal antibody hybridoma cell strain of protein and application | |
| Tung et al. | Baculovirus surface display of the HA protein of H5N2 avian influenza virus and its immunogenicity against a lethal challenge with H5N1 virus in chickens | |
| Sakoda et al. | Development and evaluation of indirect enzyme-linked immunosorbent assay for a screening test to detect antibodies against classical swine fever virus | |
| CN109182248A (en) | A kind of antibody against swine fever virus detection ELISA diagnostic kit | |
| CN102120988B (en) | Recombinant porcine circovirus type 2 strain expressing V5 epitope tag and application thereof | |
| CN105039373A (en) | Recombinant plasmid, recombinant virus vector, recombinant virus strain and application thereof, recombinant protein and subunit vaccine containing the same | |
| Xu et al. | Generation and evaluation of recombinant baculovirus coexpressing gp5 and m proteins of porcine reproductive and respiratory syndrome virus type 1 | |
| CN105039405A (en) | Recombinant expression vector and construction method thereof, recombinant virus strain and application thereof, recombinant protein and subunit vaccine | |
| CN105296507A (en) | Lassa fever virus-like particles as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 138000 Pioneer Street 1009, Songyuan Economic and Technological Development Zone, Jilin Province Applicant after: Jilin and Yuan bioengineering Limited by Share Ltd Address before: 138000 Pioneer Street 1009, Songyuan Economic and Technological Development Zone, Jilin Province Applicant before: JILIN HEYUAN BIOENGINEERING LIMITED COMPANY |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |