The content of the invention
To solve the above problems, the invention provides for knocking out the sgRNA sequences of people's ALDH2 genes, ALDH2 genes lack
Lose construction method and its application of cell line.
In a first aspect, the invention provides a kind of sgRNA sequences for being used to knock out people's ALDH2 genes, the target of the sgRNA
DNA sequence dna is SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:At least one in sequence shown in 3.
Second aspect, the invention provides a kind of method for knocking out Human embryo kidney cell ALDH2 genes, to utilize
CRISPR/Cas systems are transformed ALDH2 genes in human liver cancer cell, are specifically comprised the following steps:
(1) artificial synthesized target DNA sequence as described in relation to the first aspect and its complementary strand;
(2) synthesized nucleic acid fragment is inserted into multiple cloning sites and conversion of the sgRNA Skeleton Tables up to plasmid vector, chosen
Monoclonal bacterial strain, sgRNA recombinant plasmids are extracted, sequencing identification, which obtains, is sequenced correct sgRNA recombinant plasmids;Wherein, sgRNA bones
Frame expression plasmid carrier also expresses Cas9 nucleases;
(3) by sgRNA Transfected Recombinant Plasmid human liver cancer cells, the Human embryo kidney cell for knocking out ALDH2 genes is produced.
Preferably, the step (2) specifically includes:By synthesized SEQ ID NO:1、SEQ ID NO:2 and SEQ ID
NO:The nucleic acid of sequence shown in 3 chooses Dan Ke to being inserted respectively into multiple cloning sites and conversion of the sgRNA Skeleton Tables up to plasmid vector
Grand bacterial strain, sgRNA recombinant plasmids are extracted, sequencing identification, which obtains, is sequenced correct sgRNA recombinant plasmids;Wherein, sgRNA Skeleton Tables
Cas9 nucleases are also expressed up to plasmid vector;
The step (3) specifically includes:By two kinds of sgRNA recombinant plasmid cotransfection human liver cancer cells obtained by step (2),
Produce the human liver cancer cell for knocking out ALDH2 genes.
The third aspect, the invention provides the construction method of two kinds of ALDH2 gene delection cell lines, respectively using slow disease
Malicious infection protocol, limiting dilution assay carry out passage screening to the human liver cancer cell of the knockout ALDH2 genes obtained by second aspect, obtain
The stable human liver cancer cell for knocking out ALDH2 genes.
Fourth aspect, the invention provides two kinds of ALDH2 gene delection cell lines, are using as described in the third aspect
Obtained by the construction method of ALDH2 gene delection cell lines.
5th aspect, the invention provides a kind of sgRNA sequences for being used to knock out people's ALDH2 genes as described in relation to the first aspect
It is listed in the application knocked out in ALDH2 genes.
6th aspect, one kind are used to carrying out that ALDH2 is gene site-directed to knock in kit in human genome, including following (1)-
Any of (3):
(1) the sgRNA sequences for being used to knock out people's ALDH2 genes as described in relation to the first aspect;
(2) the sgRNA recombinant plasmids as described in second aspect;
(3) the ALDH2 gene delection cell lines as described in fourth aspect.
The invention provides technical scheme have the advantages that:
Technical scheme provided by the invention, to ALDH2 gene knockouts, is realized in genome using CRISPR/Cas9 technologies
The horizontal silence to gene acts on, and it is not thorough or can not silence in the silence of mRNA or protein level to effectively improve siRNA
The shortcomings that gene expression.
Embodiment
As described below is the preferred embodiment of the present invention, it is noted that for those skilled in the art
For, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications are also considered as
Protection scope of the present invention.
Outer without special instruction in the embodiment of the present invention, agents useful for same and consumptive material are commercial goods.
Experimental design process figure shown in technical solution of the present invention combination Fig. 1, is realized by following examples:
(1) sgRNA is designed:
Respectively for the second, the 4th and the 5th extron (Exon2, Exon4, Exon5) the design sgRNA of ALDH2 genes
Sequence.
