CN113584085A

CN113584085A - Lentiviral vector for suspension cells and application thereof

Info

Publication number: CN113584085A
Application number: CN202110737586.XA
Authority: CN
Inventors: 黄河清涛; 王德鹏; 胡清云; 刘彩云; 许澎
Original assignee: Hunan Fenghui Biotechnology Co ltd
Current assignee: Hunan Fenghui Biotechnology Co ltd
Priority date: 2021-06-30
Filing date: 2021-06-30
Publication date: 2021-11-02
Anticipated expiration: 2041-06-30
Also published as: CN113584085B

Abstract

The invention discloses a lentiviral vector for suspension cells and application thereof, belonging to the technical field of biology. The lentiviral vector is characterized in that pLVX-EGFP-IRES-Puro is used as a framework, and a Ubi promoter and a Cbh promoter are inserted. The lentiviral vector is generally suitable for expression of suspension cells, has high and stable expression efficiency, can greatly improve the over-expression effect of the suspension cells, and has simple and easy expression process and easy popularization.

Description

Lentiviral vector for suspension cells and application thereof

Technical Field

The invention relates to a slow virus vector aiming at suspension cells and application thereof, belonging to the technical field of biology.

Background

Lentiviruses (LV) are currently very effective tools in cellular and model biological experiments, and have many unique advantages in gene transfection. Research on Lentiviral vectors (Lentiviral vectors) has progressed rapidly and has been conducted very intensively. The lentivirus vector can effectively integrate the exogenous gene onto the host chromosome, thereby achieving persistent expression. Lentiviral vectors have a broader host range than retroviral vectors, and lentiviruses are able to efficiently infect non-periodic and post-mitotic cells.

Lentiviral expression vectors, known as shuttle vectors, contain the genetic information required for packaging, transfection, and stable integration. The lentiviral packaging plasmid provides all of the helper proteins necessary for transcription and packaging of the RNA into the recombinant pseudoviral vector. In order to generate high-titer virus particles, cells are co-transfected by an expression vector and a packaging plasmid at the same time, the virus is packaged in the cells, the packaged pseudovirus particles are secreted to a culture medium outside the cells, after centrifugation, a supernatant is obtained and can be directly used for infection of the host cells, and a target gene enters the host cells and is integrated into a genome through reverse transcription, so that effector molecules are expressed at a high level.

Lentiviruses have unique advantages over other retroviruses.

(1) There is a broader host range, with infectious capacity for both dividing and non-dividing cells. For some cells which are difficult to transfect, such as primary cells, stem cells, undifferentiated cells and the like, the transduction efficiency of the target gene can be greatly improved, and the probability of integrating the target gene into the host cell genome is greatly increased.

(2) And (4) stably expressing. The lentivirus can effectively integrate exogenous genes into cell chromosomes, and target genes have certain resistance to transcriptional silencing, and can be expressed in target cells continuously, efficiently and stably.

(3) The constructed lentivirus vector can carry about 5kb or even longer target gene. Therefore, besides foreign short-hairpin RNAs (short RNAs) and other small molecules, a plurality of cDNAs can be cloned into a lentiviral vector, and the virus titer is reduced along with the increase of the length of the target gene.

Based on the advantages of lentiviruses, the lentivirus vector system can be utilized to carry out conventional experimental operation of transfecting a target gene or an RNAi gene, and meanwhile, the lentiviruses play an important role in the fields of gene editing, gene therapy, transgenic animals, drug research and the like.

The common hematological tumors mainly comprise various leukemias, multiple myeloma and malignant lymphoma, and the incidence rates of the common hematological tumors are ranked in the first ten malignant tumors. Hematological neoplasms are therefore one of the current research hotspots. However, it is known that blood-derived suspension cells generally have a problem of difficulty in lentivirus infection.

Therefore, the development of a special slow virus vector for suspension cells has high clinical and market values.

Disclosure of Invention

In order to solve the technical problems, the invention provides a lentiviral vector for suspension cells and an application thereof, wherein the lentiviral vector is suitable for expression of the suspension cells, has high and stable expression efficiency, can greatly improve the over-expression effect in the suspension cells, and has simple and easy expression process and easy popularization.

The technical scheme of the invention is as follows.

