CN108126192B - Vaccine composition and application thereof - Google Patents
Vaccine composition and application thereof Download PDFInfo
- Publication number
- CN108126192B CN108126192B CN201611091776.4A CN201611091776A CN108126192B CN 108126192 B CN108126192 B CN 108126192B CN 201611091776 A CN201611091776 A CN 201611091776A CN 108126192 B CN108126192 B CN 108126192B
- Authority
- CN
- China
- Prior art keywords
- antigen
- avian
- virus
- vaccine
- vaccine composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5252—Virus inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10211—Aviadenovirus, e.g. fowl adenovirus A
- C12N2710/10234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/10011—Birnaviridae
- C12N2720/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Abstract
The invention relates to a vaccine composition, which comprises an immunizing dose of avian adenovirus penton protein or an immunizing dose of live vector containing recombinant avian adenovirus penton protein gene, and a pharmaceutically acceptable carrier. The vaccine composition can provide effective immune protection for the challenge of different serotypes of adenoviruses of chicken flocks, can provide 100 percent of protection rate at low content of immunogenic components, and shows good immune efficacy.
Description
Technical Field
The invention relates to a vaccine composition and application thereof, belonging to the field of biological medicine.
Background
Diseases of avian adenovirus infection (FADV) are infectious diseases caused by group I poultry adenovirus (FADV). FADV belongs to the Family of Adenoviridae (Family Adenovirdae), and the genome (gemone) is composed of linear double-stranded (double-stranded) DNA without segments.
The avian adenovirus is of a spherical structure without a capsule membrane, virus particles of the avian adenovirus are usually arranged in a lattice shape in an infected cell nucleus, each virus particle comprises 36kb of linear double-stranded DNA, the linear double-stranded DNA and core protein form a core with the diameter of 60-65 nm, and the core is wrapped in a capsid. The capsid is icosahedral and symmetrical, and consists of 252 capsomeres with diameters of 8-10 nm, the capsomeres are arranged on the surface of a triangle, 6 capsomeres are arranged on each side, 240 of the capsomeres are hexon (non-vertex capsomeres), and the other 12 capsomeres are penton bases (vertex capsomeres, penton proteins). Each penton substrate is combined with 2 fiber protrusions (fiber-1 protein and fiber-2 protein) with the length of 9-77.5 nm.
In recent years, the disease incidence caused by the avian adenovirus is suddenly increased, the broiler chickens at 3-5 weeks old are particularly harmful, and the death rate is suddenly increased to more than 80% in serious cases.
The vaccine immunization can effectively prevent the disease, however, in the prior art, because the avian adenovirus is not easy to culture and is difficult to obtain high-titer virus, especially different isolates have large difference, the prepared vaccine is often difficult to provide ideal immune effect, and the whole virus vaccine also has the risk in the aspect of biological safety caused by incomplete inactivation. The antigen component of the vaccine in the prior art is the hexon (240/252) which forms the main component of the virus capsid, but the immunity effect is low and the vaccine is not developed into a product.
Therefore, there is a clinical urgent need to develop a vaccine composition with good immune effect to effectively prevent the disease from spreading.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention provides a vaccine, a preparation method and application thereof, and the vaccine can effectively prevent the infection of the avian adenovirus.
The invention relates to a vaccine composition, wherein the vaccine composition comprises an immunizing dose of avian adenovirus penton protein or an immunizing dose of live vector containing recombinant avian adenovirus penton protein gene, and a pharmaceutically acceptable carrier. The vaccine composition of the invention contains immunogenic components which can effectively resist the attack of wild strains at low content.
The invention also relates to a method for preparing the vaccine composition, which comprises the following steps: cloning the gene of the poultry adenovirus penton protein; step (2) transforming and recombining the penton protein gene cloned in the step (1); expressing the recombinant avian adenovirus penton protein; step (4) separating and purifying the recombinant avian adenovirus penton protein, and treating the purified recombinant avian adenovirus penton protein by using a nonionic surfactant; and (5) mixing the treated avian adenovirus penton protein antigen and an adjuvant in proportion, and emulsifying.
The invention also relates to application of the vaccine composition in preparation of medicines for preventing and treating avian adenovirus infection.
After the poultry adenovirus penton protein gene is efficiently expressed, the prepared vaccine composition can prevent and/or treat the spread of the poultry adenovirus epidemic situation, and the vaccine composition containing the protein can enable an animal body to quickly generate antibodies after immunizing animals, has good prevention and control effects on the single or mixed infection of the currently epidemic poultry adenovirus, and has good biological safety. The vaccine composition prepared by adopting the poultry adenovirus penton protein for the first time has good immunogenicity, can completely protect chickens, and can prevent infection of various genotype poultry adenoviruses in clinical application.
Detailed Description
Hereinafter, embodiments of the present invention will be described.
The invention relates to a vaccine composition, wherein the vaccine composition comprises an immunizing dose of avian adenovirus penton protein or an immunizing dose of live vector containing recombinant avian adenovirus penton protein gene, and a pharmaceutically acceptable carrier.
The term "avian adenovirus" (FADV) belongs to the family adenoviridae, the genome of which is composed of linear double-stranded DNA without segmentation, and the clinical symptoms caused by the virus include sick chicken's chlorosis, crouch, feather fluffy, corona beard and face skin pallor, and poor growth. Pathological changes are characterized by catarrhal tracheitis and hydropericardium syndrome.
The avian adenovirus penton gene can also be applied to the development of expression vectors, live vectors, nucleic acid vaccines, diagnostic reagents and other medicaments related to preventing and/or treating avian adenovirus.
The invention discovers for the first time that the penton protein with extremely low surface content in avian adenovirus capsomere has good immunogenicity, and the prepared subunit antigen or the live vector containing the recombinant gene thereof can generate good immune efficacy after immunization, thereby providing 100% protection for chickens.
The live vector containing the recombinant gene of the avian adenovirus penton protein of the invention can be in the form of a live vector commonly used in the art, such as newcastle disease virus, poxvirus and salmonella attenuated vaccine strains.
The term "vaccine composition" as used herein refers to a pharmaceutical composition comprising the immunogenicity of avian adenovirus that induces, stimulates or enhances the immune response in chickens against avian adenovirus alone.
The term "immunizing amount" shall be understood as an "immunologically effective amount," also referred to as an immunoprotective amount or an amount effective to produce an immune response, of antigen effective to induce an immune response in a recipient, sufficient to prevent or ameliorate the signs or symptoms of disease, including adverse health effects or complications thereof. The immune response may be sufficient for diagnostic purposes or other testing, or may be suitable for use in preventing signs or symptoms of disease, including adverse health consequences or complications thereof caused by infection by a pathogen. Humoral immunity or cell-mediated immunity or both can be induced. The immune response of an animal to an immunogenic composition can be assessed indirectly, for example, by measuring antibody titers, lymphocyte proliferation assays, or directly by monitoring signs or symptoms after challenge with a wild-type strain, while the protective immunity provided by the vaccine can be assessed by measuring, for example, clinical signs such as mortality, reduction in morbidity, temperature values, overall physiological condition of the subject, and overall health and performance. The immune response may include, but is not limited to, induction of cellular and/or humoral immunity.