Design, three component safety pins of synthesis are specific to the sgRNA sequences of ALDH2 genes the second, the 4th and the 5th extron
Packet is shown in Table 1 with name:
The ALDH2sgRNA oligo sequences of table 1
(Tab.1 The sequences of ALDH2sgRNA oligo)
Respectively in the enzyme-added enzyme site in sgRNA both ends, CACC, antisense are added at 5 ' ends of the positive-sense strand of every sgRNA sequence
5 ' end addition AAAC of chain, so as to form the cohesive end complementary after Fast Digest Bbs I digestions with PX461 plasmids.
If 5 ' first base in end of positive-sense strand are not G, increase a G behind 5 ' end CACC, the corresponding end of antisense strand 3 ' is again
Increase a C.SgRNA after the completion of design serves Hai Jierui companies and carries out primer synthesis.
SEQ ID NO of the present invention:1、SEQ ID NO:2、SEQ ID NO:Sequence shown in 3 corresponds to SEQ in form 1 respectively
ID NO:4、SEQ ID NO:6、SEQ ID NO:8 draw horizontal line part, specifically, SEQ ID NO:1、SEQ ID NO:2、SEQ
ID NO:Sequence is respectively shown in 3CCAGTGGACGGATTGACGGT、CATAGGGCTTGCCATTGTCC、CTGAAGAAGTCTCCGTCAAT。
(2) structure of recombinant plasmid and identification, structure process mode are as shown in Figure 2
1. PX458 and Lenticrispr V2 are the sgRNA skeleton expression vectors containing U6 promoters, expression has
The Cas9n of Cas9D10A otch enzyme mutants, PX458 plasmids carry GFP green fluorescence protein genes and amicillin resistance,
Lenticrispr V2 plasmids carry amicillin resistance.With Fast Digest Bbs I to PX458 and Lenticrispr
V2 carries out digestion, and the carrier of linearisation is reclaimed after DNA gel electrophoresis.
2. phosphorylation and annealing are carried out to three groups of sgRNA oligo sequences in table 1 respectively with T4PNK;Use T4ligase
By linear linear PX458 and Lenticrispr V2 plasmid vectors respectively with three groups of sgRNA double-stranded sequences rooms after annealing
Temperature connection 1h.Connection product transformed competence colibacillus bacterium Trans 109, ice bath 30min, 42 DEG C of 45s, on ice 2min.Resist in ammonia benzyl
Screening and cloning on the LB flat boards of property.Picking positive colony shakes bacterium, send sequencing.Sequencing primer is the forward primer sequence of U6 promoters
Row, 5 '-GAGGGCCTATTTCCCATGATTCC-3 ' (SEQ ID NO:15).Correctly clone extracts recombinant plasmid for sequencing.
3. gained recombinant plasmid shares six groups, for recombinant plasmid obtained by PX458 plasmids be named as PX458-Exon2,
PX458-Exon4 and PX458-Exon5, the recombinant plasmid obtained by Lenticrispr V2 plasmids are named as Lenticrispr
V2-Exon2, Lenticrispr V2-Exon4 and Lenticrispr V2-Exon5.
(3) slow virus system virus liquid structure HepG2 stable cell lines
1. the generation of virus
293FT cell culture conditions:DMEM culture mediums (containing 10% hyclone), 5%CO2, 37 DEG C it is incubated.
293FT cells are inoculated with 10cm Tissue Culture Dish respectively, cell inoculation number is 2 × 106, according to core plasmid:
Packaging plasmid:Envelope plasmid=4:3:2 ratio is transfected, and sgRNA group core plasmids are respectively Lenticrispr V2-
Exon2, Lenticrispr V2-Exon4 and Lenticrispr V2-Exon5, with Lenticrispr v2 as a control group.
24h after transfection, 48h and 72h are received and virus liquid, and fluorecyte percentage is observed using inverted fluorescence microscope, it is determined that transfection
Efficiency.The virus liquid three times of collection is mixed, the virus liquid of collection concentrated using Milipore 100KD evaporating columns.Profit
Virus liquid titer determination is carried out with 293FT cells.
2. cell infection and the stable strain cell screenings of HepG2.
HepG2 cell culture conditions be DMEM culture mediums (containing 10% hyclone), 5%CO2,37 DEG C it is incubated.
