CN116790597A

CN116790597A - sgRNA targeting TOR1A protein and application thereof

Info

Publication number: CN116790597A
Application number: CN202310859021.8A
Authority: CN
Inventors: 唐宇; 吴俊娇
Original assignee: Xiangya Hospital of Central South University
Current assignee: Xiangya Hospital of Central South University
Priority date: 2023-07-13
Filing date: 2023-07-13
Publication date: 2023-09-22

Abstract

The invention belongs to the biomedical field, and discloses a targeting TOR1A protein sgRNA, wherein the nucleotide sequence of the sgRNA is shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO. 16. The sgRNA can specifically bind to TOR1A ^ΔE Allele sequence binding, in turn bound by NmCas9, results in TOR1A ^ΔE The mutant sequence is cleaved and the coding ability is lost. The present invention discovers NmCas9 associationDifferential sgRNA (sgMut-Nm 21, sgMut-Nm23, sgMut-Nm 24) vs SaCas9-KKH (sgMut-KKH 1) vs. mutant TOR1A ^ΔE The cleavage specificity of the gene is stronger, and the WT TOR1A gene is hardly cleaved; and compared with SpCa9-V (R) QR (sgMut-VQR 1), the cutting efficiency is higher.

Description

sgRNA targeting TOR1A protein and application thereof

Technical Field

The invention belongs to the field of biomedicine, and relates to a targeting TOR1A protein sgRNA and application thereof in DYT1 dystonia treatment.

Background

DYT1 dystonia is a hereditary isolated dystonia, manifested byInvoluntary movements or postural anomalies resulting from sustained or intermittent muscle contractions. Genetically, this premature dyskinesia is caused by a 3-bp heterozygous in-frame deletion of exon 5 of the TOR1A gene (c.907_909 delGAG), resulting in the TOR1A protein (TOR 1A ^ΔE ) 1 glutamic acid residue is lost at position 302 or 303. TOR1A is a ubiquitously expressed aaa+ protein, localized in the continuous lumen of the Endoplasmic Reticulum (ER)/Nuclear Envelope (NE). The biological role of TOR1A has not been fully elucidated so far, however, it has been found to be involved in a variety of biological functions including protein quality control as a chaperone, PERK-eif2α signaling associated with regulation of ER emergency and association, regulation of nuclear framework and cytoskeletal (LINC) complexes and cell polarity, biogenesis of nuclear pores, membrane balance and nuclear mass transport, synaptic vesicle cycling and excretion of large ribonucleoprotein particles through NEs to cell membranes, and the like.

Many of these functions may involve protein interactions in the ER. Studies have shown that TOR1A ^ΔE Mutations act in a variety of ways by compromising TOR1A function. Aaa+ proteins generally function in multimeric form. TOR1A was found to interact with LAP1 (on NE) and LULL1 (on ER), respectively, to form a hexamer and trigger ATP hydrolysis and decomposition, thus exerting its enzymatic activity, as also demonstrated by the crystal structure. Specifically, the C-terminal region of TOR1A functions inside the TOR1A/LULL1 and TOR1A/LAP1 hexamers, while the ΔE mutants result in their binding being unstable, resulting in a decrease in their ATPase activity.

DYT1 dystonia is caused by TOR1A ^ΔE There is still controversy to date caused by loss of function (insufficient haploid dose) or dominant negative (domino-negative) of mutations. However, the dominant negative is indeed involved in the pathological process of DYT 1. For example, TOR1A ^ΔE Accumulation in NE results in the formation of NE-derived membranous inclusions known as spheroids. TOR1A ^ΔE Overexpression results in recruitment of wild-type (WT) TOR1A into spheroids by selective defaulting of TOR1A ^ΔE This process can be inhibited, restoring its normal subcellular localization and function. Similarly, protein quality control mechanisms are also known as TOR1A ^ΔE Inhibition ofResulting in an abnormal accumulation of Ubiquitin (Ubiquitin) around the nucleus. In addition, TOR1A promotes replication of Herpes Simplex Virus (HSV) capsids in the nucleus across NEs into the cell membrane and out of the cell, while endogenous levels of TOR1A ^ΔE Interfering with this process. The normal TOR1A activity is significantly increased by genome editing of the mutant allele and its function of promoting HSV replication in DYT1 fibroblasts is restored. To further support its dominant negative effect, previous studies have also demonstrated that selective deposition of mRNA for TOR1A mutants with small interfering RNAs (siRNAs) or antisense oligonucleotides (ASOs) can restore the DYT1 phenotype to normal.

Previous prior art attempts to specifically target TOR1A mutant alleles have been made, but the SpCas9-VRQR and sgRNA used were less specific for identifying both the mutant and WT alleles.