The term "avian adenovirus antigen" refers to any composition containing at least one form of avian adenovirus antigen that induces, stimulates or is capable of fighting an immune response against avian adenovirus infection, including but not limited to inactivated, attenuated or subunit antigens.
As an embodiment of the invention, the avian adenovirus penton protein has the protein sequence encoded by SEQ ID No. 1.
As an embodiment of the invention, the content of the avian adenovirus penton protein is AGP titer which is more than or equal to 1: 2.
In a preferred embodiment of the invention, the content of the avian adenovirus penton protein is 1:2 to 1:16 of AGP titer.
As an embodiment of the present invention, the pharmaceutically acceptable carrier includes an adjuvant, the adjuvant including: (1) alumino-gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) a copolymer of a polymer of acrylic acid or methacrylic acid, maleic anhydride and an alkenyl derivative; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide and Gel adjuvant;
preferably, the saponin is Quil A, QS-21, GPI-0100;
preferably, the emulsion is an SPT emulsion, an MF59 emulsion, or an emulsion formed from an oil in combination with an emulsifier, the emulsion may be based on light liquid paraffin oil, isoprenoid oil resulting from the oligomerization of olefins (such as squalane or squalene oil, oil resulting from the oligomerization of olefins, in particular isobutene or decene), linear alkyl-containing esters of acids or alcohols (more particularly vegetable oil, ethyl oleate, propylene glycol di- (caprylate/caprate), glycerol tri- (caprylate/caprate) or propylene glycol dioleate), esters of branched fatty acids or alcohols (in particular isostearate); the emulsifier is a nonionic surfactant (especially esters of polyoxyethylated fatty acids (e.g. oleic acid), sorbitan, mannide (e.g. anhydrous mannitol oleate), aliphatic diols, glycerol, polyglycerol, propylene glycol and oleic, isostearic, ricinoleic or hydroxystearic acid, which may be ethoxylated, ethers of fatty alcohols and polyhydric alcohols (e.g. oleyl alcohol), polyoxypropylene-polyoxyethylene block copolymers (especially
In particular L121));
preferably, the polymer of acrylic acid or methacrylic acid is a crosslinked polymer of acrylic acid or methacrylic acid, in particular a compound carbomer crosslinked with polyalkenyl ethers or polyalcohols of sugars, preferably carbopol 974P, 934P and 971P;
preferably, the copolymer of maleic anhydride and alkenyl derivative is a copolymer EMA of maleic anhydride and ethylene;
preferably, the adjuvant is a white oil adjuvant, and a water-in-oil emulsion is prepared;
the concentration of the adjuvant ranges from 5% to 70% V/V, preferably from 30% to 70%, more preferably 66% V/V.
The term "veterinarily acceptable carrier" refers to all other ingredients in the vaccine composition of the present invention, except the avian adenovirus antigen, that do not stimulate the body and do not hinder the biological activity and properties of the compound used, or a diluent, preferably an adjuvant. The term "adjuvant" may include an alumina gel adjuvant; saponins (saponin), such as Quil A, QS-21(Cambridge Biotech Incorporation, Cambridge MA), GPI-0100(Galenica Pharmaceuticals Incorporation, Birmingham AL); a water-in-oil emulsion; an oil-in-water emulsion; a water-in-oil-in-water emulsion; polymers of acrylic acid or methacrylic acid; maleic anhydride and alkenyl (alkenyl) derivatives. The term "emulsion" may be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oils (isoprenoid oils) resulting from the oligomerization of olefins, such as squalane (squalane) or squalene oil (squalene oil), in particular isobutene or decene; linear alkyl-containing esters of acids or alcohols, more particularly vegetable oils, ethyl oleate, propylene glycol di- (caprylate/caprate), glycerol tri- (caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, especially isostearic acid esters. The oil is used in combination with an emulsifier to form an emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (such as, for example, anhydrous mannitol oleate), of aliphatic diols (glycols), of polyglycerols, of propylene glycol and of oleic acid, of isostearic acid, of ricinoleic acid or of hydroxystearic acid, which are optionally ethoxylated, and also polyoxypropylene-polyoxyethylene block copolymers, in particular the Pluronic products, in particular L121. See The description of The same and The reactive application of adjuvants by Hunter et al (Ed. by DES Stewart-Tull, John Wiley and Sons, New York,1995:51-94) and The description of Vaccine by Todd et al (1997,15: 564-570). For example, the SPT emulsion described on page 147 and the MF59 emulsion described on page 183 of Vaccine design, the Subunit and adivant propaach (Plenum Press,1995) written by Powell M and Newman M can be used. The term "polymer of acrylic or methacrylic acid" is preferably a crosslinked polymer of acrylic or methacrylic acid, in particular a polyalkenyl ether or polyalcohol crosslinked with a sugar (sugar), these compounds being known under the name Carbomer (Carbopol, trade name Carbopol) (Phameuropa,1996,8 (2)). Those skilled in the art can also see US2909462, which describes such acrylic polymers crosslinked with polyhydroxylated compounds having at least 3 hydroxyl groups, preferably not more than 8, wherein the hydrogen atoms of at least 3 hydroxyl groups are substituted by unsaturated aliphatic hydrocarbon groups (aliphatic radial) having at least 2 carbon atoms. Preferred groups are those containing 2 to 4 carbon atoms, such as vinyl, allyl and other ethylenically unsaturated groups (ethylenically unsaturated groups). The unsaturated groups may themselves contain other substituents, such as methyl. These products are sold under the name carbopol, (BF Goodrich, Ohio, USA) are particularly suitable. They are crosslinked with allyl sucrose or with allyl pentaerythritol. Among these, mention may be made of carbopols 974P, 934P and 971P, the most preferred being the use of carbopol 971P. The term "copolymers of maleic anhydride and alkenyl derivative" also contemplates the maleic anhydride and ethylene copolymers ema (monsanto), which are dissolved in water to give an acidic solution, neutralized, preferably to physiological pH, in order to give an adjuvant solution into which the immunogenic, immunogenic or vaccinal composition itself can be incorporated. The term "adjuvant" also includes, but is not limited to, the RIBI adjuvant system (Ribi Incorporation), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A (monophosphoryl lipid A), Avridine lipoamine adjuvant, E.coli heat labile enterotoxin (recombinant or otherwise), cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant, and the like. Preferably, the adjuvant comprises one or more of an alumina Gel adjuvant, a saponin, a water-in-oil emulsion, an oil-in-water emulsion, a water-in-oil-in-water emulsion, a polymer of acrylic acid or methacrylic acid, a copolymer of maleic anhydride and an alkenyl (alkenyl) derivative, a RIBI adjuvant system, a Block co-polymer, SAF-M, a monophosphoryl lipid A, Avridine lipid-amine adjuvant, escherichia coli heat labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide or Gel adjuvant.
The pentton proteins of the invention may be prepared by any method known in the art, for example, the pentton proteins may be prepared by recombinant expression of the pentton gene using any known expression system, for example: eukaryotic expression systems and prokaryotic expression systems. Or directly synthesizing the penton protein sequence.