The invention provides a lentiviral vector, which takes pLVX-EGFP-IRES-Puro as a framework and is inserted with a Ubi promoter and a Cbh promoter.

Further, the Ubi promoter and Cbh promoter replace the CMV promoter in pLVX-EGFP-IRES-Puro.

Further, the nucleotide sequences of the Ubi promoter and the Cbh promoter are shown in SEQ ID NO. 1.

The invention also provides a recombinant lentivirus containing the lentivirus vector.

The invention also provides a preparation method of the recombinant lentivirus, which is a recombinant lentivirus obtained by introducing a target gene into the lentivirus vector to obtain a target plasmid and co-transfecting the target plasmid with psPAX2 and pMD2.G to obtain a host cell.

Further, upon transfection, the mass ratio of psPAX2, pmd2.g, the plasmid of interest was psPAX 2: pmd2. g: the target plasmid is 2: 1: 1.

the invention also provides a recombinant cell which comprises the lentiviral vector and/or the recombinant lentivirus.

The invention also provides a method for infecting cells by using the recombinant lentivirus, which is to co-culture the recombinant lentivirus and cells to be infected.

Further, the cells are suspension cells.

The invention also provides a pharmaceutical composition, which comprises one or more of the lentivirus vector, the recombinant lentivirus and the recombinant cell.

The invention also provides the application of the lentiviral vector, the recombinant lentivirus and the recombinant cell in the aspect of expressing protein or preparing medicaments.

Drawings

FIG. 1: the invention provides a schematic diagram of a lentivirus vector.

FIG. 2: and (5) fluorescent quantitative PCR result.

FIG. 3: results of lentivirus infection of Jurkat cells.

FIG. 4: and comparing the virus infection effects of the common vector and the suspension cell special vector.

Detailed Description

Example 1 construction of circRNA overexpression Loop-Forming vector

1. Design of circRNA overexpression Loop-Forming vectors

Designing a promoter sequence suitable for suspension cells; according to the sequence information of a commercial vector pLVX-EGFP-IRES-Puro, a complete Ubi promoter-Cbh promoter nucleotide sequence (SEQ ID NO.1) suitable for suspension cell overexpression is designed, a Primer is designed by using Primer design software Primer Premier 5.0, and the primers are shown in Table 1 and delivered to a nucleic acid synthesis company for Primer synthesis.

TABLE 1 primer design

2. PCR amplification

The PCR system was used to obtain two DNA sequences by PCR amplification as shown in Table 2.

TABLE 2 PCR reaction System

And (3) PCR reaction conditions:

98℃5min；98℃10s，62℃5s，72℃30s，30cycles；72℃10min，4℃4min。

3. recovery of DNA fragments by agarose gel electrophoresis

10 μ L of the reaction product was subjected to 1% agarose gel electrophoresis, and the target gene fragment was recovered, and the gel recovery kit was purchased from Oncorhynchus organisms.

4. Enzyme-digested pLVX-EGFP-IRES-Puro vector

Plasmid pLVX-EGFP-IRES-Puro, which was digested simultaneously with ClaI-EcoRI, and the digestion system is shown in Table 3.

TABLE 3 double restriction system of plasmids

And carrying out double enzyme digestion on the pLVX-EGFP-IRES-Puro vector and the recovered target gene fragment.

5. Glue recovery

And (3) performing 1% agarose gel electrophoresis on the lentiviral blank vector subjected to double enzyme digestion, and recovering the lentiviral blank vector by using the gel.

6. Ligation of the Gene fragment of interest and the vector

And connecting the recovered and purified target fragment with the recovered and purified vector, and naming the connection product as pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro. The ligation system is shown in Table 4.

TABLE 4 connection System

The connection reaction conditions are as follows: the reaction was carried out at 50 ℃ for 30 min.

7. Ligation products transformation of competent cells

mu.L of the ligation product was taken to transform 100. mu.L of Stbl3 competent cells: uniformly mixing the product with competent cells, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, immediately placing on ice for 2min, adding 500 mu L LB culture medium preheated to room temperature, carrying out shake culture at constant temperature of 180rpm and 37 ℃ for 1h, centrifuging at 5000rpm for 3min, discarding 500 mu L culture supernatant, uniformly mixing the residual 100 mu L with a pipette, uniformly coating the mixture on an LB plate containing 50 mu g/mL ampicillin resistance, inverting, and carrying out culture in a constant-temperature incubator at 37 ℃ overnight.

