CN116218906A - RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method - Google Patents

Abstract

The invention provides an RNA editor expression plasmid, an exosome aptamer fusion expression plasmid and a targeted gene RNA editing method, and belongs to the technical field of gene editing and gene therapy. The invention finds the sequence and the method for inserting the proper MS2 and Com aptamer at the crRNA neck ring position of the CasRx, and can solve the problem that the editing of the gene RNA by using the CasRx-crRNA has a certain defect in the prior art. The modified MS2-crRNA or Com-crRNA can retain enough RNA degradation activity, and is further applied to the pre-packaging of Cas13d/crRNARNP and the delivery of virus vectors, so that RNA knockout and editing are realized.

Description

RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method

Technical Field

The invention relates to the technical field of gene editing and gene therapy, in particular to an RNA editor expression plasmid, an exosome aptamer fusion expression plasmid and a targeted gene RNA editing method.

Background

In recent years, a Type VI CRISPR-crRNA mediated nuclease Cas13d has been found to have a single-stranded RNA (ssRNA) specific degradation function, becoming a new generation of RNA editors (rnaeditors). The most commonly used of the Cas13d proteins that have been identified in isolation are CasRx proteins, which have been used in the knockdown or editing of mRNA among various species, such as mice, drosophila, zebra fish, plants, as well as tumor treatment and RNA in situ imaging within cells. CasRx is a protein consisting of 2 HEPN domains that, after binding to pre-crRNA, cleaves and processes mature crRNA and forms a Complex (RNP Complex) with crRNA, complementarily binds to target mRNA, and degrades target mRNA. The crRNA consists of a direct repeat region (directread) of 30nt and a spacer region (spacer) of 22-30nt, wherein the direct repeat region forms a neck ring structure that binds to the CasRx protein; the spacer forms a complementary double-stranded structure with the target mRNA.

Editing of gene RNAs, or modification of mutation sites, is currently performed using CasRx-crrnas, and delivery RNA editors are mainly performed using adenovirus vectors (AAV). However, these delivery strategies currently require the integration of DNA fragments of CasRx and U6-crRNA into the cell genome using viral vectors, followed by transcription or expression, with the risk of random genomic insertion into oncogenic applications.

Disclosure of Invention

The invention aims to provide an RNA editor expression plasmid, an exosome aptamer fusion expression plasmid and a targeted gene RNA editing method, so as to solve the problem that the editing of gene RNA by using CasRx-crRNA in the prior art has a certain defect.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an RNA editor expression plasmid, which has the structure of U6-gRNA-MS2-Cas13d, wherein the U6-gRNA-MS2-Cas13d comprises a nucleotide sequence shown as SEQ ID NO. 1;

or, the RNA editor expression plasmid has a structure of U6-gRNA-Com-Cas13d, wherein the U6-gRNA-Com-Cas13d comprises a nucleotide sequence shown as SEQ ID NO. 2.

The invention also provides a preparation method of the RNA editor expression plasmid, which comprises the following steps:

the U6-gRNA-CasRx plasmid is used as a template, the primer group (1) is adopted for amplification, and the PCR product Rx-MS2-1 is obtained after purification;

amplifying by using the PCR product Rx-MS2-1 as a template and adopting a primer group (2), and purifying to obtain the PCR product Rx-MS2-2;

carrying out double enzyme digestion on the obtained PCR product Rx-MS2-2 by adopting HpaI and XbaI to obtain an enzyme digestion product I;

double digestion is carried out on the U6-gRNA-CasRx plasmid by adopting HpaI and XbaI to obtain a digestion product II, electrophoresis is carried out on the digestion product II, a 13kb strip is cut off, a linear framework is recovered, and the linear framework is connected with the digestion product I by adopting T4 ligase to obtain a connection product;

transforming competent escherichia coli with the connection product, picking positive clones through ampicillin, and sequencing and identifying to obtain a successfully constructed plasmid U6-gRNA-MS2-CasRx;

the primer group (1) comprises primers Hpa1-U6-for and DR-MS2-rev1;

the primer group (2) comprises primers Hpa1-U6-for and DR-MS2-rev2;

the nucleotide sequence of Hpa1-U6-for is shown as SEQ ID NO. 4;

the DR-MS2-rev1 nucleotide sequence is shown as SEQ ID NO. 5;

the DR-MS2-rev2 nucleotide sequence is shown as SEQ ID NO. 6.

The invention also provides a preparation method of the RNA editor expression plasmid, which comprises the following steps:

the U6-gRNA-CasRx plasmid is used as a template, the primer group (3) is adopted for amplification, and the PCR product Rx-Com-1 is obtained after purification;

amplifying by using the PCR product Rx-Com-1 as a template and adopting a primer group (4), and purifying to obtain a PCR product Rx-Com-2;

carrying out double enzyme digestion on the obtained PCR product Rx-Com-2 by adopting HpaI and XbaI to obtain an enzyme digestion product III;

double digestion is carried out on the U6-gRNA-CasRx plasmid by adopting HpaI and XbaI to obtain a digestion product IV, electrophoresis is carried out on the digestion product IV, a 13kb strip is cut off, a linear framework is recovered, and the linear framework is connected with the digestion product III by adopting T4 ligase to obtain a connection product;

transforming competent escherichia coli with the connection product, picking positive clones through ampicillin, and sequencing and identifying to obtain a successfully constructed plasmid U6-gRNA-Com-CasRx;

the primer group (3) comprises primers Hpa1-U6-for and DR-Com-rev1;

the primer group (4) comprises primers Hpa1-U6-for and DR-Com-rev2;

the nucleotide sequence of Hpa1-U6-for is shown as SEQ ID NO. 4;

the DR-Com-rev1 nucleotide sequence is shown in SEQ ID NO. 7;

the DR-Com-rev2 nucleotide sequence is shown in SEQ ID NO. 8.