Disclosure of Invention

The present invention aims at providing a targeting of the sgRNA of the TOR1A protein, which is specific for TOR1A ^ΔE Allele sequence binding, in turn bound by NmCas9, results in TOR1A ^ΔE The mutant sequence is cleaved and the coding ability is lost.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

sgRNA targeting TOR1A protein, which is specific for TOR1A ^ΔE The allele sequences are bound, in turn by NmCas 9.

As a preferred mode, the nucleotide sequence of the sgRNA is shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO. 16.

The sgRNA shown in SEQ ID No.1 is designated as sgMut-Nm21, and sgMut-Nm21 is 21 nucleotides before the PAM site that recognizes NmCas9, and has a 3-nt mismatch compared to the wild-type TOR1A nucleotide sequence.

sgMut-Nm21 nucleotide sequence and TOR1A ^ΔE The nucleotide sequences match perfectly.

The sgRNA shown in SEQ ID No.2 was designated as sgMut-Nm24, and sgMut-Nm24 was 24 nucleotides before the PAM site recognizing NmCas9, and the sequence had a 3-nt mismatch compared to the wild-type TOR1A nucleotide sequence.

sgMut-Nm24 nucleotide sequence and TOR1A ^ΔE The nucleotide sequences match perfectly.

The sgRNA shown in SEQ ID No.16 is designated as sgMut-Nm23, and sgMut-Nm23 is 23 nucleotides before the PAM site that recognizes NmCas9, and has a 3-nt mismatch compared to the wild-type TOR1A nucleotide sequence.

sgMut-Nm23 nucleotide sequence and TOR1A ^ΔE The nucleotide sequences match perfectly.

The sgRNA targeting TOR1A protein can be specific to TOR1A ^ΔE Allele sequence binding, in turn bound by NmCas9, results in TOR1A ^ΔE The mutant sequence is cleaved and the coding ability is lost.

The nucleotide sequence for encoding the NmCas9 is shown as SEQ ID NO.7, and the amino acid sequence of the NmCas9 is shown as SEQ ID NO. 8.

A recombinant plasmid or recombinant virus comprising sgRNA as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 16.

An escherichia coli comprising sgrnas as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 16; or a recombinant plasmid, or a recombinant virus.

Based on the same invention, the invention also claims the application of the sgRNA targeting the TOR1A protein, the recombinant plasmid or the recombinant virus or the escherichia coli in preparing medicines for treating DYT1 dystonia.

As a preferred mode, the targeting of the sgRNA specificity of the TOR1A protein to TOR1A ^ΔE Allele sequence binding, in turn bound by NmCas9, results in TOR1A ^ΔE The mutant sequence is cleaved and the coding ability is lost.

Based on the same inventive creation, the invention also claims a kit comprising the TOR1A protein targeting sgRNA, the recombinant plasmid or recombinant virus, or the e.

The invention also claims the application of the kit in preparing a reagent for treating DYT1 dystonia.

As a preferred mode, the sgRNA is of human or non-human mammal origin, preferably of human origin.

Compared with the prior art, the invention has the beneficial effects that:

the present invention found that NmCas9 combined discriminatory sgRNA (sgMut-Nm 21, sgMut-Nm23, sgMut-Nm 24) was compared to SaCas9-KKH (sgMut-KKH 1) on mutant TOR1A ^ΔE The cleavage specificity of the gene is stronger, and the WT TOR1A gene is hardly cleaved; and compared with SpCa9-V (R) QR (sgMut-VQR 1), the cutting efficiency is higher. In addition, nmCas9 is a compact Cas enzyme of size 1082aa, which is more suitable for packaging into adeno-associated virus (AAV) commonly used in gene therapy than conventional SpCas9 (1368 aa), and thus, its clinical transformation value is more prominent.

Drawings

FIG. 1 is an approach to developing allele-specific targeting TOR1A using CRISPR ^ΔE Policy analysis of (2);

A. utilizing an AsCRISPR website to carry out In silico analysis results; B. selected sgRNA sequences for allele-specific editing.

FIG. 2 is a pCAG-EGFxFP-hTorr 1A-WT-gDNA plasmid map;

FIG. 3 is a pCAG-EGFxFP-hTorr 1A-Mut-gDNA plasmid map;

FIG. 4 is a plasmid map using NmCas9 for allele-specific targeting;

FIG. 5 is a plasmid map of allele-specific targeting using SaCas 9-KKH;

FIG. 6 is a plasmid map of allele-specific targeting using SpCas 9-VQR;

FIG. 7 is an experiment verifying cleavage efficiency and targeting specificity of an identifying sgRNA;

A. identifying a schematic of sgRNA cleavage efficiency using the pCAG-egfxfp system; B. an identifying sgRNA length setting; cleavage of sgRNA in c.293t cells resulted in EGFP fluorescence results; D. an EGFP fluorescence statistics map was generated.