Propose the aim cell strain to be infected well of the previous day kind in 6 orifice plates, cell infection is that cell collects rate and reaches 40-50%
It is advisable.Culture medium is sucked before infection, 120 μ l viral concentration liquid is diluted with 2ml fresh cultures, 3.5g polybrenes is added, in sense
48~96h observes efficiency of infection under inverted fluorescence microscope after dye.96h is mould using final concentration of 2 μ g/ml purine after infection
Element is screened, and screening time is 7 days.Maintained after puromycin screens with final concentration of 0.5 μ g/ml puromycin
HepG2 stable cell lines.
(4) monoclonal cell limiting dilution assay screening HepG2 knocks out cell line
1. cell transfecting:24h before transfection, HepG2 cells are seeded in 6 orifice plates with 5 × 105/ holes and cultivated, it is thin during transfection
Born of the same parents' degrees of fusion reaches 60%-70%.Using Viafect transfection reagents respectively by PX458-Exon2, PX458-Exon4 and
PX458-Exon5 transfects a hole HepG2 cells simultaneously, and the PX458 plasmids of equivalent are as negative control, 6 orifice plate plasmid transfection amounts
The ratio between generally 2ug/ holes, the pre- transfection reagent of plasmid are 1:2-2.5.Transfection efficiency is observed after 24h.Utilize inverted fluorescence microscope
Fluorecyte percentage is observed, to determine transfection efficiency.
2. monoclonal cell limiting dilution assay screens monoclonal cell:With trypsin digestion and cell and count, using having
Limit dilution method is diluted to 0.5 cell of 100ul culture mediums, is added to by every hole 100ul cell diluents in 96 orifice plates.After inoculation
Go out monoclonal cell with micro- sem observation cell growth condition and preliminary screening within 5 to 7 days, when cell covers with 96 orifice plate bottom, then
With trypsin digestion and cell and it is transferred in 24 orifice plates.When cell covers with 24 orifice plate bottom, a part of cell stays for passage
Kind, its genomic DNA of a part of cell extraction, it is sequenced after PCR is expanded, sequencing result is compared with protogene group, detection
Whether targeting knock out ALDH2 genes succeed.
Sequencing result, wild type is compared, HepG2 knocks out cell line there occurs the missing of one section of 4bp base, as shown in Figure 3.
(5) cell genomic dna is extracted
Constructed cell line is digested, uses GeneJETTMGenomic DNA Purification Kit are extracted
Genomic DNA.
1. cell is collected in centrifuge tube, often pipe 5X106Individual cell, slowly blown and beaten, 250g centrifugation 5min, abandoned with pipettor
Supernatant, add PBS that cell is resuspended, repeated centrifugation, has removed remaining medium in cell again.
2. cell is resuspended with 200ul PBS, often pipe adds 200ul lysates and 20ul Proteinase Ks, fully shaking, mixing
Uniformly.
3. 56 DEG C of shaking tables are incubated 10min, mixing is during which shaken per 3-4 minutes once, to ensure that cell cracking is abundant.
4. adding 20ul RNAase A, concussion mixes, and is incubated at room temperature 10min.
5. adding 400ul 50%ethanol, shaken with rifle and mix or shake mixing.
6. in the Column posts that above-mentioned MiX addition kits are provided, 6000g centrifugations, 1min, DNA is collected into post transfer
Into new 2ml collecting pipes.
7. adding 500ul wash buffer I, 8000g centrifugation 1min, waste liquid is abandoned.Add 500ul wash buffer
II, 12000g, centrifuge 3min.
8. it is central to post filter membrane is collected to add 200ul Elution Buffer, incubation at room temperature 2min, 8000g centrifugation,
1min, you can DNA sample needed for obtaining.
(6) PCR reaction conditions and SURVEYOR analysis detections
1. the ALDH2 gene mRNA sequences number provided according to NCBI design QRT-PCR primers;Designed by Primer 3.0
The SURVEYOR primers and PCR primer of ALDH2 genes, primer are synthesized by Shanghai JaRa biotech firm.