Preferably, the temperature of the double enzyme digestion is independently 35-39 ℃;

the double enzyme digestion time is independently 0.5-1.5 h;

the electrophoresis adopts agarose gel electrophoresis with the concentration of 0.6 to 1.0 percent;

the temperature of the connection is independently 20-25 ℃;

the connection time is independently 5-20 min.

Preferably, the competent E.coli is a TStbl3 E.coli competent strain;

the concentration of the ampicillin is 80-120 mug/mL;

the sequencing identification is carried out by adopting a universal primer U6, and the nucleotide sequence of the universal primer U6 is shown as SEQ ID NO. 9.

The invention also provides an exosome aptamer fusion expression plasmid, the structure of the exosome aptamer fusion expression plasmid is pcDNA3.1-Com-CD63-MCP, and the nucleotide sequence of the exosome aptamer fusion expression plasmid is shown as SEQ ID NO. 3.

The invention also provides a preparation method of the exosome aptamer fusion expression plasmid, which comprises the following steps:

using the psPAX2-D64V-NC-Com plasmid as a template to amplify a fragment Com;

amplifying fragment CD63 by using pcDNA3.1-CD63 plasmid as a template;

using the psPAX2-D64V-NC-MCP plasmid as an amplification template to amplify fragment MCP-2;

carrying out double enzyme digestion on the pcDNA3.1 plasmid by using EcoR I and Xho I endonucleases, and recovering a DNA product as a vector skeleton DNA;

recombining the vector skeleton DNA, the fragment Com, the fragment CD63 and the fragment MCP-2 by a one-step cloning kit according to the sequence of the vector skeleton DNA, the fragment Com, the fragment CD63 and the fragment MCP-2 to obtain a recombined product;

transforming the recombinant product into competent bacteria, selecting positive clones, and then sequencing and identifying to obtain pcDNA3.1-Com-CD63-MCP;

the nucleotide sequence of the Com is shown as SEQ ID NO. 10;

the nucleotide sequence of the CD63 is shown as SEQ ID NO. 11;

the nucleotide sequence of the MCP-2 is shown as SEQ ID NO. 12.

Preferably, the temperature of the recombination is 48-52 ℃;

the recombination time is 12-18 min;

the competent bacteria were DH 5. Alpha. Competent bacteria.

The invention also provides a targeted gene RNA editing method, which comprises the following steps:

inserting the target gene into the RNA editor expression plasmid to obtain the RNA editor expression plasmid carrying the target gene;

transfecting an RNA editor expression plasmid carrying a target gene and the exosome aptamer fusion expression plasmid into cells for culture;

centrifuging the cells to obtain exosomes;

and (3) carrying out targeted cell infection or tissue injection on the exosomes, and completing targeted gene RNA knockout.

Preferably, the cells are HEK293T cells;

the time of the culture is 3-5 d.

The invention has the technical effects and advantages that:

according to the invention, through finding the sequence and the method for inserting the proper MS2 and Com aptamer at the crRNA neck ring position of CasRx, the modified MS2-crRNA or Com-crRNA can retain enough RNA degradation activity, and is further applied to the pre-packaging of Cas13d/crRNA RNP and the delivery of virus vectors, so that RNA knockout and editing are realized.

Drawings

FIG. 1 shows the results of direct RNA knockout efficiency tests of U6-mPCS 9sg5-MS2-CasRx and U6-mPCS 9sg5-Com-CasRx expression plasmids;

FIG. 2 is a validation result of RNA knockdown function of EV delivery CasRx-mPCSK9sg5-MS2 complex.

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

EXAMPLE 1 construction of U6-gRNA-CasRx plasmid

(1) In pXR003: casRx gRNA cloning backbone (Addgene, accession # 109053) plasmid as template, primer combination Pac1-Hpa1-U6-for/PacI-XbaI-BsmBI-C13dDR-rev, fragment amplified with high fidelity PCR kit (Noruzan, cat# P505-d 1), and PCR product purified with kit (Noruzan, cat# DC 301-01). The product number was U6-gRNA.

An upstream primer Pac1-Hpa1-U6-for amplifying the U6-gRNA TGGTTAATTAAGTTAACGAGGGCCTATTTCCCATGATT, shown in SEQ ID NO. 13;

the downstream primer PacI-XbaI-BsmBI-C13dDR-rev for amplifying U6-gRNA is TTAATTAACATCTAGAAAAAAAAGGAGACGTCCGTCTCCGTTTCAAACCCCGACCAGTT, and is shown in SEQ ID NO. 14;

the high-fidelity PCR amplification reaction system is shown in Table 1:

TABLE 1 reaction System for amplifying U6-gRNA

Composition of components	Dosage of
		2×Phanta Max Buffer	25μL
dNTP(10mM each)	1μL
		Primer F (upstream Primer)	2μL
Primer R (downstream Primer)	2μL
		DNA template (template)	1ng
Phanta Max Super-Fidelity DAN Polymerase	1μL
		ddH 2 O	Make up the system to 50. Mu.L

The procedure for the high fidelity PCR amplification reaction is shown in Table 2:

TABLE 2 reaction procedure for amplifying U6-gRNA

(2) Fragments U6-gRNA and pXR001 obtained in the above steps were used: the EF1a-CasRx-2A-EGFP (Addgene, # 109049) plasmids were each slightly below 1. Mu.g and digested with 1. Mu.L PacI enzyme at 37℃for 1h. Both were directly used to recover the cleavage product using the kit (Northey, cat# DC 301-01). For the linearized pXR001 scaffold, all recovered was reacted at 37℃for more than 15min using the following system (Table 3) using the kit (TAKARA, 2250A) to complete dephosphorylation. The dephosphorylated product is then recovered directly.