FIG. 8 is an identification of sgRNA/NmCas9 to reduce perinuclear Ubiquitin aggregation in fibroblasts of DYT1 patients; A. a carrier diagram; B. vector expression in fibroblasts (HA; green fluorescent staining), perinuclear Ubiquitin aggregation (red fluorescent staining); C. statistics of the proportion of perinuclear Ubiquitin aggregation.

FIG. 9 is a schematic diagram of the structure of a packaging plasmid.

FIG. 10 is a schematic structural diagram of an envelope plasmid.

FIG. 11 is a schematic structural diagram of the 0420 carrier.

Fig. 12 is a schematic structural diagram of the 0421 carrier.

Fig. 13 is a schematic structural diagram of the 0422 carrier.

FIG. 14 is a schematic structural diagram of a 0423 carrier.

Fig. 15 is a schematic structural diagram of the 0424 carrier.

FIG. 16 is a schematic structural diagram of the 0425 carrier.

Fig. 17 is a schematic structural diagram of the 0426 carrier.

Fig. 18 is a schematic structural diagram of the 0427 carrier.

Fig. 19 is a schematic structural diagram of the 0428 carrier.

FIG. 20 is a schematic structural diagram of the 0429 carrier.

FIG. 21 is a schematic structural diagram of a 0430 carrier.

FIG. 22 is a schematic structural diagram of the 0431 carrier.

FIG. 23 is a schematic structural diagram of the 0432 carrier.

Detailed Description

The invention will be described in detail below with reference to the drawings in connection with embodiments. It should be noted that, without conflict, the embodiments of the present invention and features of the embodiments may be combined with each other.

The experimental methods in the examples described below, unless otherwise specified, are generally according to conventional conditions such as those described in J.Sam Brooks et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations. Unless otherwise specified, all reagents involved in the examples of the present invention are commercially available products and are commercially available.

Main experiment materials

293T cell (Punuocele, # CL-0001)

DYT1 patient fibroblasts (Coriell, # GM03211 carrying TOR 1A) ^WT/ΔE Heterozygous variation

DMEM complete medium: DMEM (Gibco), 10% Fetal Bovine Serum (FBS) and 1% green streptomycin mix (Solarbio)

PEI transfection reagent (Polysciences, # 24765)

OPTI-MEM(Gibco,#31985062)

LB liquid medium: peptone 10g, yeast extract 5g, naCl 5g (constant volume to 1L, high pressure steam sterilization, preservation at 4 ℃)

LB solid medium: peptone 10g, yeast extract 5g, naCl 5g, agar 15g (constant volume to 1L, high pressure steam sterilization), cooling, adding ampicillin, packaging, pouring into bacterial culture dish, and preserving at 4deg.C

TAE buffer (10X): tris 24.2g, EDTA 5.71g, glacial acetic acid 5.71ml (constant volume to 1L)

Fluolomount-G caplet (Southern Biotech)

SanPrep plasmid extraction kit and gel recovery kit (Shanghai Ind worker)

Table 1 enzymes and reagents for molecular cloning

TABLE 2 Primary and secondary antibodies for immunofluorescent staining

The present invention provides three differential sgRNA (sgMut-Nm 21, sgMut-Nm23 and sgMut-Nm 24) sequences which are specific for TOR1A ^ΔE Allele sequence binding, in turn bound by NmCas9, results in TOR1A ^ΔE The mutant sequence is cleaved and the coding ability is lost.

The sgMut-Nm21 is 21 nucleotides before the PAM site of NmCas9, and the sequence of the sgMut-Nm21 is mismatched with 3-nt compared with the wild type TOR1A nucleotide sequence, and the nucleotide sequence is shown as SEQ ID NO. 1.

sgMut-Nm24 is 24 nucleotides before the PAM site of NmCas9, and has a 3-nt mismatch compared with the wild type TOR1A nucleotide sequence, and the nucleotide sequence is shown as SEQ ID NO. 2.

sgMut-Nm23 is 23 nucleotides before the PAM site of NmCas9, and has a 3-nt mismatch compared with the wild type TOR1A nucleotide sequence, and the nucleotide sequence is shown as SEQ ID NO. 16.

The nucleotide sequence of the genome of the wild TOR1A (exon 5) is shown as SEQ ID NO. 3.

Mutant TOR1A ^ΔE The nucleotide sequence of the genome (exon 5) is shown as SEQ ID NO. 4.

The amino acid sequence of the wild type TOR1A (full length) protein is shown as SEQ ID NO. 5.

Mutant TOR1A ^ΔE The amino acid sequence of the (full-length) protein is shown as SEQ ID NO. 6.

The NmCas9 nucleotide sequence is shown as SEQ ID NO. 7.