8. Sequencing identification

And selecting positive single colonies, and sending the positive single colonies to biological engineering company Limited for sequencing.

9. Plasmid extraction from positive strains with correct sequencing

And performing amplification culture on the positive strains with correct sequencing, adding the positive strains into 20mL of LB culture medium containing corresponding antibiotics, performing overnight culture at 37 ℃ for 12-16h, and extracting plasmids.

And performing amplification culture on the positive strains with correct sequencing, adding the positive strains into a 20mL LB culture medium containing corresponding antibiotics, performing overnight culture at 37 ℃ for 12-16h, and extracting plasmids to obtain a vector containing an overexpression framework aiming at the suspension cells.

Example 2 construction of target Gene-pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector

1. The target gene sequence is amplified by PCR, and the PCR reaction system is shown in Table 2.

And (3) PCR reaction conditions:

98℃5min；98℃10s，60℃5s，72℃15s，30cycles；72℃10min，4℃4min。

2. the DNA fragments were recovered by agarose gel electrophoresis.

3. Restriction enzyme pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector

Plasmid pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro, and the enzyme digestion system is shown in Table 5 by double digestion with AgeI-EcoRI.

TABLE 5 enzyme digestion System

After 5h reaction at 7 ℃ the large fragment was recovered on a 1% agarose gel.

4. Ligation of the Gene fragment of interest and the vector

Connecting the recovered and purified target fragment with the recovered and purified carrier, and naming the connection product as

pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro. The ligation system is shown in Table 6.

TABLE 6 connection System

5. Ligation products transformation of competent cells

mu.L of the ligation product was taken to transform 100. mu.L of DH5a competent cells: uniformly mixing the product with competent cells, carrying out ice bath for 30min, carrying out heat shock for 90s at 42 ℃, immediately placing on ice for 2min, adding 500 mu L LB culture medium preheated to room temperature, carrying out shake culture at constant temperature of 180rpm and 37 ℃ for 1h, centrifuging at 5000rpm for 3min, discarding 500 mu L culture supernatant, uniformly mixing the residual 100 mu L with a pipette, uniformly coating the mixture on an LB plate containing 50 mu g/mL ampicillin resistance, inverting, and carrying out culture in a constant-temperature incubator at 37 ℃ overnight.

6. Sequencing identification

7. Plasmid extraction from positive strains with correct sequencing

And performing amplification culture on the positive strains with correct sequencing (adding the positive strains into a 20mL LB culture medium containing corresponding antibiotics for culture at 37 ℃ for 12h), and extracting plasmids to obtain a target gene-pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector.

Example 3pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro Lentiviral packaging

1. Cell preparation

1) The day before transfection, 3-5 × 106 293T cells/dish were seeded into 10mm cell culture dishes, and 10% fetal bovine serum-containing DMEM medium, 3%7℃、5％CO₂Culturing in an incubator.

2) On the day of transfection, transfection was performed at a cell density of 80%. According to psPAX 2: pmd2. g: the target plasmid is 2: 1: 1, adding the mixture into serum-free DMEM culture solution, gently mixing the mixture uniformly, and standing the mixture for 5 min.

3) Gently mixing the transfection reagent with serum-free DMEM medium, and standing for 5mim

Mixing the liquids of steps 2) and 3), and standing for 20 min.

4) The mixture was dropped into a cell culture dish and incubated at 37 ℃ in a 5% CO2 cell incubator for 6 h.

5) Culturing for 48h, collecting cell supernatant

2. Concentrating

1) After 48h of transfection, the cell supernatants were collected in a 50mL centrifuge tube and the DMEM medium was changed, and after 72h, the cell supernatants were collected once again and the two collected solutions were mixed.

2) The collected virus solutions were mixed and concentrated by centrifugation.

3) Subpackaging the virus supernatant concentrated solution into virus tubes, and freezing and storing at-80 ℃.

3. Concentrating

1) 293T cells were plated into 96-well plates at 1 × 105 per well and incubated overnight at 37 ℃.