TABLE 3 pXR001 post-cutting backbone dephosphorylation reaction System

Composition of components	Dosage of
		10×Alkaline Phosphatase Buffer	5μL
Linearization of pXR001 backbone	1-20pmol
		CIAP(30U/μL)	2μL
ddH 2 O	Make up the system to 50. Mu.L

The recovered DNA product was reacted with 1. Mu. L T4 ligase (Invitrogen) at 23℃for 5 minutes or more to complete ligation according to the following system (Table 4).

TABLE 4 ligation System of U6-gRNA and pXR001 backbone

Composition of components	Dosage of
		5×T4 Ligase Buffer	2μL
U6-gRNA (insert DNA)	90fmol
		pXR001 dephosphorylation backbone (vector backbone DNA)	30fmol
T4 Ligase	1μL
		ddH 2 O	Make up the system to 10. Mu.L

(3) Conversion of ligation products to Trelief ^TM The 5α escherichia coli competent strain (qingke, cargo number TSC-C01), cloning was performed on LB plates containing 100. Mu.g/mL ampicillin, sequencing and identifying the primer CasRx-genogyping-rev to obtain the inserted clone.

Sequencing primer for identifying U6-gRNA insertion, casRx-genogyping-rev: gacctagaaggtccattagc.

And (3) taking a small amount of bacterial liquid for amplification culture to extract endotoxin-free plasmids for cell experiments.

EXAMPLE 2 construction of U6-gRNA-MS2-CasRx plasmid

(1) The intermediate process fragment was amplified with a high fidelity PCR kit (Nuo-u6-for/DR-MS 2-rev 1) using the U6-gRNA-CasRx plasmid as template and the PCR product was purified with the kit (Nuo-uzan, cat# DC 301-01). The product number is Rx-MS2-1. The fragment Rx-MS2-1 was used as a template, the primer combination Hpa1-U6-for/DR-MS2-rev2, the complete fragment to be inserted was amplified with a high fidelity PCR kit (Nuo-uzan, cat# P505-d 1), and the PCR product was purified with a kit (Nuo-uzan, cat# DC 301-01). The product number is Rx-MS2-2.

Amplification of the upstream primer Hpa1-U6-for of Rx-MS 2-1: AAGTTAACGAGGGCCTATT TCCCATGATT, as shown in SEQ ID NO. 4;

amplification of the downstream primer DR-MS2-rev1 of Rx-MS 2-1: CCAGGGCCCTGCAGACAT GGGTGATCCTCATGTTGGCCTTGGTAGGGGTTCGGTGTTTC as shown in SEQ ID NO. 5;

the upstream primer Hpa1-U6-for amplifying Rx-MS2-2 is as above;

the downstream primer DR-MS2-rev2 of the amplified Rx-MS2-2 is GCATCTAGAAAAAAAAGG AGACGTCCGTCTCCGTTTCAAACCCCGACCAGGGCCCTGCAGACATGG GTGAT, and is shown as SEQ ID NO. 6;

the amounts of the components in the high-fidelity PCR amplification reaction system are consistent with Table 1, and the high-fidelity PCR amplification reaction is shown in Table 2.

The MS2 sequences used were: GGCCAACATGAGGATCACCCATGTCTGCAG GGCC as shown in SEQ ID NO. 15.

(2) The fragments Rx-MS2-2 and U6-gRNA-CasRx plasmids obtained in the above steps were each slightly below 1. Mu.g, and digested with 1. Mu.L of HpaI and 1. Mu.L of XbaI at 37℃for 1h. The former directly uses a kit (Nuo Wei Zan, product number: DC 301-01) to recover the enzyme digestion product; the latter was electrophoresed on an agarose gel at a concentration of 0.8%, and the 13kb band was excised, followed by recovery of the linear backbone with the sol of the kit (Nuo-vone, cat# DC 301-01). The recovered DNA product was reacted with 1. Mu. L T4 ligase (Invitrogen) at 23℃for 5 minutes or more in the following system (Table 5) to complete ligation.

TABLE 5 Rx-connection System of MS2-2 and U6-gRNA-CasRx backbone

Composition of components	Dosage of
		5×T4 Ligase Buffer	2μL
Rx-MS2-2 (insert DNA)	90fmol
		U6-gRNA-CasRx (vector backbone DNA)	30fmol
T4 Ligase	1μL
		ddH 2 O	Make up the system to 10. Mu.L

The ligation products were transformed into TStbl3 E.coli competent strains (Optimum, TSC-C06), on LB plates containing 100. Mu.g/mL ampicillin, the universal primer U6 is sequenced and identified to obtain an insertion clone, wherein the sequence of the U6-crRNA-MS2 part is GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAACCCCTACCAAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCCTGGTCGGGGTTTGAAACGGAGACGGACGTCTCCTTTTTTTT, and the sequence is shown as SEQ ID NO. 1.

Identification of MS2 inserted sequencing primer U6: ATGGACTATCATATGCTTACCGTA as shown in SEQ ID NO. 9.

And (3) taking a small amount of bacterial liquid for amplification culture to extract the endotoxin-free plasmid for cell experiments.

EXAMPLE 3 construction of U6-gRNA-Com-CasRx plasmid

(1) The intermediate process fragment was amplified with a high fidelity PCR kit (Nuo-u6-for/DR-Com-rev 1) using the U6-gRNA-CasRx plasmid as template and the PCR product was purified with the kit (Nuo-uzan, cat# DC 301-01). The product number was Rx-Com-1. The fragment Rx-Com-1 was used as a template, the primer combination Hpa1-U6-for/DR-Com-rev2, the complete fragment to be inserted was amplified with a high fidelity PCR kit (Nuo-uzan, cat# P505-d 1), and the PCR product was purified with a kit (Nuo-uzan, cat# DC 301-01). The product number was Rx-Com-2.