The amino acid sequence of the NmCas9 protein is shown in SEQ ID NO. 8.

The sgMut-KKH is 21 nucleotides before the PAM site of SaCas9-KKH is identified, and the sequence of the sgMut-KKH is 3-nt mismatched compared with the wild type TOR1A nucleotide sequence, and the nucleotide sequence is shown as SEQ ID NO. 9.

sgMut-KKH1 nucleotide sequence and TOR1A ^ΔE The nucleotide sequences match perfectly.

The nucleotide sequence of SaCas9-KKH is shown as SEQ ID NO. 10.

The amino acid sequence of the SaCas9-KKH protein is shown as SEQ ID NO. 11.

The sgMut-VQR1 is 20 nucleotides before the PAM site of the SpCas9-VQR is identified, and the sequence of the sgMut-VQR has 3-nt mismatch compared with the wild type TOR1A nucleotide sequence, and the nucleotide sequence is shown as SEQ ID NO. 12.

sgMut-VQR1 nucleotide sequence and TOR1A ^ΔE The nucleotide sequences match perfectly.

sgMut-VQR2 is 20 nucleotides before the PAM site that recognizes SpCas9-VQR, and its sequence is perfectly matched with the wild-type TOR1A nucleotide sequence, but TOR1A ^ΔE Mutations introduce new PAM sites (NGA) that are slightly less efficient than classical PAM sites (NGG) to mediate Cas9 cleavage. The nucleotide sequence is shown as SEQ ID NO. 13.

sgMut-VQR2 nucleotide sequence and TOR1A ^ΔE The nucleotide sequences match perfectly.

The SpCas9-VQR nucleotide sequence is shown in SEQ ID NO. 14.

The amino acid sequence of the SpCas9-VQR protein is shown as SEQ ID NO. 15.

Example 1 use of CRISPR to develop allele-specific targeting TOR1A ^ΔE Policy analysis of (a)

Results of In silico analysis using the ascrisr website, candidate sgRNA sequences selected for allele-specific editing (table 3). Specifically, the Query sequence is entered in the AstISPR website (http:// www.genemed.tech/AsCRISPR):

TGATGAAGACATTGTAAGCAGAGTGGCTGAG[GAG/-]ATGACATTTTTCCCCAAAGAGGAGAGAGTTT

four major classes of Cas enzymes (Cas 9, cpf1, cas12b, casX) were selected, with each major class containing several subtypes or variants, for a total of 24 Cas enzymes, each recognizing a specific PAM site. The results of the website analysis resulted in sgRNAs that could specifically target WT and mutant TOR1A and the off-target condition (Table 3; FIG. 1).

TABLE 3 specific targeting of WT and mutant TOR1A sgRNAs and off-target conditions

The candidate sgrnas that can specifically target the mutant TOR1A are selected, and the length of the sgrnas designed for SpCas9 is known to be the best 21nt effect, the length of the sgrnas designed for SaCas9 is the best 22nt effect, but the length of the sgrnas designed for NmCas9 is not determined. Different lengths of sgrnas (18-24 nt) were therefore designed for NmCas9, respectively, to evaluate their highest efficiency of the sgRNA form (table 4).

TABLE 4 selection of candidate sgRNAs after In silico analysis

Example 2 experiments to verify cleavage efficiency and targeting specificity of sgrnas

pCAG-EGFxFP vector cleavage:

the pCAG-EGFxFP (Addgene 50716) vector was used as a backbone, and BamHI and EcoRI were used for double cleavage, the cleavage system (20. Mu.l) was as follows, and cleavage was carried out at 37℃for 3 hours, the cleavage system was as follows:

table 5 double enzyme digestion System

Adding	Addition amount of
		pCAG-EGFxFP (Addgene 50716) vector	3μg(xxxμl)
10×CutSmart Buffer	2μl
		BamHI-HF	0.5μl
EcoRI-HF	0.5μl
		ddH ₂ O	To 20 μl

The product obtained after cleavage was run on a 1% agarose gel (160 v,20 min), and the 1% agarose gel was prepared as follows: adding 1% agarose into 1×TAE buffer, heating in a microwave oven until completely dissolving, cooling, adding 1×gel-Red, shaking, pouring into a Gel box with comb, and naturally solidifying. And cutting out a gel block containing the long fragment vector, and recovering the gel block by using a SanPrep nucleic acid purification kit.