2) Resuspending virus stock solution by DMEM medium, the virus stock solution amount of the first hole is 10 mu L, then carrying out gradient dilution by 10 times, adding 100 mu L of culture medium-virus mixed solution into each hole, and carrying out 3 repeated holes on each diluted concentration. Culturing in a 5% CO2 incubator at 37 deg.C.

3) After 24 hours, the virus-containing DMEM medium was changed to a virus-free DMEM complete medium.

4) After culturing for another 48 hours, the number of fluorescent cells contained in each well was observed under a fluorescent microscope, counted, photographed, and the virus titer was calculated.

The sum of the total number of 3 replicate wells was calculated and averaged, assuming a (average number of fluorescent cells in the penultimate visible fluorescence well) and B (average number of fluorescent cells in the penultimate visible fluorescence well). Lentivirus titer calculation formula: lentivirus titer (TU/mL) — (a + B10) × 1000/2/a well virus volume (μ L).

Test example: overexpression of genes in suspension cells by the Lentiviral overexpression vectors of the invention

Designing PCR amplification primers according to a sequence of RAB40C gene (NCBI database accession number: NM-021168), and amplifying a linear sequence of the circular RNA; then, the target nucleotide sequence is connected into the overexpression vector of the invention through EcoRI and AgeI enzyme cleavage sites to construct an overexpression vector, and the vector is subjected to lentivirus packaging.

Through lentivirus transfection and fluorescent quantitative PCR detection, the constructed lentivirus overexpression vector is successfully expressed in suspension cells. The specific detection steps are as follows:

1. RAB40C (NM-021168) gene PCR amplification primer design:

RAB40C(NM_021168)-F：ACAGCAGAGATCCAGTTTATCGATCTGCAGTGCAGCGTGACCC(SEQ ID NO.4)

RAB40C(NM_021168)-R：GCCACAGACCTGGCCCGGGGAATTCCTAGGAGATCTTGCAGTTACTCCGC(SEQ ID NO.5)

2. PCR amplification of target circular RNA sequences

The PCR system is shown in Table 7.

TABLE 7 PCR System

And (3) PCR reaction conditions:

98℃5min；98℃10s，60℃5s，72℃15s，30cycles；72℃10min，4℃4min。

the PCR amplification product is connected to the vector containing the invention after tapping recovery and enzyme digestion, and the vector of the suspension cell lentivirus overexpression RAB40C (NM-021168) gene is constructed and named as RAB40C (NM-021168) -pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro.

3. Lentiviral packaging

The above overexpression vector was expressed according to psPAX 2: pmd2. g: the target plasmid is 2: 1: packaging lentivirus at a ratio of 1. Lentivirus infects suspension cells Jurkat cells.

4. Fluorescent quantitative PCR detection of mRNA expression

1) According to RAB40C gene (accession number: NM-021168) sequence design PCR amplification primer, and the sequence of the primer for specifically detecting RAB40C (NM-021168) is as follows:

RAB40C-F：CGCCTACAGTAACGGGATCG(SEQ ID NO.6)

RAB40C-R：TTTCCAACCAAGATCCGGGG(SEQ ID NO.7)

2) selecting beta-actin gene as reference gene of fluorescence quantitative result data, the sequence is as follows:

β-actin F：CATGGGTCAGAAGGATTCCT(SEQ ID NO.8)

β-actin R：TCGTCCCAGTTGGTGACGAT(SEQ ID NO.9)

3) the specific detection method comprises the following steps:

cells infected with the overexpressed lentivirus were extracted for total RNA in the cells following strictly the Reagent instructions of Reagent Reagent (Life technologies, Inc.).

The detailed extraction steps are as follows:

(1) about 100 ten thousand cells were taken and 1mL trizol was added.

(2) Adding 200 μ L chloroform, shaking vigorously for 15s, and standing at room temperature for 15 min;

(3) centrifuging at 12000g for 15min at 4 deg.C, separating the solution into three layers, dissolving RNA in the water phase, and transferring the water phase to another new RNase free EP tube;

(4) adding isopropanol with the volume of 1 time, and fully and uniformly mixing by vortex;

(5) centrifuging at 12000g for 10min at 4 deg.C, collecting RNA precipitate at the bottom of the tube, and discarding the supernatant;

(6) adding 1mL of 75% ethanol, slightly inverting by hand, centrifuging at 12000g for 5min, and discarding the supernatant;

(7) air-dry at room temperature, add 25. mu.L DEPC H2O, blow with a gun head several times to dissolve RNA well, store at-80 ℃.