The SURVEYOR PCR of table 2 react primer sequence
Tab.2 PCR primer
Expanded 2. surpassing fidelity dna polymerase with Phusion and entering performing PCR, with reference to specification 50ul systems, genomic DNA
100ng, 50ul reaction system are as shown in the table.
Component |
Quantity (uL) |
H2O |
to 50 |
Phusion HF buffer,5X |
10 |
dNTPs,2.5mM |
4 |
Phusion polymerase |
0.5 |
Forward primer |
2.5 |
Reverse primer |
2.5 |
template DNA |
100ng |
Total |
50 |
Program is as follows:
Negate should after PCR primer 5ul enter row agarose gel electrophoresis detect its specificity.
SURVEYOR analytical procedures are as follows:
1) carry out PCR primer with QIAquick PCR purification Kit kits to purify, recovery product is diluted
To 40ng/ul, detection is carried out according to SURVEYOR assay kit specification steps
2) DNA heteroduplexs form (annealing reaction) system:
Component |
Quantity (μ l) |
Taq PCR buffer,10× |
2 |
Normalized PCR product,20ngμl-1 |
18 |
Total volume |
20 |
Reaction condition:
Cycle-index |
Condition |
1 |
95℃,10min |
2 |
95-85℃,-2℃s-1 |
3 |
85℃,1min |
4 |
85-75℃,-0.3℃s-1 |
5 |
75℃,1min |
6 |
75-65℃,-0.3℃s-1 |
7 |
65℃,1min |
8 |
65-55℃,-0.3℃s-1 |
9 |
55℃,1min |
10 |
55-45℃,-0.3℃s-1 |
11 |
45℃,1min |
12 |
45-35℃,-0.3℃s-1 |
13 |
35℃,1min |
14 |
35-25℃,-0.3℃s-1 |
15 |
25℃,1min |
16 |
25-4℃,-0.3℃s-1 |
17 |
4℃,hold |
3) SURVEYOR nuclease digestions (being operated on ice):
Reaction system:
Component |
Dosage (μ l) |
Final concentration |
Annealed heteroduplex |
20 |
|
MgCl2stock solution supplied with kit,0.15M |
2.5 |
15mM |
ddH2O |
0.5 |
|
SURVEYOR nuclease S |
1 |
1× |
SURVEYOR enhancer S |
1 |
1× |
Total |
25 |
|
Reaction condition:Fully shaking, mix above-mentioned mixture, 42 DEG C of 30min.
4) 10ul samples are taken, are analyzed with 2% Ago-Gel.Cutting efficiency, formula are calculated with quantitative gel software
For fcut=(b+c)/(a+b+c), wherein Indel are miss ratio, fcutFor cutting ratio
Rate, a are the gray value for not being cut band, and b and c represent the gray value of new band caused by cutting.
The 293FT cells of that group transfection of selection Indel (%) highest do the inoculation and screening of next step.
SURVEYOR nuclease digestions partial results as shown in figure 4, test result indicates that
1) limiting dilution assay HepG2 knocks out strain
PX458-Exon2, PX458-Exon4 and the PX458- built for the sgRNA of Exon2, Exon4, Exon5 design
Exon5 plasmid groups are effective, and SURVEYOR results are the positive.
2) slow-virus transfection method HepG2 knocks out strain
PX458-Exon2 the and PX458-Exon5 plasmids group built for the sgRNA of Exon2, Exon5 design is effective,
SURVEYOR results are the positive.
(7) the HepG2 cell lines DNA sequencing analysis of ALDH2 gene knockouts
1. extracting cell genomic dna, enter performing PCR using Phusion high-fidelity enzymes, and PCR primer is purified, make
Add A tails to above-mentioned PCR primer with Taq archaeal dna polymerases, reaction total system is 50 μ l, react specific needed for each component usage amount and
Reaction condition is as follows:
2. connect carrier T:Above-mentioned plus A tails PCR primer is attached with carrier T, while using carrier T kit certainly
The control setting negative control of band, each group component for reacting required are as follows:
Control group is as follows:
Often pipe adds Solution I (including the enzyme needed for coupled reaction) 5 μ l in above-mentioned reaction system, in 16 DEG C of connections
30min, entirely react and carried out in PCR instrument.