2. Acquisition of PCR fragments

The specific process is as follows:

first, PCR amplification of TOR1A was performed using the following primers ^WT/ΔE Genomic DNA (extracted from fibroblasts of heterozygous patients):

EGxxFP-F:cggGGATCCgaccggaacctcattgattat(SEQ ID NO.36)

EGxxFP-R:ccgGAATTCttggtgaacaccgttttgc(SEQ ID NO.37)

the PCR amplification system was as follows:

TABLE 6 PCR amplification System

Adding	Addition amount of
		TOR1A ^WT/ΔE Genomic DNA	100ng
EGxxFP-F(10μM)	1.25μl
		EGxxFP-R(10μM)	1.25μl
5×PrimeStar Buffer	10μl
		dNTP(2.5mM)	4μl
PrimeStar Enzyme	0.5μl
		ddH ₂ O	To 50 μl

The PCR amplification procedure was as follows, for a total of 35 cycles:

TABLE 7 PCR amplification procedure

Preheating at 94 DEG C	1min
		Denaturation at 98 DEG C	10s
Annealing at 56 DEG C	15s
		Extending at 72 DEG C	1min/1kb
72℃	10min

The PCR product obtained was run on a 1% agarose gel, then analyzed on an ultraviolet analyzer and excised to recover the correct size band (197 bp). Then, bamHI and EcoRI were used for double cleavage, and the cleavage system (20. Mu.l) was as follows, and cleavage was carried out at 37℃for 1 hour, and the cleavage system was as follows:

table 8 double enzyme digestion System

The product obtained after cleavage was recovered again using the kit SanPrep nucleic acid purification kit for ligation.

3. Connection

The pCAG-EGFxFP cleaved product and the post-PCR enzyme-digested recovered product were ligated for 3 hours at room temperature according to the following system:

TABLE 9 T4 ligase ligation system

Additives	Addition amount of
		Enzyme cutting gel recovery product after PCR	150ng
pCAG-EGFxFP cleaved product	50ng
		T4 ligase	0.5μl
10×T4 ligation buffer	10μl
		ddH ₂ O	To 20 μl

After that, the ligation product was transformed into competent Stbl3 E.coli as follows:

1. stbl3 competent cells (100. Mu.l) were removed at-80℃and thawed on ice;

2. adding a connection product into competent cells, and gently mixing;

3. placing on ice for 30 minutes, and simultaneously preheating an LB solid plate;

4. placing the mixture on ice immediately after heat shock for 45s at 42 ℃ in a water bath kettle for standing for 2 minutes;

5. uniformly coating the mixture of the competence and the connection product on an LB plate by using coating beads in an ultra-clean workbench;

6. the plates were incubated overnight at 37℃for 16-18 hours.

After overnight growth, the single clone grown on the LB plate was picked up into LB liquid medium (0.1 mg/ml ampicillin was added) and amplified on a shaker at 37℃for 16-18 hours. Then extracting plasmid and Sanger sequencing to verify, and obtaining TOR1A respectively ^WT/ΔE Vector of genomic DNA (FIGS. 2 and 3). Plasmid extraction was performed using the SanPrep nucleic acid purification kit.

Construction of the cas9/sgRNA vector:

the pXPR206-lenti-U6-gRNA-SaCas9-puro (Addgene 96920) vector is recovered for standby by double enzyme digestion of KpnI and EcoRI; the U6-Nm tracrRNA fragment (425 bp) was amplified by PCR using pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS (Addgene 115694) vector as a template, recovered by running 1% agarose gel, and recovered by re-gel after double digestion with KpnI and EcoRI. The PCR primer sequences are as follows: U6-Nm-F1-KpnI: CGGGGTACCgagggcctatttcccatgatt (SEQ ID NO. 38); U6-Nm-R1-EcoRI: CCGGAATTCgtcgacggatcgggagatc (SEQ ID NO. 39). The product after cleavage of pXPR206-lenti-U6-gRNA-SaCas9-puro (Addgene 96920) vector and the product recovered from enzyme digestion after pSimplineII-U6-sgRNA-BsmBI-NLS-NmCas 9-HA-NLS PCR were transformed into Stbl3 competent cells and plated on LB plates after 3 hours at room temperature, and after picking up monoclonal colonies for expansion culture, plasmids were extracted and verified by Sanger sequencing. This procedure gave the A2B2 pXPR206-lenti-U6-Nm gRNA scaffold-SaCas9-puro vector (hereafter A2B2 vector). The enzyme digestion system, the glue recovery, the connection transformation and the plasmid extraction are the same as the procedures before.

The A2B2 carrier is subjected to double enzyme digestion by using AgeI/BamHI, and then the gel is recovered for standby; the NmCas9-HA fragment (3382 bp) was amplified by PCR using pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS (Addgene 115694) vector as template, and recovered by running 1% agarose gel. The enzyme digestion system, the glue recovery, the connection transformation and the plasmid extraction are the same as the procedures before.