The upstream primer Hpa1-U6-for amplifying Rx-Com-1 is as above;

the downstream primer DR-Com-rev1 of the amplified Rx-Com-1 is GGCCCTGCAGGTGGGATGCTCGCAGGCATTCAGTGGCCTTGGTAGGGGTTCGGTGTTTC, as shown in SEQ ID NO. 7;

the upstream primer Hpa1-U6-for amplifying Rx-Com-2 is as above;

the downstream primer DR-Com-rev2 of the amplified Rx-Com-2 is GCATCTAGAAAAAAAAGGAGACGTCCGTCTCCGTTTCAAACCCCGACCAGGGCCCTGCAGGTGGGATGCT, shown in SEQ ID NO. 8;

the amounts of the components in the high-fidelity PCR amplification reaction system are consistent with Table 1, and the high-fidelity PCR amplification reaction is shown in Table 2.

The Com sequences used were: GGCCACTGAATGCCTGCGAGCATCCCACCTGCAGGGCC as shown in SEQ ID NO. 16.

(2) The fragments Rx-Com-2 and U6-gRNA-CasRx plasmids obtained in the above procedure were each slightly below 1. Mu.g and digested with 1. Mu.L of HpaI and 1. Mu.L of XbaI at 37℃for 1h. The former directly uses a kit (Nuo Wei Zan, product number: DC 301-01) to recover the enzyme digestion product; the latter was electrophoresed on an agarose gel at a concentration of 0.8%, and the 13kb band was excised, followed by recovery of the linear backbone with the sol of the kit (Nuo-vone, cat# DC 301-01). The recovered DNA product was reacted with 1. Mu. L T4 ligase (Invitrogen) at 23℃for 5 minutes or more to complete ligation according to the following system (Table 6).

TABLE 6 Rx-Com-2 and U6-gRNA-CasRx backbone ligation System

Composition of components	Dosage of
		5×T4 Ligase Buffer	2μL
Rx-Com-2 (insert DNA)	90fmol
		U6-gRNA-CasRx (vector backbone DNA)	30fmol
T4 Ligase	1μL
		ddH 2 O	Make up the system to 10. Mu.L

The ligation products were transformed into TStbl3 E.coli competent strains (Optimum, TSC-C06), on LB plates containing 100. Mu.g/mL ampicillin, the universal primer U6 sequencing identifies the resulting insert clone, wherein the sequence of the U6-crRNA-Com portion is: GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGAACCCCTACCAAGGCCACTGAATGCCTGCGAGCATCCCACCTGCAGGGCCCTGGTCGGGGTTTGAAACGGAGACGGACGTCTCCTTTTTTTT, as shown in SEQ ID NO. 2.

Identification of Com inserted sequencing primer U6: ATGGACTATCATATGCTTACCGTA is shown in SEQ ID NO. 9.

And (3) taking a small amount of bacterial liquid for amplification culture to extract the endotoxin-free plasmid for cell experiments.

EXAMPLE 4 construction of pcDNA3.1-Com-CD63-MCP exosome packaging plasmid

(1) Taking the psPAX2-D64V-NC-Com plasmid as an amplification template, and amplifying a fragment Com by using a primer Com-1-F/Com-1-R PCR; taking pcDNA3.1-CD63 plasmid as an amplification template, and amplifying fragment CD63 by using a primer CD63-F2/CD63-R2 PCR; taking the psPAX2-D64V-NC-MCP plasmid as an amplification template, and amplifying a fragment MC P-2 by using a primer MCP-2-F/MCP-2-R PCR, wherein the sequences of the primers are respectively as follows:

Com-1-F CCACTAGTCCAGTGTGGTGGAATTCatgaaatcaattcgctgtaaa, as shown in SEQ ID NO. 17.

Com-1-R catttcattcctccttccaccgccatggctgccgggcctgggctctgtccacctccacctccg gagttgt, as shown in SEQ ID NO. 18.

CD63-2-F acaactccggaggtggaggtggacagagcccaggcccggcagccatggcggtggaag gaggaatgaaatg, as shown in SEQ ID NO. 19.

CD63-2-R gaagccatggatccacctccaccggacatcacctcgtagccacttct, as shown in SEQ ID NO. 20.

MCP-2-F: tggatccatggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgt gatggcgtccaatttcacgcag as shown in SEQ ID NO. 21.

MCP-2-R TTTAAACGGGCCCTCTAGACTCGAGctagtatataccggagttggct gcga as shown in SEQ ID NO. 22.

The amounts of the components in the high-fidelity PCR amplification reaction system are consistent with Table 1, and the high-fidelity PCR amplification reaction is shown in Table 2.

(2) Taking 1 mug of pcDNA3.1 plasmid, carrying out double digestion for 2 hours at 37 ℃ by using EcoR I and Xho I endonucleases (NEB company), and recovering a DNA product (serving as a vector skeleton DNA) by using a kit (Nuo-vozan, product number: DC 301-01); the recombination reaction was then completed using One step cloning kit (next holy, cat# 10922E S20) according to the following system (Table 7) at 50℃for 15 min:

TABLE 7 construction of recombinant reaction System of pcDNA3.1-Com-CD63-MCP

Composition of components	Dosage of
		Com	0.15pmol
CD63	0.15pmol
		MCP-2	0.15pmol
Vector backbone DNA	0.05pmol
		2×Hieff Clone Universal Enzyme Premix	10μL
ddH2O	Make up the system to 20. Mu.L