As an embodiment of the invention, the vaccine composition of the invention comprises a penton protein antigen with an AGP titer of more than or equal to 1: 2.
As one embodiment of the invention, the vaccine composition of the invention comprises a penton protein antigen with AGP titer being more than or equal to 1:2, which is encoded by SEQ ID NO.1 of the sequence Listing.
In one embodiment of the invention, the vaccine composition comprises a penton protein antigen with an AGP titer of 1: 2-1: 16.
As an embodiment of the invention, the vaccine composition comprises a penton protein antigen with AGP titer of 1: 2-1: 16, which is encoded by SEQ ID NO.1 of the sequence table.
As an embodiment of the invention, the vaccine composition according to the invention comprises a penton protein antigen with an AGP titer of 1: 4.
As an embodiment of the invention, the vaccine composition of the invention comprises a penton protein antigen with AGP titer of 1:4, which is encoded by SEQ ID NO.1 of the sequence Listing.
As an embodiment of the present invention, the vaccine composition further comprises one or more other antigens, said other antigens comprising chicken newcastle disease virus antigen, avian influenza virus antigen, chicken infectious bronchitis virus antigen, chicken infectious bursal disease virus antigen, egg drop syndrome virus antigen, avian reovirus antigen, escherichia coli antigen, avibacterium paragallinarum antigen, mycoplasma synoviae antigen, mycoplasma gallisepticum antigen, pasteurella multocida antigen, marek's virus antigen, avian encephalomyelitis virus antigen, chicken infectious laryngotracheitis virus antigen. As an embodiment of the present invention, the vaccine composition further comprises one or more other antigens, wherein the other antigens are inactivated antigens of newcastle disease virus, avian influenza virus, avian infectious bronchitis virus, avian infectious bursal disease virus antigen VP2 protein, and inactivated antigens of egg drop syndrome virus.
The vaccine composition of the present invention further comprises other pathogens or antigens for use in combination to prepare a combination vaccine or composite vaccine against various diseases including avian adenovirus infection.
The term "combination vaccine" refers to a vaccine prepared from a viral mixture of an avian adenovirus of the invention and at least one different virus. The term "combination vaccine" refers to a vaccine prepared from the avian adenovirus and bacteria of the present invention. For example, the avian adenovirus of the present invention may be mixed or combined with newcastle disease virus, infectious bronchitis virus, avian influenza virus, infectious bursal disease virus, egg drop syndrome virus, avian reovirus and/or escherichia coli, avibacterium paragallinarum, mycoplasma synoviae, mycoplasma gallisepticum.
As a preferred embodiment of the invention, the newcastle disease virus antigen is an N7a strain inactivated antigen, the avian influenza virus antigen is an SZ strain inactivated antigen, the avian infectious bronchitis virus antigen is an M41 strain inactivated antigen, the avian infectious bursal disease virus antigen is VP2 protein, and the egg drop syndrome virus antigen is an AV-127 strain inactivated antigen.
As a preferred embodiment of the invention, the content of the avian adenovirus penton protein is AGP titer of 1: 2-1: 16, and the content of the chicken Newcastle disease virus antigen is 10 before inactivation8.0～109.0EID500.1ml, the content of the avian influenza virus is 10 before inactivation6.5～108.5EID500.1ml, the virus content of the avian infectious bronchitis is 10 before inactivation6.0～107.0EID500.1ml, the content of the chicken infectious bursal disease virus antigen VP2 protein is AGP titer of 1: 16-1: 128, and the content of the egg drop syndrome virus antigen is 10 before inactivation7.0～108.0EID50/0.1ml。
In a further preferred embodiment of the invention, the content of the avian adenovirus penton protein is AGP titer of 1: 2-1: 16, and the content of the chicken Newcastle disease virus antigen is 10 before inactivation8.0EID50/0.1ml, the content of the avian influenza virus is 10 before inactivation8.0EID500.1ml, the virus content of the avian infectious bronchitis is 10 before inactivation6.0EID500.1ml, the content of the chicken infectious bursal disease virus antigen VP2 protein is AGP titer 1:16, and the content of the egg drop syndrome virus antigen is 10 before inactivation .70EID50/0.1ml。
The vaccine composition of the present invention may further comprise other agents added to the composition of the present invention.
As one embodiment of the present invention, the pharmaceutically acceptable carrier includes drugs, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives; the immunostimulant includes alpha-interferon, beta-interferon, gamma-interferon, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), and interleukin 2(IL 2). To prepare such compositions, methods well known in the art may be used.
The invention also relates to a method for preparing the vaccine composition, which comprises the following steps: cloning the gene of the avian adenovirus penton protein; step (2) transforming and recombining the penton protein gene cloned in the step (1); expressing the recombinant avian adenovirus penton protein; step (4) separating and purifying the recombinant avian adenovirus penton protein, and treating the purified recombinant avian adenovirus penton protein by using a nonionic surfactant; and (5) mixing the avian adenovirus penton protein antigen and an adjuvant in proportion, and emulsifying.
The invention also relates to application of the vaccine composition in preparing a medicament for preventing and treating avian adenovirus infection.
The term "preventing and/or treating" when referring to an avian adenovirus infection means inhibiting replication of an avian adenovirus, inhibiting transmission of an avian adenovirus or preventing colonization of an avian adenovirus in its host, and alleviating the symptoms of an avian adenovirus infected disease or disorder. Treatment is considered to be therapeutically effective if the viral load is reduced, the condition is reduced and/or the food intake and/or growth is increased.
The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.
The chemical reagents used in the examples of the present invention are all analytical reagents and purchased from the national pharmaceutical group.
In order that the invention may be more readily understood, reference will now be made to the following examples. The experimental methods are conventional methods unless specified otherwise; the biomaterial is commercially available unless otherwise specified.
Example 1 construction of pET28a _ FADV _ penton expression vector
Extraction of 1FADV Virus DNA
The plasmid extraction kit is purchased from a Tiangen organism; t4 DNA Ligase was purchased from BioLab; the pET28a plasmid was purchased from Novagen; the agarose gel recovery kit is purchased from Tianze biology, and other reagents are analytically pure.
According to the instruction of the virus DNA extraction kit, 0.2ml of chicken liver suspension infected with avian adenovirus FAV-HN strain (fowladenovirus, FAV-HN strain (strain FAV-HN) with the preservation number of CCTCC NO. V201609, the preservation unit of China center for type culture Collection, the preservation address of university of Wuhan and Wuhan, China, and the preservation time of 2016, 2, 29 days) is put into a sterile 1.5ml centrifuge tube, 0.4ml of VB is added into the sample liquid, and the mixture is mixed by vortex and kept stand for 10 minutes at room temperature. 0.45ml of AD buffer was added to the sample solution and mixed vigorously. Putting a VB column into a 2ml collecting tube, adding 0.6ml of mixed liquor into the VB column, centrifuging for 1 minute at 14000g, adding the rest mixed liquor into the VB column, centrifuging for 1 minute at 14000g, discarding the 2ml collecting tube, putting the VB column into a new 2ml collecting tube, adding 0.4ml of W1buffer, centrifuging for 30 seconds at 14000g, adding 0.6ml of buffer into the VB column, centrifuging for 30 seconds at 14000g, emptying for 3 minutes, adding 50ul of RNase free water to place in the center of a membrane, standing for 3 minutes, centrifuging for 1 minute at 14000g, and obtaining a centrifuged liquid as a DNA genome.