The PCR primer sequences are as follows: 0415-F: cgccagaacacaggaccggtgccaccatggtgcctaagaaga (SEQ ID NO. 40);

0415-R:aagttggtggccccggatccCTCGAGatccagcttctttttcttcgctg(SEQ ID NO.41)。

the A2B2 vector cleavage products and pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS (Addgene 115694) PCR cleavage products were ligated with Gibson assembly as follows:

table 10 Gibson connection System

Wherein 50-100ng of carrier and 3 times of fragments are uniformly mixed; the ligation system was reacted at 50℃for 30 minutes, followed by transformation, monoclonal selection, plasmid extraction and Sanger sequencing. Transformation, selection of monoclonal, plasmid extraction and Sanger sequencing were performed as described above. This step yielded pXPR206-lenti-U6-gRNA-NmCas9-puro (FIG. 4).

pXPR206-lenti-U6-gRNA-SaCas9-puro (Addgene 96920) vector was recovered for use with AgeI/BamHI double enzyme post-digestion glue; PCR (polymerase chain reaction) amplification of SaCas9-FLAG fragment (3308 bp) by using SaCas9-KKH MSP1830 (Addgene 70708) vector as a template, and recovery by running 1% agarose gel.

The PCR primer sequences are as follows: 0414-F: cgccagaacacaggaccggtcgccaccatggg (SEQ ID NO. 42);

0414-R：aagttggtggccccggatccCTCGAGcttgtcatcgtcatccttgtaatcgatgt(SEQ ID NO.43)。

pXPR206-lenti-U6-gRNA-SaCas9-puro (Addgene 96920) vector cleavage products and SaCas9-KKH MSP1830 (Addgene 70708) PCR cleavage products were ligated with Gibson assembly, the same as above. Transformation, monoclonal selection, plasmid extraction and Sanger sequencing were then performed. Transformation, selection of monoclonal, plasmid extraction and Sanger sequencing were performed as described above. This step yielded pXPR206-lenti-U6-gRNA-SaCas9-KKH-puro (FIG. 5).

The lentiCRISPR v2-Puro (Addgene 52961) vector is recovered for later use by using AgeI/BamHI double enzyme digestion; the FLAG-SpCas9-VQR fragment (4315 bp) is amplified by PCR with a p459SpCas9-VQR-Puro (Addgene 101715) vector as a template, and is recovered by running 1% agarose gel.

The PCR primer sequences are as follows: 0416-F: cgccagaacacaggaccggtgccaccatggac (SEQ ID NO. 44);

0416-R：AAGTTTGTTGCGCCGGATCCctttttcttttttgcctggccgg(SEQ ID NO.45)。

the lentiCRISPR v2-Puro (Addgene 52961) vector cleavage product and the p459SpCas9-VQR-Puro (Addgene 101715) PCR cleavage product were ligated with Gibson assembly, the same system as before. Transformation, monoclonal selection, plasmid extraction and Sanger sequencing were then performed. Transformation, selection of monoclonal, plasmid extraction and Sanger sequencing were performed as described above. This step resulted in a lentiCRISPR v2-SpCas9-VQR-Puro (fig. 6).

We will construct three CRISPR vectors previously: pXPR206-lenti-U6-gRNA-NmCas9-Puro (FIG. 4), pXPR206-lenti-U6-gRNA-SaCas9-KKH-Puro (FIG. 5) and lentiCRISPR v2-SpCas9-VQR-Puro (FIG. 6) were digested with FastDiget BsmBI, respectively, and the long fragment vector was recovered by gel. The enzyme digestion system is as follows:

table 11 CRISPR vector cleavage System

Adding	Addition amount of
		CRISPR vector	3μg
10×Fast Digest Buffer	3μl
		FastDigest BsmBI	1.5μl
FastAP	1.5μl
		DTT(100mM)	0.3μl
ddH ₂ O	Up to 30. Mu.l

And (3) enzyme cutting at 37 ℃ for 45 minutes, adding a DNA loading buffer solution after enzyme cutting, electrophoresis at 160V in 1% agarose gel for 20 minutes, analyzing and cutting a gel on an ultraviolet analyzer to recover carrier bands, and recovering three long fragment carriers by using a kit SanPrep nucleic acid purification kit for gel recovery.

Positive and negative DNA single strands were synthesized for the designed sgRNAs (Table 4) (Table 12).

TABLE 12 Single strand of forward and reverse DNA

Each pair of single strands was incubated at 37℃for 30 min, followed by denaturation at 95℃for 5 min, and then cooled to room temperature at a rate of 5℃per min to anneal to form double-stranded DNA (sgMut).