After the recombination reaction is completed, DH5 alpha competent bacteria (in the family of the general formula of the Optimazaceae: TSC-C14) are transformed by the recombination products, and are picked up on an LB plate, and the expression plasmid pcDNA3.1-Com-CD63-MCP with the sequence of GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCATGAAATCAATTCGCTGTAAAAACTGCAACAAACTGTTATTTAAGGCGGATTCCTTTGATCACATTGAAATCAGGTGTCCGCGTTGCAAACGTCACATCATAATGCTCAACGCTTGTGAACACCCTACGGAGAAACATTGTGGGAAAAGAGAAAAAATCACGCATTCTGACGAAACCGTGCGTTATGGCGGTCACAACTCCGGAGGTGGAGGTGGACAGAGCCCAGGCCCGGCAGCCATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTTCTTGCTCTACGTCCTCCTGCTGGCCTTTTGCGCCTGTGCAGTGGGACTGATTGCCGTGGGTGTCGGGGCACAGCTTGTCCTGAGTCAGACCATAGGCGCGCCGAGCTCGAGGATCCTTGCTAGCATCCAGGGGGCTACCCCTGGCTCTCTGTTGCCAGTGGTCATCATCGCAGTGGGTGTCTTCCTCTTCCTGGTGGCTTTTGTGGGCTGCTGCGGGGCCTGCAAGGAGAACTATTGTCTTATGATCACGTTTGCCATCTTTCTGTCTCTTATCATGTTGGTGGAGGTGGCCGCAGCCATTGCTGGCTATGTGTTTAGAGATAAGGTGATGTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCGAAAAATAACCACACTGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACACAGATTGGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAATGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCAGCCCTTGGAATTGCTTTTGTCGAGGTTTTGGGAATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAGAAGTGGCTACGAGGTGATGTCCGGTGGAGGTGGATCCATGGCTTCTAACTTTACTCAGTTCGTTCTCGTCGACAATGGCGGAACTGGCGACGTGATGGCGTCCAATTTCACGCAGTTCGTCCTGGTTGACAACGGGGGGACTGGGGACGTTACGGTCGCTCCGAGCAACTTTGCCAATGGTATTGCGGAGTGGATTTCTTCTAATTCACGGTCCCAAGCTTACAAAGTGACCTGTTCCGTGCGGCAAAGTTCTGCTCAGAATAGAAAGTACACTATAAAGGTCGAAGTCCCTAAGGGGGCCTGGCGATCATATCTCAATATGGAGCTTACCATCCCAATATTTGCCACTAATTCTGATTGTGAATTGATTGTCAAAGCAATGCAAGGACTCTTGAAAGACGGAAACCCAATCCCCAGCGCAATCGCAGCCAACTCCGGTATATACTAGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC is obtained through sequencing identification, and is shown as SEQ ID NO. 3.

The nucleotide sequences of Com, CD63 and MCP are shown in SEQ ID NO.10, NO.11 and NO.12, respectively.

Experimental example 1 construction of cell line HEK293T-mPCS 9-P2A-mCh erry expressing mouse Pcsk9

(1) Construction of pLent-CMV-mPCS 9-P2A-mCherry expression plasmid

We used lentiviral vector pLent-CMV-Luc2-P2A-mCherry as cloning vector (sea Ji Haoge Co., product number: HH-LV-172), cloned mouse mPCSK9 cDNA, PCR amplified, and constructed pLent-CMV-mPCSK9-P2A-mCherry by recombinant cloning.

Using pcDNA3.1-mPCSK9 as a template, and using BamH1-mPCSK9-F and mPCSK9-P2A-R to amplify fragments, which are marked as mPCSK9-P2A;

using the plasmid with mCherry as a template, the fragment was amplified with P2A-mCherry-F and Xho1-mCherry-R, designated as P2A-mCherry;

bridging the fragments mPCS 9-P2A and P2A-mCherry to obtain the fragment mPCS 9-P2A-mCherry, and carrying out double enzyme digestion, ligation and conversion on the fragment and plasmid plenti6.2-BSD by BamH1 and Xho1 respectively.

The amounts of the components in the high-fidelity PCR amplification reaction system are consistent with Table 1, and the high-fidelity PCR amplification reaction is shown in Table 2.

BamH1-mPCSK9-F GCCGGATCCATGGGCACCCACTGCTCTGC as shown in SEQ ID NO. 23.

mPCS 9-P2A-R TGGCCCGGGATTCTCTTCGACATCCCCTGCTTGTTTCAACAGGGAGAAGTTAGTGGCCTGAACCCAGGAGGCCTTTG as shown in SEQ ID NO. 24.

P2A-mCherry-F: GCCACTAACTTCTCCCTGTTGAAACAAGCAGGGGATGTCGAAGAGAATCCCGGGCCAATGGTGAGCAAGGGCGAGGA as shown in SEQ ID NO. 25.

Xho1-mCherry-R: GCCCTCGAGTTACTTGTACAGCTCGTCCA as shown in SEQ ID NO. 26.

(2) Lentivirus package

Corresponding to 1-2×10 per 10cm culture dish ⁶ HEK293T cells were seeded at 37℃with 5% CO ₂ The incubator was cultured overnight. The culture medium comprises the following components: 89% dmem broth +10% serum +1% diabody. The next day when HEK293T cell confluence reached about 70%, a transfection premix system was formulated as follows (table 8). pLeRatio of nt-CMV-mPcSK9-P2A-mCherry, psPAX2 to pM D2.G mass ratio 2:2:1

TABLE 8 transfection System for packaging lentiviruses with HEK293T cell lines

Composition of components	Dosage of
		DMEM	750μL
pLent-CMV-mPCSK9-P2A-mCherry	6μg
		psPAX2	6μg
pMD2.G	3μg
		lipo8000 transfection reagent	24μL

After mixing, it was allowed to stand at room temperature for 10min and then gently added dropwise to HEK293T cell supernatant.

Fresh medium was refreshed after 24h post-transfection culture. The culture supernatant was collected 48h after transfection and filtered through a 0.45 μm pore size filter, and the filtrate obtained was the lentiviral suspension.