(8) And (3) RNA concentration detection: the RNA concentration was measured using a nucleic acid protein detector.

4) Reverse transcription PCR

(1) A reverse transcription reaction solution was prepared as shown in Table 8 and placed in an EP tube.

TABLE 8 reverse transcription reaction solution

(2) The following reactions were performed on a PCR instrument: 72 ℃ for 5min, then chilled on ice.

(3) The reverse transcription system in Table 9 was added into the EP tube in step (1).

TABLE 9 reverse transcription reaction System

The reverse transcription reaction was performed on a PCR instrument under the following conditions: 5min at 25 ℃; 60min at 42 ℃; 72 ℃ for 10 min; 4 ℃ for 2 min. The cDNA obtained from the reaction was tested immediately or stored at 4 ℃.

5) Real-time fluorescent quantitative PCR reaction

(1) The fluorescent quantitative PCR reaction system is shown in Table 10.

TABLE 10 fluorescent quantitative PCR reaction System

(2) Setting reaction conditions:

as shown in Table 11, the conditions for the fluorescent quantitative PCR reaction were: denaturation at 95 deg.C for 3 min; 95 ℃ 15s, 60 ℃ 20s (this step collects the fluorescence signal); performing 40 cycles, and then performing melting curve analysis; melting procedure: collecting fluorescence signals at the temperature of 59-95 ℃ for 2min at 95 ℃.

TABLE 11 fluorescent quantitative PCR reaction conditions

The fluorescence quantification result is shown in fig. 2, and it can be seen from the figure that after the cell is infected with the over-expressed lentivirus, the target RAB40C (NM — 021168) molecule is successfully detected to have high expression, and the expression level is increased by 4 times compared with that of the untransfected group, which indicates that the suspension cell over-expression vector constructed by the invention can effectively over-express mRNA in the suspension cell.

RAB40C (NM-021168) -pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro vector, after packaging lentivirus, and infecting target cell Jurkat, the state, growth and fluorescence of the cells were observed, as shown in FIG. 3. After a common vector (pLVX-EGFP-IRES-Puro) is subjected to virus packaging, a suspension cell is infected by a virus, and after a suspension cell is subjected to virus packaging by a suspension cell special vector (pLVX-Ubi-MCS-Cbh-EGFP-IRES-Puro), the suspension cell is infected by the virus, and the virus infection effect of the suspension cell special vector packaging is obviously better than that of the virus packaged by the common vector (see figure 4).

In conclusion, the suspension cell overexpression lentiviral vector provided by the invention is designed based on a high-quality lentiviral packaging plasmid, is applied to lentiviral packaging after expressing mRNA, is convenient for subsequent test operation, can be generally applied to expression of suspension cells, has high and stable expression efficiency, greatly improves the overexpression effect in the suspension cells, is simple and easy to operate and is easy to popularize by applying the vector containing the sequence to expression.

Sequence listing

<110> Hu nan fenghui biotech Co., Ltd

<120> lentiviral vector for suspension cells and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2871

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca ccggcagcta cgggggattc ctttcccacc 840

gctccttcgc tttcccttcc tcgcccgccg taataaatag acaccccctc cacaccctct 900

ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960

cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc cctctctacc 1020

ttctctagat cggcgttccg gtccatggtt agggcccggt agttctactt ctgttcatgt 1080

ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag cgttcgtaca cggatgcgac 1140

ctgtacgtca gacacgttct gattgctaac ttgccagtgt ttctctttgg ggaatcctgg 1200

gatggctcta gccgttccgc agacgggatc gatttcatga ttttttttgt ttcgttgcat 1260

agggtttggt ttgccctttt cctttatttc aatatatgcc gtgcacttgt ttgtcgggtc 1320

atcttttcat gctttttttt gtcttggttg tgatgatgtg gtctggttgg gcggtcgttc 1380

tagatcggag tagaattaat tctgtttcaa actacctggt ggatttatta attttggatc 1440

tgtatgtgtg tgccatacat attcatagtt acgaattgaa gatgatggat ggaaatatcg 1500

atctaggata ggtatacatg ttgatgcggg ttttactgat gcatatacag agatgctttt 1560

tgttcgcttg gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt tctagatcgg 1620