2penton Gene amplification
Oligonucleotide primers were synthesized based on the conserved region sequences at the 5 'and 3' ends of the penton gene, and PCR was performed. The primer sequences are shown in Table 1.
TABLE 1 Penton Gene primers
| penton-f | CATGCCATGGTGGGGGTTGCAGCCG |
| penton-r | CCCAAGCTTCTACTGCAAGGTCGCGG |
The PCR product was sequenced by Invitrogen company, and the sequence of the penton gene is shown in SEQ ID No.1 of the sequence Listing.
3 expression vector construction
The correct PCR product will be sequenced and ligated into the pET28a plasmid via the enzyme cleavage site. After the ligation, escherichia coli BL21(DE3) was transformed with the plasmid, and a single clone was selected and cultured overnight in LB medium containing 100 μ g of kanamycin, and after plasmid extraction and sequencing analysis, the positive clone was the pET28a _ FADV _ penton expression strain.
Example 2 preparation of Penton protein
The strain containing pET28a _ FADV _ penton/E.coli BL21(DE3) prepared in example 1 was inoculated into LB medium containing 50 to 100. mu.g/ml kanamycin in an amount of 1% (V/V), and cultured with shaking at 37 ℃. When OD600 ═ 0.4 to 0.6, the mixture was left at 28 ℃ for 30 minutes. Isopropyl-. beta. -D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 to 1.0mM, and shaking culture was carried out at 28 ℃ for 24 hours. CulturingAfter completion, the cells were collected, resuspended in PBS (sodium chloride, 8g, potassium chloride, 0.2g, disodium hydrogenphosphate, 1.44g, potassium dihydrogenphosphate, 0.24g, pH 7.4 adjusted, volume fixed 1L), sonicated, centrifuged and the supernatant was collected. The content of soluble target protein in the expression product is high, and the AGP titer of the penton protein reaches 1: 32, endotoxin content of 0.56X 105EU/ml。
Example 3 E.coli expression of Penton protein endotoxin removal
0.5ml of the solution to be treated and Triton X-114 (5. mu.l) at a final concentration of 1% (v/v) were added to a 1.5ml centrifuge tube and vortexed. The samples were placed on ice for 5 minutes. After vortexing the cooled samples, the tubes were immediately put into a 37 ℃ water bath for 5min to allow new two phases to develop. The sample was then centrifuged for 60s at 37 ℃. After centrifugation, the target protein will remain in the upper layer, and the endotoxin-containing detergent will remain in the bottom of the centrifuge tube in the form of oil droplets. The whole operation cycle was 3 times. The AGP titer of the penton protein was determined to reach 1: 32, endotoxin content of 0.01X 105EU/ml。
The results show that Triton X-114 can eliminate residual endotoxin in recombinant proteins and has no influence on the immunogenicity of the penton proteins.
EXAMPLE 4 preparation of an avian adenovirus penton protein subunit vaccine
The purified penton protein of example 3 was slowly added to the white oil adjuvant while the motor was turned on, stirred at 17500r/min for 5min, and then 1% thimerosal solution was added to the solution until the stirring was terminated to give a final concentration of 0.01%. The specific ratio is shown in Table 2.
TABLE 2 avian adenovirus penton protein subunit vaccine ratios
| Components | Vaccine 1 | Vaccine 2 | Vaccine 3 |
| Penton protein (AGP potency) | 1：2 | 1:4 | 1:16 |
| White oil adjuvant (V/V%) | 66％ | 66％ | 66％ |
Example 5 avian adenovirus penton protein subunit vaccine safety test
60 SPF chickens of 21 days old are taken, each group comprises 15 SPF chickens, the 1 st group to the 3 rd group are respectively injected with vaccines 1 to 3 prepared in the immunization example 4 by neck subcutaneous injection, the immunization dose is 0.6ml, and the 4 th group is injected with 0.6ml of physiological saline by subcutaneous injection to be used as blank control. Feeding under the same condition, observing clinical symptoms, weight gain rate and death rate for 3 weeks, dissecting 5 animals at 3 weeks, 4 weeks and 5 weeks, and observing whether the inoculated part forms macroscopic lesions. The results show (see tables 3 and 4) that no clinical symptoms and death are seen in the vaccine 1-vaccine 3 inoculated groups, the weight gain rates of the inoculated group and the control group do not show obvious difference, and granuloma formation is not seen, which indicates that the avian adenovirus penton protein subunit vaccine prepared by the invention is safe for immunizing chickens.
TABLE 3 poultry adenovirus penton protein subunit vaccine safety test clinical symptoms and mortality
TABLE 4 avian adenovirus penton protein subunit vaccine safety test of weight change and granuloma formation in chickens
EXAMPLE 6 avian adenovirus penton protein subunit vaccine immunogenicity assay
40 SPF chickens of 21 days old are divided into 4 groups, each group comprises 10 SPF chickens, the 5 th group to the 7 th group are respectively injected with vaccines 1 to 3 prepared in the immunization example 4 by neck subcutaneous injection, the immunization dose is 0.3ml, and the 8 th group is injected with 0.3ml of physiological saline by subcutaneous injection to serve as blank control. All test chickens were kept separately, challenged with FAV-HN strain virus solution by intramuscular injection 21 days after immunization, observed for 14 days, and recorded for morbidity, mortality, and protection. The results are shown in Table 5.
TABLE 5 results of the immunogenicity test of the avian adenovirus penton protein subunit vaccine
The results show that the 8 th group of control group is completely killed, and the 5 th to 7 th groups of immune groups have good immune protection effect on the immunized chickens, so that the immune effect is good. The poultry adenovirus penton protein subunit vaccine with the AGP titer not less than 1:2 is shown to provide effective immune protection for chicken flocks.
Example 7 avian adenovirus penton protein subunit vaccine Cross-protection assay
100 SPF chickens of 21 days old were divided into 10 groups of 10 chickens, each group had 10 animals, and the vaccine 1 prepared in example 4 was injected subcutaneously into the neck of groups 9 to 13, respectively, with an immunization dose of 0.3ml, and 0.3ml of physiological saline was injected subcutaneously into groups 14 to 18, as a blank control. All test chickens were kept in isolation, challenged with heterotypic serotype (serotypes 2, 3, 5, 8, 11) virus solutions by intramuscular injection 21 days after immunization, observed for 14 days, and recorded for morbidity, mortality, and protection. The results are shown in Table 6.
TABLE 6 avian adenovirus penton protein subunit vaccine Cross-protection test results
The results show that the 14 th to 18 th groups of the control groups are killed by diseases in different degrees, and the 9 th to 13 th groups of the immunization groups have good immune protection effect on the immunized chickens, so that the immune effect is good. The poultry adenovirus penton protein subunit vaccine with the AGP titer not less than 1:2 is shown to provide effective immune protection for the attack of different serotypes of adenovirus of chicken flocks.