(3) Lentiviral infection

Immediately after addition of polybrene at a final concentration of 8. Mu.g/mL, the supernatant to be infected HEK293T, which had been prepared in advance and had a confluence of about 70-80%, was replaced for infection. Lentiviral supernatants and cells to be infected at 37℃5％CO ₂ The incubator was incubated for 8h and the lentivirus had entered essentially HEK293T to be infected and integrated into the genome. The fresh culture medium is replaced for further culture for 48 hours to restore the healthy state of the cells for normally expressing the protein.

(4) Positive integration screening

The HEK293T cells after recovery culture are passaged to a new culture dish according to the proportion of 1:3, blasticidin S with the final concentration of 8 mug/mL is added according to the culture volume during inoculation, and the mixture is placed at 37 ℃ and 5% CO ₂ Culturing in an incubator. Some of the cells died after a short period of time after the addition of the drug, and stable resistant cell lines were visible after about 5 days. Candidate strain positions were found and determined under a microscope, cell lines were scraped and rapidly aspirated using a small volume gun head, transferred to individual wells of a 48 well plate, and expanded for culture with blasticidin S selection pressure maintained at a final concentration of 4 μg/mL.

(5) Identification of positive integration strains

qPCR was performed on the stably transformed cell lines to determine mPCSK9 expression.

qPCR identification primer:

the mouse Pcsk9 qPCR F GCCCATCGGGAGATTGAGG is shown as SEQ ID NO. 27.

mouse Pcsk9 qPCR R: TTCCCTTGACAGTTGAGCACA as shown in SEQ ID No. 28.

Experimental example 2 construction of U6-mPCSK9sg5-MS2-CasRx plasmid

(1) Mu.g of vector U6-gRNA-MS2-CasRx was digested with 1. Mu.L of BsmB1 endonuclease at 37℃for 1h. The 13.33kb band was excised by agarose gel electrophoresis at a concentration of 0.8%, and the DNA fragment was recovered by using a kit (Nuo-vone, cat# DC 301-01) sol.

(2) 5 mu L of each primer pair mPCSK9-sg5-for/mPCSK9-sg5-rev is uniformly mixed, incubated for 5min at 94 ℃, naturally cooled to room temperature, and the denaturation-annealing step is completed to form double-stranded DNA. The primer sequences used are as follows.

mPCSK9-sg5-for: AAACGTGGGTGCCGTGGCTGTCACACTTGCTCG C as shown in SEQ ID NO. 29.

mPCSK9-sg5-rev: AAAAGCGAGCAAGTGTGACAGCCACGGCACCC AC as shown in SEQ ID NO. 30.

The amounts of the components in the high-fidelity PCR amplification reaction system are consistent with Table 1, and the high-fidelity PCR amplification reaction is shown in Table 2.

(3) This was reacted with the recovered U6-gRNA-MS2-CasRx cut backbone with 1. Mu. L T4 ligase (Invitrogen) at 23℃for 5min or more to complete ligation as described below (Table 9).

TABLE 9 ligation System of primer pair double strand and U6-gRNA-MS2-CasRx backbone

Composition of components	Dosage of
		5×T4 Ligase Buffer	2μL
sg5 primer pair double strand (insert DNA)	3μL
		U6-gRNA-MS2-CasRx (vector backbone DNA)	30fmol
T4Ligase	1μL
		ddH 2 O	Make up the system to 10. Mu.L

The ligation product was transformed into a competent strain of TStbl3 E.coli (Opt. TSC-C06 of the family Praeparatae), clones were picked on LB plates containing 100. Mu.g/mL ampicillin, and universal primer U6 was sequenced and identified to obtain insert clones.

Identification of MS2 inserted sequencing primer U6: ATGGACTATCATATGCTTACCGTA.

And (3) taking a small amount of bacterial liquid for amplification culture to extract the endotoxin-free plasmid for cell experiments.

Experimental example 3 construction of U6-mPCS 9sg5-Com-CasRx plasmid

(1) Mu.g of vector U6-gRNA-Com-CasRx was digested with 1. Mu.L of BsmB1 endonuclease at 37℃for 1h. The 13.33kb band was excised by agarose gel electrophoresis at a concentration of 0.8%, and the DNA fragment was recovered by using a kit (Nuo-vone, cat# DC 301-01) sol.

(2) 5 mu L of each primer pair mPCSK9-sg5-for/mPCSK9-sg5-rev is uniformly mixed, incubated for 5min at 94 ℃, naturally cooled to room temperature, and the denaturation-annealing step is completed to form double-stranded DNA. The resulting U6-gRNA-Com-CasRx digested backbone was reacted with 1. Mu. L T4 ligase (Invitrogen) at 23℃for 5min or more to complete ligation as described below (Table 10).

Table 10 primer pair double strand and U6-gRNA-Com-CasRx backbone ligation System

Composition of components	Dosage of
		5×T4 Ligase Buffer	2μL
sg5 primer pair double strand (insert DNA)	3μL
		U6-gRNA-Com-CasRx (vector backbone DNA)	30fmol
T4 Ligase	1μL
		ddH 2 O	Make up the system to 10. Mu.L

The ligation product was transformed into a competent strain of TStbl3 E.coli (Opt. TSC-C06 of the family Praeparatae), clones were picked on LB plates containing 100. Mu.g/mL ampicillin, and universal primer U6 was sequenced and identified to obtain insert clones.

Identification of Com inserted sequencing primer U6: ATGGACTATCATATGCTTACCGTA.

And (3) taking a small amount of bacterial liquid for amplification culture to extract the endotoxin-free plasmid for cell experiments.