3. connection product transformed competence colibacillus bacterium Trans 109, ice bath 30min, 42 DEG C of 45s, on ice 2min.Resist in ammonia benzyl
Screening and cloning on the LB flat boards of property.Picking positive colony shakes bacterium, send Beijing six directions Huada gene company sequencing.
As a result as shown in figure 5, the deletion mutation that the stable strains of HepG2 cause in target position, realizes ALDH2 clpp genes
Remove.
(8) the HepG2 cell lines mRNA of ALDH2 gene knockouts and expressing quantity detection
1. using Trizol methods extraction cell total rna, reverse transcription, generation are carried out using TOYOBO companies Reverse Transcriptase kit
CDNA, the system provided according to TOYOBO companies SYBR mix reagent specifications carry out qRT-PCR.
As a result as shown in fig. 6, successfully build ALDH2 gene knockouts HepG2 cell lines mrna expression amount significantly lower than pair
According to group.
2. using M-PER cell pyrolysis liquids extraction HepG2ALDH2 Knockout cells strain total proteins, determined using BCA albumen
Amount kit is quantified, and carries out Western Blot.
As a result as shown in fig. 7, successfully build ALDH2 gene knockouts HepG2 cell lines expressing quantity significantly lower than pair
According to group.
Relative to traditional gene knockout method, not only flow is cumbersome, high to technical requirements, and somewhat expensive, success rate
It is relatively low.The CRISPR-Cas9 technologies that the present invention uses are forth generation gene editing methods, and its is easily operated, more efficient,
It is low-cost.The present invention is related for ALDH2 metabolism using the ALDH2 Knockout cells model of CRISPR-Cas9 technique constructions
Research provide active platform.Specifically have the beneficial effect that:
(1) silence to gene in genomic level is realized to ALDH2 gene knockouts using CRISPR/Cas9 technologies
Effect, effectively improve siRNA the silence of mRNA or protein level it is not thorough or can not cryptiogene expression the shortcomings that.
(2) ALDH2 participates in the important metabolic function of body, and what ALDH2 genes knocked out cell line is established as exogenous chemical
The metabolism research of thing or exogenous poisonous substance in vivo provides effective platform.
(3) strain of ALDH2 Knockout cells is for chronic disease (such as alcoholic Jiver disease and diabetes) and tumour phase
The research of related disorders provides powerful.
(4) ALDH2 Knockout cells strain can be used for that ALDH2 is metabolized related xenobiotic toxicity, carcinogenicity is ground
Study carefully and medicine between reciprocation research.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
All any modification, equivalent and improvement made within refreshing and principle etc., should be included in the scope of the protection.
Sequence table
<110>Zhongshan University
<120>Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ccagtggacg gattgacggt 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
catagggctt gccattgtcc 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ctgaagaagt ctccgtcaat 20
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
caccgccagt ggacggattg acggt 25
<210> 5
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
aaacaccgtc aatccgtcca ctggc 25
<210> 6
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
caccgcatag ggcttgccat tgtcc 25
<210> 7
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
aaacggacaa tggcaagccc tatgc 25
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
caccgctgaa gaagtctccg tcaat 25
<210> 9
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
aaacattgac ggagacttct tcagc 25
<210> 10
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
cctgtgcttt tcatttgtag gct 23
<210> 11
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
cagtttcgat tggttcctac agt 23
<210> 12
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
tcctcctccc tgcctttgga 20
<210> 13
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
gccttctctg actcctgtga tcc 23
<210> 14
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
acaagaaccc caggcgattc t 21
<210> 15
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
tgcgtgtcct cccctaactc ca 22
<210> 16
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
ttgtctgcaa ggcctgtgc 19
<210> 17
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
ttggttccta cagtctgtac aa 22
<210> 18
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
tttacaagaa ccccaggcga 20
<210> 19
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
gaattcacga gtggcagtgc 20
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
cttagcatgg tgtcacggac 20
<210> 21
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
tgggattgca ggcgtgag 18