Example 8 preparation of Newcastle disease antigen
Taking Newcastle Disease Virus strain (gene VII type), N7a strain (Newcastle Disease Virus (genotype VII), strain N7a) (preserved in China center for type culture Collection with the preservation number of CCTCC NO: V201545, the preservation date of 2015 10 months and 19 days, and the preservation address of Wuhan, Wuhan university, China), and properly diluting with sterilized normal saline (10) (10: 10)-4Or 10-5) Inoculating 0.1ml of susceptible chick embryos of 10-11 days old, and after inoculation, placing at 37 ℃ for continuous incubation. Selecting dead and alive chick embryos 48-120 hours after inoculation, harvesting allantoic fluid, and measuring the virus content to be 108.0EID500.1 ml. Adding a formaldehyde solution (v/v) with the final concentration of 0.1%, inactivating at 37 ℃, stirring once every 4-6 h, and inactivating for 16h for later use after complete inactivation.
Example 9 preparation of avian influenza antigens
Taking H9 subtype avian influenza virus SZ strain (disclosed in Chinese patent application CN103789272A) virus seed, diluting to 10 with sterile normal saline-3(0.1 ml of virus solution is added into 0.9ml of sterile physiological saline, and diluted for 2 times after shaking and mixing uniformly), 10-day-old susceptible chick embryos (self-hatching with SPF hatching eggs purchased from Beijing Meiliya Viton laboratory animal technology Co., Ltd.) are inoculated through allantoic cavity, and each embryo contains 0.1ml (containing 10)5EID50). After inoculation, the pinholes are sealed, and incubation is continued at 36-37 ℃ without turning eggs. And taking out the mixture for 96 hours, standing the mixture in an upward air chamber, and cooling the mixture for 12 to 24 hours at the temperature of between 2 and 8 ℃. And (5) harvesting the embryo liquid of the cooled chick embryo. The virus content was determined to be 108.5EID500.1 ml. Adding a formaldehyde solution (v/v) with the final concentration of 0.1%, inactivating at 37 ℃, stirring once every 4-6 h during the inactivation, and inactivating for 24h for later use after complete inactivation.
Example 10 preparation of infectious bronchitis antigen
The avian infectious bronchitis virus M41 strain (purchased from China institute of veterinary drugs) was taken and diluted with sterilized normal saline (10)-2Or 10-3) Inoculating 0.1ml of susceptible chick embryos of 10-11 days old, and continuously incubating at 36-37 ℃ after inoculation. Selecting dead and alive chick embryos 24-48 hours after inoculation, harvesting allantoic fluid, and determining virus content to be 106.0EID500.1 ml. Adding a formaldehyde solution (v/v) with the final concentration of 0.1%, inactivating at 37 ℃, stirring once every 4-6 h, and inactivating for 16h for later use after complete inactivation.
EXAMPLE 11 preparation of bursa of Fabricius antigen
Preparation of VP2cDNA
IBDV virus RNA is extracted from SPF chicken bursa of Fabricius infected with chicken infectious bursal disease virus super virulent virus strains according to the operation of a virus RNA extraction kit, and reverse transcription is carried out by using a random primer. Oligonucleotide primers were synthesized according to the conserved region sequences at the 5 'and 3' ends of the VP2 gene, the sequences of the synthesized oligonucleotide primers are shown in Table 7, PCR amplification was performed, and the primers were recovered by an agarose gel recovery kit and stored at-20 ℃.
TABLE 7 primers for the gene VP2 of bursa of Fabricius virus
| VP2-EcoR1-f | CCGGAATTCATGACAAACCTGCAAGATCAAAC |
| VP2-Sal1-r | ACGCGTCGACTTACCTTAGGGCCCGGATTATGT |
Construction of the pCold III _ VP2/E.Coli BL21(DE3) Strain
Taking the prepared VP2cDNA, carrying out double enzyme digestion, and connecting the digested fragment to a pCold III vector; the ligation product was directly transformed into E.coli BL21(DE3) and spread on LB solid medium containing 100. mu.g of ampicillin and cultured overnight to give a colony of pCold III _ VP2/E.coli BL21(DE 3).
3. Preparation of chicken infectious bursal disease virus VP2 protein
Ventilating and culturing in culture tank, and adding 70% culture medium and peanut oil defoaming agent. Inoculating pCold III _ VP2/E.Coli BL21(DE3) strain seed liquid according to 2-4% of the amount of the culture medium after sterilization, culturing at 37 ℃, adding 0.2mol/L alpha-lactose until the OD600 value of the strain liquid reaches 0.6-1.0 to ensure that the final concentration reaches 0.02mol/L, and continuing culturing for 5-8 h.
After the culture is finished, the thalli are collected centrifugally, resuspended, broken by ultrasonic waves, and the supernatant is collected centrifugally. After ammonium sulfate precipitation, VP2 protein solution is collected.
Example 12 preparation of egg drop syndrome antigen
Diluting an egg drop syndrome AV-127 strain (purchased from Chinese veterinary medicine supervision institute) with sterilized normal saline in proportion, inoculating a susceptible duck embryo with 0.1ml of each embryo in an allantoic cavity, continuously incubating at 36-37 ℃, discarding the dead duck embryo before 24 hours, irradiating the egg for 1 time every 6-8 hours, taking out the dead duck embryo at any time until 120 hours, taking out all duck embryos, standing an air chamber upwards, and cooling at 2-8 ℃ for 12-24 hours; then aseptically harvesting duck embryo allantoic fluid, and determining virus content to 108.5EID500.1 ml. Adding a formaldehyde solution (v/v) with the final concentration of 0.2%, inactivating at 37 ℃, stirring once every 4-6 h during the inactivation, and inactivating for 16h for later use after complete inactivation.
EXAMPLE 13 preparation of avian adenovirus combination vaccine
The purified avian adenovirus penton protein antigen of example 3 was mixed with the newcastle disease antigen prepared in example 8, the avian influenza antigen prepared in example 9, the infectious bronchitis antigen prepared in example 10, the infectious bursal disease antigen prepared in example 11, and the egg drop syndrome antigen prepared in example 12, respectively, in a ratio, added to a white oil adjuvant while starting a motor, stirred at 17500r/min for 5min, and a 1% thimerosal solution was added to the mixture before the stirring was terminated to give a final concentration of 0.01%. The concrete proportions are shown in tables 8, 9, 10 and 11.