agtagaatac tgtttcaaac tacctggtgt atttattaat tttggaactg tatgtgtgtg 1680

tcatacatct tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat 1740

acatgttgat gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat 1800

atgctctaac cttgagtacc tatctattat aataaacaag tatgttttat aattattttg 1860

atcttgatat acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg 1920

ccttcatacg ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt 1980

tggtgttact tctgcagacc ggtgcggccg cgaattcccc gggccaggtc tgtggctcga 2040

gtctagagga tccgcagaca aatggctcta gaggtacccg ttacataact tacggtaaat 2100

ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaatagt aacgccaata 2160

gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta 2220

catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc 2280

gcctggcatt gtgcccagta catgacctta tgggactttc ctacttggca gtacatctac 2340

gtattagtca tcgctattac catggtcgag gtgagcccca cgttctgctt cactctcccc 2400

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 2460

gcgatggggg cggggggggg gggggggcgc gcgccaggcg gggcggggcg gggcgagggg 2520

cggggcgggg cgaggcggag aggtgcggcg gcagccaatc agagcggcgc gctccgaaag 2580

tttcctttta tggcgaggcg gcggcggcgg cggccctata aaaagcgaag cgcgcggcgg 2640

gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct ccgccgccgc ctcgcgccgc 2700

ccgccccggc tctgactgac cgcgttactc ccacaggtga gcgggcggga cggcccttct 2760

cctccgggct gtaattagct gagcaagagg taagggttta agggatggtt ggttggtggg 2820

gtattaatgt ttaattacct ggagcacctg cctgaaatca ctttttttca g 2871

<210> 2

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acagcagaga tccagtttat cgatctgcag tgcagcgtga ccc 43

<210> 3

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cccttgctca ccatggtggc ctgaaaaaaa gtgatttcag gcaggt 46

<210> 4

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acagcagaga tccagtttat cgatctgcag tgcagcgtga ccc 43

<210> 5

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccacagacc tggcccgggg aattcctagg agatcttgca gttactccgc 50

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgcctacagt aacgggatcg 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tttccaacca agatccgggg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

catgggtcag aaggattcct 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcgtcccagt tggtgacgat 20

Claims

1. A lentiviral vector is characterized in that the lentiviral vector takes pLVX-EGFP-IRES-Puro as a framework and is inserted with a Ubi promoter and a Cbh promoter.

2. The lentiviral vector of claim 1, wherein the Ubi promoter and Cbh promoter replace the CMV promoter in pLVX-EGFP-IRES-Puro.

3. The lentiviral vector of claim 1, wherein the Ubi promoter and Cbh promoter have the nucleotide sequences shown in SEQ ID No. 1.

4. A recombinant lentivirus comprising the lentiviral vector of any one of claims 1-3.

5. The method for producing a recombinant lentivirus of claim 4, which comprises introducing a gene of interest into the lentivirus vector of any one of claims 1 to 3 to obtain a plasmid of interest, and co-transfecting the plasmid of interest with psPAX2 and pMD2.G into a host cell to obtain the recombinant lentivirus.

6. The method according to claim 5, wherein the mass ratio of psPAX2, pMD2.G, and the plasmid of interest at the time of transfection is psPAX 2: pmd2. g: the target plasmid is 2: 1: 1.

7. a recombinant cell comprising the lentiviral vector of any one of claims 1-3 and/or the recombinant lentivirus of claim 4.

8. A method of infecting a cell by co-culturing the recombinant lentivirus of claim 4 with a cell to be infected.

9. A pharmaceutical composition comprising one or more of the lentiviral vector of any one of claims 1-3, the recombinant lentivirus of claim 4, and the recombinant cell of claim 7.

10. Use of the lentiviral vector of any one of claims 1 to 3, or the recombinant lentivirus of claim 4, or the recombinant cell of claim 7 for expressing a protein or for the preparation of a medicament.