TABLE 13 annealing System

Adding	Addition amount of
		Forward DNA single strand (100. Mu.M)	1μl
Reverse DNA single strand (100. Mu.M)	1μl
		10×T4 ligation buffer	1μl
T4 PNK	0.5μl
		ddH ₂ O	To 10 μl

The obtained double-stranded DNA (diluted 200-fold) was ligated with the three long fragment vectors recovered by the enzyme digestion and gel electrophoresis, respectively, using T4 ligase at room temperature for 1 hour, and then transformed into E.coli Stbl 3. The corresponding relation is as follows:

the sgNC, sgMut-Nm18, sgMut-Nm19, sgMut-Nm20, sgMut-Nm21, sgMut-Nm22, sgMut-Nm23, and sgMut-Nm24 were connected to pXPR206-lenti-U6-gRNA-NmCas9-pur (FIG. 4) after cleavage to obtain 0425-0432 vectors (structures shown in FIG. 16, FIG. 17, FIG. 18, FIG. 19, FIG. 20, FIG. 21, FIG. 22, and FIG. 23), respectively; the sgNC and the sgMut-KKH are connected with pXPR206-lenti-U6-gRNA-SaCas9-KKH-puro (figure 5) after enzyme digestion to respectively obtain 0423-0424 vectors (the structures are shown in figure 14 and figure 15); the sgNC, sgMut-VQR1 and sgMut-VQR2 were ligated to the cleaved lentiCRISPR v2-SpCas9-VQR-Puro (FIG. 6) to obtain 0420-0422 vectors (structures shown in FIG. 11, FIG. 12 and FIG. 13).

Table 14 T4 ligase ligation system

Adding	Addition amount of
		Diluted double-stranded DNA	1μl
BsmBI digested CRISPR vector	50 ng
		T4 ligase	0.5μl
10×T4 ligation buffer	1μl
		ddH ₂ O	To 10 μl

The following day, single colonies were picked to LB liquid medium overnight for shaking, after which plasmids were extracted and verified using Sanger sequencing confirming insertion of sgrnas into CRISPR vectors. The transformation, gel recovery and plasmid extraction processes are the same as before.

3. Cell verification:

293T cells were cultured using DMEM complete medium and periodically passaged at a ratio of 1:10 for use. All Cas9/sgRNA vectors constructed previously (0420-0432 vectors) were combined with TOR1A ^WT/ΔE Vector combinations of genomic DNA (FIGS. 7A, B), respectively (i.e., all Cas9/sgRNA vectors were combined with TOR1A, respectively) ^WT And TOR1A ^ΔE Vector combinations of genomic DNA) were transfected into 293T cells using PEI. The transfection process is as follows: passaging 293T cells in advance at 2X 10 ⁵ Cells were seeded onto cell climbing plates of a 12-well plate. The next day, 0.25 μg of Cas9/sgRNA plasmid and 0.25 μg of pCAG-EGFxFP plasmid were mixed with OPTI-MEM, followed by addition of 3 volumes of PEI and mixing well, and left to stand at room temperature for 20 minutes. The mixture was slowly added to the broth, gently shaken, and the culture continued overnight in cell culture at 37 ℃. The next day, cells were washed once with PBS and replaced with fresh DMEM complete medium for continued culture. After 48 hours of transfection, the medium was aspirated, the cells were washed with PBS and replaced with fresh DMEM complete medium. GFP fluorescence was observed under a fluorescence microscope (Leica DMi 8) and counted.

Specifically, if the transferred Cas9/sgRNA can cleave DNA in the pCAG-egfxfp vector (WT and mutant TOR1A sequence), homologous recombination will occur between the overlapping elements on both sides of TOR1A in the pCAG-egfxfp vector, further allowing the GFxxFP components on both sides to form a complete GFP protein encoding green fluorescence. From the GFP production, it is known whether the DNA cleavage of Cas9/sgRNA takes place. The results show that SpCas9-VR/sgMut-VQR-2 and SaCas9-KKH/SaMut-KKH-1 can cleave both WT and mutant TOR1A sequences and generate GFP fluorescence with little specificity for the cleaved TOR1A mutant sequences; whereas NmCas9/sgMut-Nm21 and NmCas9/sgMut-Nm24 can specifically cleave only TOR1A mutant sequences, with little cleavage of WT, resulting in GFP fluorescence generation, results and statistical analysis as shown in FIGS. 7C, D. NmCas9/sgMut-Nm23 can specifically cleave the TOR1A mutant sequence, but will also cleave the WT in small amounts. The results demonstrate that both the identifying sgMut-Nm21/Cas9 and the sgMut-Nm24/NmCas9 are able to specifically target TOR1A mutant sequences.

Example 3 differential sgRNA/NmCas9 reduces perinuclear Ubiquitin aggregation in fibroblasts from DYT1 patients

To verify the potential functional significance of the identifying sgMut-Nm21/Cas9 and sgMut-Nm24/NmCas9 specific targeting TOR1A mutations, 0425, 0429 and 0432 vectors (FIG. 8A) were packaged separately as lentiviruses and transduced into fibroblasts of DYT1 patients (carrying TOR 1A) ^WT/ΔE Heterozygous variation). The effect of differential sgMut-Nm21/Cas9 and sgMut-Nm24/NmCas9 specific targeting TOR1A mutations on perinuclear Ubiquitin aggregation was observed by immunofluorescence staining.