Experimental example 4 testing of direct RNA knockout efficiency of U6-mPCS 9sg5-MS2-CasRx and U6-mPCS 9sg5-Com-CasRx expression plasmids

(1) Lipo8000 transfection reagent (Biyun Tian, cat# C0533) was used. When HEK293T cells reached 70-80% confluence, plasmid and reagents were mixed as follows (Table 11), allowed to stand at room temperature for 10min, and added to the cell culture medium. Each group used 3-well HEK293T cells as biological replicates.

Single-well transfection mixed reagent system of table 1124 pore plate

Composition of components	Dosage of
		DMEM	50μL
U6-mPCS 9sg5-MS2-CasRx plasmid	0.5μg
		lipo8000 transfection reagent	1μL

(2) After 48h of transfection, transfected cells were collected, RNA was extracted using RNA isolater Total RNA Extraction Reagent (Nuo's praise, cat# R401) and reverse transcribed into cDNA using HiScript III RT SuperMix for qPCR (+gDNA wind) (Nuo's praise, cat# R323).

(3) Fluorescent quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Norflu, cat# Q711) and the transfected U6-mPCSK9sg5-MS2-CasRx and U6-mPCSK9sg5-Com-CasRx were analyzed to significantly reduce cellular mPCSK9 expression, and the results are shown in FIG. 1. Amplification primers used for fluorescent quantitative PCR are shown below.

mouse Pcsk9 qPCR F：GCCCATCGGGAGATTGAGG

mouse Pcsk9 qPCR R：TTCCCTTGACAGTTGAGCACA

Experimental example 5 packaging of U6-mPCS 9sg5-MS2-CasRx into extracellular vesicles EV by Com-CD63-MCP

Lipo8000 transfection reagent (Biyun Tian, cat# C0533) was used. When HEK293T cells reached 70-80% confluence, each plasmid was mixed according to the following system (Table 12), allowed to stand at room temperature for 10min, and added to the cell culture medium. 3 dishes of HEK293T cells were used for each group of EV.

Table 12 packed EV mixed reagent system

Composition of components	Dosage of
		DMEM	750μL
Plasmid to be packaged (U6-mPCS)K9sg5-MS2-CasRx)	10μg
		Enrichment plasmid (pcDNA3.1-Com-CD 63-MCP)	2.5μg
Packaging plasmid (pMD 2. G)	2.5μg
		lipo8000 transfection reagent	24μL

Experimental example 6 enrichment and quantification of EV

(1) After overnight transfection, the cells were replaced with pure serum-free DMEM medium. After 48 hours, the culture supernatants of each group of 3 dishes are collected together into a 50mL centrifuge tube, and are centrifuged at 4 ℃ and 2000 Xg for 15 minutes;

(2) The ultracentrifuge tube and the ultracentrifuge adapter were sterilized by infiltration with alcohol and air-dried in a safety cabinet. The culture supernatant after low-speed centrifugation was filtered through a 0.22 μm filter, and the filtrate was collected into an ultracentrifuge tube.

(3) Each adapter of the ultracentrifuge rotor was tightly trimmed using sterile PBS and ultracentrifuged at 4℃under 120000Xg for 70 min. Slowly pouring out the supernatant after the completion, and sucking residual liquid at the orifice of the injection tube by using a liquid-transferring gun;

(4) The bottom material of the ultracentrifuge tube was resuspended using 200. Mu.L of sterile PBS and was not visible to the naked eye. 10. Mu.L of EV suspension was stored for short term use in nanoparticle counting, the remainder was sub-packaged. The EV suspension can be left overnight at 4℃for a maximum of 1 week; if long-term storage is needed, the product can be placed at-80 ℃ to avoid repeated freezing and thawing.

Experimental example 7 EV RNA knockdown functional verification of CasRx-mPCSK9sg5-MS2 Complex delivery

(1) Particle size analysis and counting were performed on particles in EV suspension using a nanoparticle tracking analyzer, and EV usage was calculated proportionally. Fine with HEK293TFor example, the EV/cell number ratio is about 10 ³ -10 ⁶ Is not limited in terms of the range of (a).

(2) Counting cells, plating the cells according to a proper quantity, after the cells are attached, absorbing and discarding culture supernatant, replacing the culture supernatant with serum-free DMEM culture medium, slowly dripping EV suspension with a corresponding volume into the culture medium, and gently shaking and mixing the EV suspension.

(3) The recipient cells were collected 24h by EV treatment, RNA was extracted using RNA isolater Total RNA Extrac tion Reagent (Nuo Zan, cat# R401), and reverse transcribed into cDNA using HiScript III RT Sup erMix for qPCR (+gDNA wind) (Nuo Zan, cat# R323).

(4) Fluorescence quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Norflu, cat# Q711) and analyzed for EV administration with the encapsulated CasRx-mPCSK9sg5, which significantly reduced cellular mPCSK9 expression, as shown in FIG. 2. Amplification primers used for fluorescent quantitative PCR are shown below.

mouse Pcsk9 qPCR F:GCCCATCGGGAGATTGAGG

mouse Pcsk9 qPCR R：TTCCCTTGACAGTTGAGCACA。

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (10)

1. The RNA editor expression plasmid is characterized by having a structure of U6-gRNA-MS2-Cas13d, wherein the U6-gRNA-MS2-Cas13d comprises a nucleotide sequence shown as SEQ ID NO. 1;

or, the RNA editor expression plasmid has a structure of U6-gRNA-Com-Cas13d, wherein the U6-gRNA-Com-Cas13d comprises a nucleotide sequence shown as SEQ ID NO. 2.