TABLE 8 avian adenovirus bivalent vaccine ratios
TABLE 9 triple vaccine ratios for avian adenovirus
TABLE 10 avian adenovirus tetravaccine ratios
TABLE 11 avian adenovirus quintuplet vaccine ratios
| Components | Vaccine 18 | Vaccine 19 |
| Penton protein (AGP potency) | 1：8 | 1：16 |
| Strain N7a antigen (EID)50/0.1ml) | 108.0 | 108.0 |
| SZ strain antigen (EID)50/0.1ml) | 108.0 | 108.0 |
| M41 strain antigen (EID)50/0.1ml) | 106.0 | 106.0 |
| VP2 protein (AGP potency) | 1：16 | — |
| AV-127 strain antigen (EID)50/0.1ml) | — | 107.0 |
| White oil adjuvant (V/V%) | 66％ | 66％ |
EXAMPLE 14 avian adenovirus combination vaccine immunogenicity assay
1. Partial immunogenicity of avian adenoviruses
Taking 170 SPF chickens of 21 days old, dividing the SPF chickens into 17 groups, wherein each group comprises 10 SPF chickens, and the 19 th group to the 34 th group are respectively injected with 0.3 ml/SPF chicken by neck subcutaneous injection to immunize 4-19 vaccines prepared in the example 13; group 35 was injected subcutaneously with 0.3ml of physiological saline as a blank control. All test chickens were kept separately, challenged with FAV-HN strain virus solution by intramuscular injection 21 days after immunization, observed for 14 days, and recorded for morbidity, mortality, and protection. The results are shown in Table 12.
TABLE 12 avian adenovirus combination vaccine avian adenovirus partial immunogenicity test results
The results show that the vaccine groups 4 to 19 can generate better immune protection after 21 days of immunization. The fact that the oil emulsion joint vaccine prepared by the avian adenovirus penton protein serving as the antigen can completely protect chickens is shown.
2. Partial immunogenicity assay for newcastle disease virus
Taking 130 SPF chickens of 21 days old, dividing the SPF chickens into 13 groups, wherein each group comprises 10 SPF chickens, and the 36 th group to the 47 th group are respectively injected with 20 mul/SPF chicken by neck subcutaneous injection to immunize 4 vaccines and 9-19 vaccines prepared in the embodiment 13; group 48 was injected subcutaneously with 20 μ l of physiological saline as a blank control. All test chickens were kept separately, and 21 days after immunization, the 36 th to 47 th groups of immunized chickens, together with the 48 th group of control chickens, were bled and serum was separated. Detecting the HI antibody of the Newcastle disease virus, meanwhile, attacking by intramuscular injection with the HN1101 strain virus liquid of the Newcastle disease virulent virus, observing for 14 days, and recording the morbidity, mortality and protection number. The results are shown in Table 13.
TABLE 13 partial immunogenicity test results for avian adenovirus combination vaccine Newcastle disease Virus
Note: HI antibodies were determined as geometric means of antibodies in immunized chickens.
The results show that vaccine 4, vaccine 9 to vaccine 19 immune groups can generate higher newcastle disease antibodies 21 days after immunization, and compared with a control group, the immune groups can completely protect against virulent attacks. The oil emulsion combined vaccine prepared by using the N7a strain Newcastle disease virus liquid provided by the invention as an antigen can provide complete protection for chicken flocks.
3. Partial immunogenicity testing of avian influenza
Taking 90 SPF chickens of 21 days old, dividing the SPF chickens into 9 groups, each group comprises 10 SPF chickens, and injecting vaccine 5, vaccine 9, vaccine 13, vaccine 16-vaccine 19 prepared in the immunization example 13 into the 49 th to 56 th groups by neck subcutaneous injection, wherein each SPF chicken is 0.3 ml; group 57 was given a control blank by subcutaneous injection of 0.3ml of physiological saline. All test chickens were kept separately, and 21 days after immunization, the 49 th to 56 th groups of immunized chickens, together with the 57 th group of control chickens, were bled and serum was separated. Detecting HI antibody titer of H9 subtype avian influenza virus, and simultaneously attacking with SZ strain virus solution by intravenous injection, each 0.2ml (containing 10)7.0EID50). Collecting cloaca swabs 5 days after the challenge, inoculating 5 SPF (specific pathogen free) chick embryos of 10-11 days old into an allantoic cavity after treatment, incubating and observing for 5 days, determining the agglutination value of the erythrocyte of the chick embryo liquid whether dead embryos or live embryos, and judging that the virus is separated positively if the agglutination value of 1 chick embryo liquid in the 5 chick embryos inoculated by each swab sample is not less than 1:16 (micro method). For samples negative to virus isolation, the judgment should be made after blind transmission once. The immune group should be negative for at least 9 chicken viruses isolated; the control group should isolate at least 4 chicken viruses as positive. The results are shown in Table 14.
TABLE 14 partial immunogenicity test results for avian adenovirus combined vaccine avian influenza
Note: HI antibodies were determined as geometric means of antibodies in immunized chickens.
The results show that the vaccine 5, the vaccine 9, the vaccine 13 and the vaccines 16 to 19 can generate higher avian influenza antibody 21 days after immunization, and compared with a control group, the immune group can completely protect the attack of strong virus. The H9 subtype avian influenza virus liquid provided by the invention is shown to be used as an oil emulsion combined vaccine prepared by an antigen to provide complete protection for chicken flocks.
4. Partial immunogenicity test for infectious bronchitis in chickens
80 SPF chickens of 21 days old are taken and divided into 8 groups, each group comprises 10 SPF chickens, and the live vaccine (H120 strain) for infectious bronchitis is inoculated to each group from 58 th group to 64 th group by eye dropping and nose dropping to obtain 1 feather (0.05 ml). 21 days after inoculation, blood was collected and serum was isolated together with group 65 control chickens. Meanwhile, the vaccine 6, the vaccine 10, the vaccine 13, the vaccine 14, the vaccine 15, the vaccine 18 and the vaccine 19 prepared in example 13 were immunized by cervical subcutaneous injection in each of groups 58 to 64 at a dose of 0.3 ml/mouse. Collecting blood and separating serum of 65 th group of control chicken 28 days after inoculation; the HI antibody titer was measured on sera collected from the 58 th to 64 th group of immunized chickens 21 days after the first immunization of live vaccine and twice on 28 days after the immunization of inactivated vaccine (sera collected from 65 th group of control chickens at the same time). The geometric mean value of the antibody titer of the hyperimmune serum HI in the immune group is not less than 4 times of the geometric mean value of the antibody titer of the hyperimmune serum HI, and the geometric mean value of the antibody titer of the serum HI in the nonimmune control group is not more than 1:8 (micro-dose method). Meanwhile, the infectious bronchitis M41 strong poison of chicken is used for attacking poison by dripping nose to attack poison 103.0EID50 per feather, and an attacking poison experiment is carried out. The results are shown in Table 15.
TABLE 15 partial immunogenicity test results for avian adenovirus combined vaccine avian infectious bronchitis
The results show that the geometric mean value of the secondary immune serum HI antibody titer of the vaccine 6, the vaccine 10, the vaccine 13, the vaccine 14, the vaccine 15, the vaccine 18 and the vaccine 19 is not lower than 4 times of the geometric mean value of the primary immune serum HI antibody titer, and the virus is not separated from the trachea of all immunized chickens after challenge, so that the strong-virus challenge can be completely protected. The oil emulsion prepared by the infectious bronchitis virus liquid serving as the antigen can be combined to protect chickens completely.