The slow virus packaging method comprises the following steps: 6. Mu.g of the constructed 0425, 0429 and 0432 vectors, 4.5. Mu.g of the psPAX2 vector (packaging plasmid, as shown in FIG. 9) and 3. Mu.g of the PMD2.G (envelope plasmid, as shown in FIG. 10) vector were mixed and transfected with 3 volumes of PEI and cultured in 293T cells in 10-cm dishes. The transfection process is as follows: slowly adding the mixture of plasmid and PEI into the culture solution, shaking gently, placing in a 37 deg.C incubator for 12-16 hr, and replacing the culture solution to continue culturing. After overnight transfection, the cells were washed twice with PBS and the culture was continued by replacing fresh 10% DMEM complete medium. After 48 hours and 72 hours of transfection, the culture solution was collected into a centrifuge tube, and the cells and other fragments were removed by filtration through a 0.45 μm pore size filter, and the resulting virus solution was placed at 4℃for use.

Fibroblasts were routinely cultured using DMEM (15% FBS). In transduction experiments, fibroblasts from a 10-cm dish were transferred to (1:5) T-25 flasks. The next day, 30ml of virus solution and 6. Mu.g/ml polybrene were added overnight, respectively. The next day, the new complete medium is replaced. Three days later, cells were transferred to cell slide and grown overnight, after which cells were fixed with 4% PFA at room temperature for 20 minutes and stored in PBS for immunostaining experiments.

The immunostaining process is as follows: PBS was pipetted off and blocked for 30 min with blocking solution containing 3% BSA and 0.3% Triton-X-100. The blocking solution was removed and incubated overnight at 4℃with a respective anti-dilution (HA 1:100;Ubiquitin 1:100). The next day, wash with PBST 3 times for 10min each. The corresponding fluorescent secondary antibody Alexa fluor 488/555 (1:500; invitrogen) was added and incubated for 1 hour at room temperature in the absence of light. PBST was washed 3 times for 10min each. Finally, adding DAPI nucleus-staining solution for staining for 5 minutes, washing with PBS for 5 minutes, and sealing with a fade-proof fluorocount-G sealing tablet. The immunostaining was then observed under a fluorescence microscope (Leica DMi 8).

Immunofluorescent staining showed that the vector in which sgRNAs were located expressed HA (green fluorescent staining), confirming that the vector had been transferred into cells (fig. 8B). In DYT1 patient cells, perinuclear Ubiquitin (red fluorescent staining) had an aggregation in the sgNC group, whereas sgMut-Nm21 and sgMut-Nm24 significantly reduced this aggregation (FIGS. 8B, C). This result shows that the identified sgrnas/NmCas 9 has potential to treat the pathological features of DYT1 dystonia.

The foregoing examples are set forth in order to provide a more thorough description of the present invention, and are not intended to limit the scope of the invention, since modifications of the present invention, in which equivalents thereof will occur to persons skilled in the art upon reading the present invention, are intended to fall within the scope of the invention as defined by the appended claims.

Claims

1. An sgRNA targeting TOR1A protein, wherein the sgRNA is specific for TOR1A ^ΔE The allele sequences are bound, in turn by NmCas 9.

2. The TOR1A protein-targeted sgRNA of claim 1, wherein the nucleotide sequence of the sgRNA is set forth in SEQ ID No.1, SEQ ID No.2, or SEQ ID No. 16.

3. A recombinant plasmid or recombinant virus is characterized by comprising sgRNA shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO. 16.

4. Coli comprising sgRNA as set forth in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.16, or a recombinant plasmid, or a recombinant virus.

5. Use of a TOR1A protein-targeting sgRNA according to claim 1 or 2, a recombinant plasmid or recombinant virus according to claim 3, or e.coli according to claim 4 for the preparation of a medicament for the treatment of DYT1 dystonia.

6. The use according to claim 5, wherein the TOR1A protein-targeting sgRNA according to claim 1 or 2, the recombinant plasmid or recombinant virus according to claim 3, or the escherichia coli-specific and TOR1A according to claim 4 ^ΔE Allele sequence binding, in turn bound by NmCas9, results in TOR1A ^ΔE The mutant sequence is cleaved and the coding ability is lost.

7. A kit comprising NmCas9 and the TOR1A protein-targeting sgRNA of claim 1 or 2, the recombinant plasmid or recombinant virus of claim 3, or the escherichia coli of claim 4.

8. Use of the kit of claim 7 for the preparation of a reagent for the treatment of DYT1 dystonia.