2. The method for preparing the RNA editor expression plasmid of claim 1, comprising the steps of:

the U6-gRNA-CasRx plasmid is used as a template, the primer group (1) is adopted for amplification, and the PCR product Rx-MS2-1 is obtained after purification;

amplifying by using the PCR product Rx-MS2-1 as a template and adopting a primer group (2), and purifying to obtain the PCR product Rx-MS2-2;

carrying out double enzyme digestion on the obtained PCR product Rx-MS2-2 by adopting HpaI and XbaI to obtain an enzyme digestion product I;

double digestion is carried out on the U6-gRNA-CasRx plasmid by adopting HpaI and XbaI to obtain a digestion product II, electrophoresis is carried out on the digestion product II, a 13kb strip is cut off, a linear framework is recovered, and the linear framework is connected with the digestion product I by adopting T4 ligase to obtain a connection product;

transforming competent escherichia coli with the connection product, picking positive clones through ampicillin, and sequencing and identifying to obtain a successfully constructed plasmid U6-gRNA-MS2-CasRx;

the primer group (1) comprises primers Hpa1-U6-for and DR-MS2-rev1;

the primer group (2) comprises primers Hpa1-U6-for and DR-MS2-rev2;

the nucleotide sequence of Hpa1-U6-for is shown as SEQ ID NO. 4;

the DR-MS2-rev1 nucleotide sequence is shown as SEQ ID NO. 5;

the DR-MS2-rev2 nucleotide sequence is shown as SEQ ID NO. 6.

3. The method for preparing the RNA editor expression plasmid of claim 1, comprising the steps of:

the U6-gRNA-CasRx plasmid is used as a template, the primer group (3) is adopted for amplification, and the PCR product Rx-Com-1 is obtained after purification;

amplifying by using the PCR product Rx-Com-1 as a template and adopting a primer group (4), and purifying to obtain a PCR product Rx-Com-2;

carrying out double enzyme digestion on the obtained PCR product Rx-Com-2 by adopting HpaI and XbaI to obtain an enzyme digestion product III;

double digestion is carried out on the U6-gRNA-CasRx plasmid by adopting HpaI and XbaI to obtain a digestion product IV, electrophoresis is carried out on the digestion product IV, a 13kb strip is cut off, a linear framework is recovered, and the linear framework is connected with the digestion product III by adopting T4 ligase to obtain a connection product;

transforming competent escherichia coli with the connection product, picking positive clones through ampicillin, and sequencing and identifying to obtain a successfully constructed plasmid U6-gRNA-Com-CasRx;

the primer group (3) comprises primers Hpa1-U6-for and DR-Com-rev1;

the primer group (4) comprises primers Hpa1-U6-for and DR-Com-rev2;

the nucleotide sequence of Hpa1-U6-for is shown as SEQ ID NO. 4;

the DR-Com-rev1 nucleotide sequence is shown in SEQ ID NO. 7;

the DR-Com-rev2 nucleotide sequence is shown in SEQ ID NO. 8.

4. The method for preparing an RNA editor expression plasmid according to claim 2 or 3, wherein the temperature of the double cleavage is independently 35-39 ℃;

the double enzyme digestion time is independently 0.5-1.5 h;

the electrophoresis adopts agarose gel electrophoresis with the concentration of 0.6 to 1.0 percent;

the temperature of the connection is independently 20-25 ℃;

the connection time is independently 5-20 min.

5. A method of preparing an RNA editor expression plasmid according to claim 2 or 3, wherein the competent escherichia coli is a TStbl3 escherichia coli competent strain;

the concentration of the ampicillin is 80-120 mug/mL;

the sequencing identification is carried out by adopting a universal primer U6, and the nucleotide sequence of the universal primer U6 is shown as SEQ ID NO. 9.

6. The exosome aptamer fusion expression plasmid is characterized by having a structure of pcDNA3.1-Com-CD63-MCP, and the nucleotide sequence of the exosome aptamer fusion expression plasmid is shown as SEQ ID NO. 3.

7. The method for preparing the exosome aptamer fusion expression plasmid according to claim 6, which comprises the following steps:

using the psPAX2-D64V-NC-Com plasmid as a template to amplify a fragment Com;

amplifying fragment CD63 by using pcDNA3.1-CD63 plasmid as a template;

using the psPAX2-D64V-NC-MCP plasmid as an amplification template to amplify fragment MCP-2;

carrying out double enzyme digestion on the pcDNA3.1 plasmid by using EcoR I and Xho I endonucleases, and recovering a DNA product as a vector skeleton DNA;

recombining the vector skeleton DNA, the fragment Com, the fragment CD63 and the fragment MCP-2 by a one-step cloning kit according to the sequence of the vector skeleton DNA, the fragment Com, the fragment CD63 and the fragment MCP-2 to obtain a recombined product;

transforming the recombinant product into competent bacteria, selecting positive clones, and then sequencing and identifying to obtain pcDNA3.1-Com-CD63-MCP;

the nucleotide sequence of the Com is shown as SEQ ID NO. 10;

the nucleotide sequence of the CD63 is shown as SEQ ID NO. 11;

the nucleotide sequence of the MCP-2 is shown as SEQ ID NO. 12.

8. The method for preparing the exosome aptamer fusion expression plasmid according to claim 7, wherein the temperature of recombination is 48-52 ℃;

the recombination time is 12-18 min;

the competent bacteria were DH 5. Alpha. Competent bacteria.

9. The targeted gene RNA editing method is characterized by comprising the following steps of:

inserting a target gene into the RNA editor expression plasmid of claim 1 to obtain an RNA editor expression plasmid carrying the target gene;

transfecting an RNA editor expression plasmid carrying a target gene and the exosome aptamer fusion expression plasmid of claim 6 into cells for culturing;

centrifuging the cells to obtain exosomes;

and (3) carrying out targeted cell infection or tissue injection on the exosomes, and completing targeted gene RNA knockout.

10. The method for editing targeted gene RNA of claim 9, wherein the cells are HEK293T cells;

the time of the culture is 3-5 d.

Images