5. Bursal partial immunogenicity assay
Taking 60 SPF chickens of 21 days old, dividing the SPF chickens into 6 groups, each group comprises 10 SPF chickens, and the 66 th group to the 70 th group respectively carry out neck subcutaneous injection on the vaccine 7, the vaccine 11, the vaccine 14, the vaccine 16 and the vaccine 18 prepared in the immunization example 13, wherein each SPF chicken is 0.3 ml; group 71 was given a 0.3ml subcutaneous injection of saline as a blank control. All test chickens were separately bred, and 21 days after immunization, groups 66-71, and 0.1ml (actual virus content is more than or equal to 100 BIDs) of virus liquid of a chicken infectious bursal disease virus strain BC6-85 (CVCC AV7 strain purchased from China veterinary medicine inspection institute) which is 100-fold diluted was inoculated to each eye dropping way. After the virus attack, the clinical manifestations of the chickens are observed every day, the number of the sick and dead chickens is recorded to 72-96 hours, live chickens are killed, dissected one by one, and pathological changes such as bursa of fabricius are observed. The immunized chicken should be at least 8 normal chickens and have no bursal disease; the control chicken should have at least 4 chickens with obvious bursal disease (more than one disease such as bleeding strip of pectoralis or leg muscle, bursal enlargement or atrophy, yellowing, and jelly-like secretion). The results are shown in Table 16.
TABLE 16 avian adenovirus combination vaccine bursa of Fabricius partial immunogenicity test results
The results show that the vaccine 7, the vaccine 11, the vaccine 14, the vaccine 16 and the vaccine 18 can completely protect the attack of the chicken infectious bursal disease virus 21 days after immunization.
6. Partial immunogenicity test for egg drop syndrome
Taking 60 SPF chickens of 21 days old, dividing the SPF chickens into 6 groups, each group comprises 10 SPF chickens, and the 72 th to 76 th groups respectively carry out neck subcutaneous injection immunization on the vaccine 8, the vaccine 12, the vaccine 15, the vaccine 17 and the vaccine 19 which are prepared in the embodiment 13, wherein each SPF chicken is 0.3 ml; group 77 was given 0.3ml of saline subcutaneously as a blank control. All test chickens are separately fed, blood is collected from 72 th to 77 th groups 21 days after immunization, and the HI antibody titer of egg drop syndrome is determined, wherein the geometric mean titer of the HI antibody of the immunized chicken is more than or equal to 7log2, and the titer of the HI antibody of a control chicken is less than or equal to 2log 2. The results are shown in Table 17.
TABLE 17 partial immunogenicity test results for avian adenovirus combination vaccine egg drop syndrome
Note: HI antibodies were determined as geometric means of antibodies in immunized chickens.
The results show that the vaccine 8, the vaccine 12, the vaccine 15, the vaccine 17 and the vaccine 19 can generate higher egg drop syndrome antibodies 21 days after immunization, and can effectively protect the egg laying syndrome of chicken groups. Proved by experiments, the avian adenovirus combined vaccine provided by the invention can resist the invasion of relevant pathogens, shows good immunogenicity, and can effectively control the prevalence of avian adenovirus related diseases in China.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.
SEQUENCE LISTING
<110> Puleco bioengineering GmbH
<120> a vaccine composition and uses thereof
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 1578
<212> DNA
<213> avian adenovirus
<400> 1
atgtgggggt tgcagccgcc gacgtcgatt ccgccgcctc ctccgccgac cgagttaacg 60
ccctcgacct atccggcgat ggtgaacggc tatccgcctc cggccgcgtc cgcgcagagc 120
tgttcctcta gcggcggtca gagcgagctg tatatgcccc ttcagcgggt gatggcccct 180
acggggggac ggaacagcat taagtatcgc gattacacgc cgtgtcgtaa caccaccaag 240
ctgttttacg tagacaacaa ggctagcgat atcgatacgt ataataaaga cgccaaccat 300
agcaatttcc gcaccacggt gatccataac caggatctgg acgcggacac ggccgccacc 360
gagtccatcc agttggactc tcgttcttgc tggggtggtg acctgaaaac cgctgttcgt 420
accaactgcc cgaacgtttc ttctttcttc cagtctaact ctgttcgtgt tcgtatgatg 480
tggaagcgcg acccgccgac tagcacggct cctccgagcg cggtaggcag cggctattcg 540
gtgcccggcg cgcagtacaa gtggtacgac ctgacggtcc ccgagggtaa ctacgcgctg 600
tgcgaactga tagacctgct caacgagggc atcgtgcagc tctacctgag cgagggtcgc 660
cagaacaacg tgcaaaaatc ggacatcggg gtcaagttcg acacacgcaa cttcggcttg 720
ctccgcgacc ccgtgacggg actggtaact ccgggcacgt acgtgtacaa gggttaccac 780
cccgacatcg tgctgctgcc cggatgcgcg atcgacttta cgtacagccg cctgagcctg 840
ctcctgggca tagggaagcg cgagccctac tcgaaggggt tcgttattac ctacgaggat 900
ctgcagggag gggatatccc ggctctgctg gacctcgact ccgtcgacgt gaacgacgct 960
gacggtgaag tgatcgagct cgacaacgct gctccccttt tacatgacag cgcgggcgtg 1020
tcgtataacg tcatttacga ccaggtgacg ggtaaacccg tgacggcgta tcgatcgtgg 1080
atgttggctt acaacgtacc taactcgcag gccaatcaga cgaccttgct gacggtgccc 1140
gatatggcgg gcgggatcgg ggcgatgtac acgtccctgc ccgatacctt tatcgcgcct 1200
accgggttca aggaagataa cacgaccaac ctttgcccgg tcgtcggcat gaacctgttc 1260
cccacctaca ataaaattta ttaccaggcg gcgtccacgt acgtgcaacg cctggaaaat 1320
tcctgccagt cggccacagc cgccttcaac cgctttcccg aaaacgagat tctgaagcaa 1380
gcgcccccca tgaatgtttc gtccgtgtgc gataaccaac ccgccgtcgt tcagcagggt 1440
gtgttgcctg tgaagagctc gctccccgga ctgcagcgcg tgctgatcac agacgaccag 1500
cgtcgtccga taccctacgt gtataagtct atcgcgacgg ttcagccgac cgttctgagt 1560
tccgcgacct tgcagtag 1578
Claims (10)
1. A vaccine composition comprising an immunizing amount of an avian adenovirus penton protein or an immunizing amount of a live vector comprising a recombinant avian adenovirus penton protein gene, and a pharmaceutically acceptable carrier; the avian adenovirus penton protein is a protein sequence coded by SEQ.ID NO. 1; the pharmaceutically acceptable carrier is a white oil adjuvant, and the water-in-oil emulsion is prepared, wherein the concentration range of the adjuvant is from 30% to 70%.
2. The vaccine composition of claim 1, wherein said avian adenovirus penton protein content is AGP titer ≥ 1: 2.
3. The vaccine composition according to claim 1, wherein the avian adenovirus penton protein content is AGP titer 1:2 to 1: 16.
4. The vaccine composition of claim 1,
the concentration of the adjuvant was 66% V/V.
5. The vaccine composition of claim 1, wherein said vaccine composition further comprises one or more additional antigens, said additional antigens comprising a chicken newcastle disease virus antigen, an avian influenza virus antigen, an avian infectious bronchitis virus antigen, an avian infectious bursal disease virus antigen, an egg drop syndrome virus antigen, an avian reovirus antigen, an escherichia coli antigen, an avian paragallibacterium antigen, a mycoplasma synoviae antigen, a mycoplasma gallisepticum antigen, a pasteurella multocida antigen, a marek's virus antigen, an avian encephalomyelitis virus antigen, a chicken infectious laryngotracheitis virus antigen.
6. The vaccine composition of claim 5, wherein the vaccine composition further comprises one or more other antigens, and the other antigens are inactivated antigen of newcastle disease virus, inactivated antigen of avian influenza virus, inactivated antigen of infectious bronchitis virus, antigen of infectious bursal disease virus VP2 protein, and inactivated antigen of egg drop syndrome virus.
7. The vaccine composition of claim 6, wherein the newcastle disease virus antigen is an N7a strain inactivated antigen, the avian influenza virus antigen is an SZ strain inactivated antigen, the avian infectious bronchitis virus antigen is an M41 strain inactivated antigen, the avian infectious bursal disease virus antigen is a VP2 protein, and the egg drop syndrome virus antigen is an AV-127 strain inactivated antigen.
8. The vaccine composition according to claim 7, wherein the avian adenovirus penton protein content is AGP titer 1: 2-1: 16, and the newcastle disease virus antigen content is 10 before inactivation8.0～109.0EID500.1ml, the content of the avian influenza virus antigen is 10 before inactivation6.5～108.5EID500.1ml, the antigen content of the avian infectious bronchitis virus is 10 before inactivation6.0～107.0EID500.1ml, the content of the chicken infectious bursal disease virus antigen VP2 protein is AGP titer of 1: 16-1: 128, and the content of the egg drop syndrome virus antigen is 10 before inactivation7.0～108.0EID50/0.1ml。
9. The vaccine composition according to claim 7, wherein the Newcastle disease virus antigen content of the chicken is 10 before inactivation8.0EID500.1ml, the content of the avian influenza virus is 10 before inactivation8.0EID50/0.1ml, the antigen content of the avian infectious bronchitis virus is 10 before inactivation6.0EID500.1ml, the content of the chicken infectious bursal disease virus antigen VP2 protein is AGP titer 1:16, and the content of the egg drop syndrome virus antigen is 10 before inactivation7.0EID50/0.1ml。
10. Use of a vaccine composition according to any one of claims 1 to 9 in the manufacture of a medicament for the prevention of an avian adenovirus infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611091776.4A CN108126192B (en) | 2016-12-01 | 2016-12-01 | Vaccine composition and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611091776.4A CN108126192B (en) | 2016-12-01 | 2016-12-01 | Vaccine composition and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108126192A CN108126192A (en) | 2018-06-08 |
| CN108126192B true CN108126192B (en) | 2021-01-15 |
Family
ID=62388211
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611091776.4A Active CN108126192B (en) | 2016-12-01 | 2016-12-01 | Vaccine composition and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108126192B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110575539B (en) * | 2018-06-11 | 2023-01-10 | 洛阳惠中生物技术有限公司 | Avian influenza virus-like particle vaccine, and preparation method and application thereof |
| CN114366808B (en) * | 2021-12-14 | 2023-10-13 | 南京农业大学 | Polysaccharide and virus antigen co-delivery nano vaccine, and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2839838A1 (en) * | 2013-08-19 | 2015-02-25 | Veterinärmedizinische Universität Wien | Fowl adenovirus vaccine |
-
2016
- 2016-12-01 CN CN201611091776.4A patent/CN108126192B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2839838A1 (en) * | 2013-08-19 | 2015-02-25 | Veterinärmedizinische Universität Wien | Fowl adenovirus vaccine |
Non-Patent Citations (3)
| Title |
|---|
| A subunit vaccine against hydropericardium syndrome using adenovirus penton capsid protein;M.S. Shah等;《Vaccine》;20121018;第30卷;7153-7156 * |
| ADV35553.1;Park,H.-S.等;《GenBank》;20110929;全文 * |
| M.S. Shah等.A subunit vaccine against hydropericardium syndrome using adenovirus penton capsid protein.《Vaccine》.2012,第30卷7153-7156. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108126192A (en) | 2018-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108126191B (en) | Vaccine composition and preparation method and application thereof | |
| CN108653724B (en) | Vaccine composition for preventing egg drop syndrome of poultry, and preparation method and application thereof | |
| CN108653725B (en) | Vaccine composition for preventing egg drop syndrome of poultry, and preparation method and application thereof | |
| CN110575539B (en) | Avian influenza virus-like particle vaccine, and preparation method and application thereof | |
| CN110575538B (en) | Avian influenza virus-like particle vaccine, and preparation method and application thereof | |
| CN107281479B (en) | Gene VII type Newcastle disease virus attenuated strain, vaccine composition and application thereof | |
| JP7303306B2 (en) | Foot-and-mouth disease virus-like particle antigen, vaccine composition thereof, preparation method and application | |
| CN111233984B (en) | O-type foot-and-mouth disease virus-like particle antigen, vaccine composition thereof, preparation method and application | |
| CN110540579B (en) | Avibacterium paragallinarum antigen protein, vaccine composition containing avibacterium paragallinarum antigen, and preparation method and application thereof | |
| CN109750036B (en) | Nucleotide sequence, method for improving protein expression efficiency by using same and application | |
| CN108126192B (en) | Vaccine composition and application thereof | |
| CN107523556B (en) | Avian adenovirus strain, vaccine composition and application thereof | |
| CN115322972B (en) | H9 subtype avian influenza virus isolate and application thereof | |
| JP2023520803A (en) | Foot-and-mouth disease virus-like particle antigen, its vaccine composition, preparation method and use | |
| CN110559433B (en) | Avian influenza virus-like particle vaccine, and preparation method and application thereof | |
| CN109134619B (en) | Porcine circovirus type 2 antigen, immunogenic composition prepared from same, preparation method and application | |
| CN114573708A (en) | Avibacterium paragallinarum HA fusion protein and tripolymer thereof, vaccine composition prepared from avibacterium paragallinarum HA fusion protein, preparation method and application of vaccine composition | |
| CN110467654B (en) | Foot-and-mouth disease virus-like particle antigen, vaccine composition prepared from same, and preparation method and application of vaccine composition | |
| CN110713987B (en) | Recombinant gene VII type Newcastle disease virus strain and vaccine composition, preparation method and application thereof | |
| CN112679585B (en) | Vaccine composition containing avian egg drop syndrome virus genetic engineering subunit vaccine, and preparation method and application thereof | |
| CN110777160A (en) | Preparation method of foot-and-mouth disease virus-like particle antigen, foot-and-mouth disease virus-like particle antigen prepared by preparation method and application of foot-and-mouth disease virus-like particle antigen | |
| CN115403673A (en) | Avian egg drop syndrome virus subunit nanoparticle antigen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |