CN111254164A - Method for rapidly establishing CRISPR gene editing liver cancer cell strain and cell strain - Google Patents

Abstract

The invention discloses a method for quickly establishing a gene editing liver cancer cell strain. The invention improves CRISPR/Cas9 technology, constructs a recombinant plasmid with better expression efficiency, and constructs a liver cancer cell strain with stably knocked-out genes by combining rapid monoclonal culture. The required sgRNA is accurately obtained through primer synthesis, and an insert is synthesized through two steps of PCR and loaded into a vector to construct a recombinant plasmid for knockout; packaging lentivirus, incubating with liver cancer cells, and introducing sgRNA and Cas9protein into the liver cancer cells simultaneously and equivalently through lentivirus mediation; puromycin (Puromycin) resistance screening is carried out on the liver cancer cells after gene editing, and meanwhile, monoclonality culture is carried out, and finally, stable liver cancer cell strains with positive gene knockout are quickly obtained. The method provides important experimental materials for researching the molecular mechanism of the gene in the tumorigenesis and development and provides reference for in vitro cell modeling of liver cancer diseases.

Description

Method for rapidly establishing CRISPR gene editing liver cancer cell strain and cell strain

Technical Field

The invention relates to the field of gene editing of targeted tumor cells in the field of biomedical research, in particular to a method for quickly obtaining a gene-edited liver cancer cell strain.

Background

Liver cancer is the highest cancer with mortality rate accounting for the second place in the world. In China, the morbidity and mortality of liver cancer are high, and the health and the life quality of the people are seriously harmed. Therefore, the research on the pathogenesis of liver cancer becomes one of the hot spots of the tumor biological research. Liver cancer is a genetically abnormal disease in which hundreds or thousands of mutations are formed in cancer cells, making it difficult to find oncogenes by DNA sequencing techniques. In addition, many liver cancer regulatory genes are difficult to find by sequencing because they do not mutate, but are otherwise deregulated in cancer. Determining the function of mutated genes in hepatoma cells, understanding their mechanism of mutational carcinogenesis and regulating important gene functions in the development of hepatoma are important challenges. Often, a cell model is required to be established to knock out a target gene, and the change of the deleted related gene is discussed in vitro, so that the function of the gene can be known.

The CRISPR/Cas is a unique adaptive immune system evolved in the long-term evolution process of bacteria and archaea in natural organisms. In this system, a restriction enzyme called Cas is capable of targeted degradation of foreign invaded DNA or RNA under the guidance of short-chain RNA, and this system is named CRISPR/Cas, i.e. Clustered regularly interspaced short palindromic repeats and their related genes (CRISPR Cas). This clustered regularly spaced short palindromic repeat was first discovered in 1987 on the E.coli chromosome, however the biological significance of its inclusion is not immediately understood. Subsequent studies have shown that CRISPR is ubiquitous in virtually most bacteria and archaea. Until 2005, the link between CRISPR and antiviral immunity was gradually recognized, and with the continuous discovery of scientists, the relevant action mechanism of CRISPR was really understood and applied to the field of gene editing until 2012. In 2013, CRISPR-Cas9 began to be widely used as a gene editing technology.

The existing CRISPR/Cas9 system experiment construction scheme: (1) protocol based on DNA vectors. After the vector enters a cell through transfection, the sgRNA is transcribed by the U6 promoter, the Cas9 gene can express the Cas9protein in the cell through a plurality of processes such as transcription and translation, and the two genes are combined in the cell to search and recognize a target sequence so as to achieve the effect of gene editing. (2) Experimental protocols based on sg RNA and mRNA Mix. After sgRNA design and artificial synthesis, the screening efficiency is improved by directly transfecting or injecting mRNA of Cas9, the artificially synthesized sgRNA and the mixture into cells to be edited. The principle is that some cells are difficult to introduce exogenous DNA fragments by a conventional transfection mode, and sufficient required gene editing elements can be directly introduced into the cells by the mode so as to achieve the purpose of gene editing. The scheme transfects DNA into cells, and avoids the possibility of gene recombination after the DNA enters the cells. Another important objective of this approach is to reduce the time for Cas9 to function, and thus reduce off-target generation, since this avoids the sustained expression of Cas9 in vivo. (3) Experimental protocol for sgRNA and Cas9protein complex. Cas9 endonuclease with verified activity is obtained, and after sg RNA and Cas9 endonuclease are mixed extracellularly, transfection or microinjection is carried out by adopting a special transfection method to enter cells for playing a role. Although the latter two methods have certain advantages, the operation technology, the test equipment and instrument conditions, and the test friendliness (operability) to most laboratories are all too high, and common laboratories are difficult to meet all requirements, so the first method is suitable for autonomous operation and implementation in most laboratories. However, in the first mode, because the sg RNA carried by the vector is limited, the gene editing efficiency of the current hepatoma cell line is still not ideal, and a new method is urgently needed to enable a large number of laboratories to efficiently and rapidly obtain the hepatoma cell line with gene editing. Therefore, the final aim of the invention is to establish a rapid and efficient method for gene editing liver cancer cell strains, and lay a foundation for establishing liver cancer in-vitro research models in extensive laboratories.

At present, the efficiency of obtaining a gene-editing positive cell strain from a liver cancer cell strain after sgRNA and Cas9 are introduced into a drug screen is not ideal, efficient cell monoclonality is a technical progress for overcoming the obstacle, and a solid foundation is laid for quickly establishing a gene-editing liver cancer cell strain subsequently.

Disclosure of Invention

The invention aims to provide a method for quickly editing liver cancer cell genes by using lentivirus-mediated sgRNA by taking liver cancer cells as target cells. The cell strain can be used as a cell model for researching a regulation mechanism of genes for the generation and development of liver cancer.

The invention improves CRISPR/Cas9 technology, constructs a recombinant plasmid with better expression efficiency, and constructs a liver cancer cell strain with stably knocked-out genes by combining rapid monoclonal culture. Due to the adoption of the optimized CRISPR/Cas9 technology, the method has the advantages of simplicity, convenience, high efficiency and easiness in operation in most laboratories during construction of the knockout plasmid.

The invention provides a method for rapidly establishing a CRISPR gene editing liver cancer cell strain, which comprises the following steps:

(1) design and selection of sgrnas: determining species (such as human or mouse) and a target gene sequence to be edited, downloading a genome sequence of a gene from NCBI and analyzing the structure to find a transcription initiation region, selecting a 250bp sequence at the target site as a sgRNA design sequence, designing the sgRNA sequence by a Zhang laboratory online design website http:// crispr. mit. edu/design, performing weighted screening on the position of the sgRNA in the genome and the off-target efficiency, and selecting candidate sgRNAs according to sgRNA online design software.

Aiming at different knockout fragment sites, a pair of sgRNAs is designed at two ends (upstream and downstream respectively) of a target fragment, and the interval between the two sgRNAs is about 250bp, so that the problem of chromosome variation after a genome fragment is excessively sheared is solved. Using Lentivirus V2 lentiviral vector as a framework, obtaining a to-be-inserted fragment by a two-round PCR amplification method, then using ESP3I restriction enzyme to enzyme-cut the inserted fragment and the vector, and performing T-shaped PCR₄And after DNA ligase ligation, constructing a recombinant knockout plasmid simultaneously carrying two sgRNAs for knocking out the upstream and downstream of the gene segment.

The following two specific steps of PCR amplification were performed:

to obtain the final insert containing two sgrnas, PCR was performed by dividing the final insert into three parts. The insert has the structure sgRNA1+ spacer + sgRNA 2. The first round of PCR yielded sgRNA1+ partial spacer and partial spacer + sgRNA2, respectively, as two products. Then, the two products were mixed in equal proportion and diluted 100 times as a template for the second round of PCR. Four PCR primers were designed for each insert. Of the four PCR primers, primer I and primer IV respectively carry one sgRNA (sgRNA1 or sgRNA 2).

As exemplified below, the sgRNA pattern is N (20). Primer II and primer III are universal primers, and the sequences are not changed when other inserts are synthesized for knocking out other genes. Fragment sgRNA1+ partial spacer was amplified from primer I (specific primer) and primer II (universal primer), and fragment partial spacer + sgRNA2 was amplified from primer IV (specific primer) and primer III (universal primer).

The specific amplification primer sequence with the sgRNA (sgRNA1 or sgRNA2) fragment is:

primer I 5′-CGTCTCGCACCGNNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtag-3′

primer IV 5′-CGTCTCcAAACANNNNNNNNNNNNNNNNNNNNCGGTGTTTCGTCCTTTCCAC-3′

wherein, N represents sgRNA sequence.

The other two universal primer sequences were:

primer II 5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTC-3′

primer III 5′-agtcggtgcTTTTTTGCCTATTTCCCatgattcc-3′

the synthesis process of the insert fragment by using Lentivirus V2 skeleton plasmid as a template:

the primers primer I and primer II are used in the first round of PCR, and the PCR product is obtained to be 115 bp;

using the primers primer III and primer IV, a PCR product of 293bp was obtained.

Finally, using the first round PCR product mixture diluted by 100 times as a template, and using specific primers I and IV to complete the final PCR in the second round PCR, a 386bp insert is obtained for the subsequent plasmid ligation.

The above method for obtaining the insert has the technical advantages of being very rapid, convenient and low in cost. The resulting insert was finally ligated into a vector as shown in FIG. 1.

(2) And (3) removing primers and impurities from the PCR product by using a PCR product recovery and purification kit, and carrying out electrophoresis detection.

(3) The empty lentivirus expression vector Lentvirus V2 is subjected to enzyme digestion by using ESP3I enzyme, and a linear vector is recovered from glue and used as a framework vector.

(4) By T₄DNA ligase the insert obtained in step (1) was ligated with the linear vector Lentvirus V2 recovered in step (3) at 25 ℃ for 2h to construct a recombinant plasmid.

(5) And (3) mixing the ligation reaction solution according to the proportion of 1: coli competent cells Stbl3 were transformed at a ratio of 10, and the transformed bacterial solution was spread on an ampicillin-resistant LB solid culture dish and cultured at 37 ℃ for 16 hours; picking a single bacterial colony with a larger diameter on the next day, carrying out shake culture for 5h by using a 1.5ml centrifugal tube, carrying out bacteria liquid PCR identification, carrying out amplification culture on positive bacteria by using a 15ml centrifugal tube, centrifugally collecting thalli, extracting recombinant plasmids, and carrying out secondary identification on enzyme digestion plasmids. For positive identification plasmids, a self-designed detection primer LV2-3 is adopted for sequencing verification, and the sgRNA sequence needs to be accurately found in a sequencing result. The sequence of the sequencing primer LV2-3 is as follows: 5'-CTCCTTTCAAGACCTAGCTAGC-3' are provided.

(6) 24-48h before cell transfection, 1-10X 10 cells are inoculated in a 100mm culture dish⁵Every ml of HEK293T cells, the next day when the cell confluence reaches 50-70% for transfection.

(7) Cell transfection experiments. Adopting a method for packaging lentivirus infection, and mixing virus packaging plasmids pVSVG and PSPA x2 with the positive recombinant plasmid obtained in the step (5) and the recombinant plasmid obtained in the step (1): 9: 10 (total mass 4-8. mu.g), adding into 500. mu.l Opti-MEM minimal medium or DMEM medium without double antibody and serum, and mixing according to the ratio of 1: 4 (plasmid mass: transfection reagent), uniformly mixing, and standing at room temperature for 30 min; meanwhile, removing old culture medium from HEK293T cells, gently cleaning with 5ml of 1 XPBS for 1 time, adding 2-3ml of DMEM culture medium without double antibody and serum, dropwise adding the above transfection reagent and plasmid incubation liquid into HEK293T cells, and culturing in a 37 ℃ incubator with 5% CO 2; and taking out the culture dish after 3-6h, supplementing 8-10ml of DMEM medium containing 1% double antibody and 10% serum, and putting the DMEM medium into an incubator for continuous culture.

(8) Culturing for 48-72h, collecting culture medium containing virus, and filtering the culture medium with 0.45 μm sterile filter membrane to obtain filtrate as virus solution. The virus solution can be used directly or after concentration, or stored at-80 deg.C for a long period.

(9) Inoculating hepatocarcinoma cells in a 60mm culture dish 24-48h before virus infection experiment, wherein the different inoculum sizes are 6-10 × 10 according to different cell growth speeds⁵The degree of cell confluence per ml the following day was about 50-70%.

(10) And (4) virus infection. And (3) taking out the liver cancer cell culture dish, removing the cell culture medium, replacing with 3ml of DMEM medium containing 1% double antibody and 10% serum, adding the virus liquid obtained in the step (8) into the target cell culture dish, adding 4ml of virus liquid into each dish, adding 6-10 mu l of polybrene (polybrene), and continuously culturing for 24 hours in a 5% CO2 incubator at 37 ℃.

(11) The following day the dishes were removed from the incubator, the virus-containing medium was removed, and the culture was continued with 10ml of DMEM medium containing 1% double antibody and 10% serum.

(12) After 24-48h of culture, the cells were seen to grow more densely under the microscope. Liver cancer cells were digested with trypsin 0.25% in a ratio of 1ml per 10cm dish, centrifuged and re-seeded in a new 100mm dish, and positive cell lines were pre-selected by adding puromycin in an appropriate amount depending on the type of target cells in 10ml of DMEM medium containing 1% diabody and 10% serum. The same DMEM medium containing an equal concentration of Puromycin was changed every three days. Screening was continued for 3-7 days.

(13) And (4) screening cell monoclonals. Cells (with extremely low density) which are pre-screened for 3-7 days are digested by pancreatin, then are re-diluted by the density of 1-2 cells per well and are evenly inoculated to a 96-well plate, and are cultured until cell monoclonals can be observed by microscopic examination.

(14) And (4) identifying positive cell strains. After digesting the cell monoclonals with pancreatin, the monoclonals are subjected to 24-well plate, 12-well plate and 6-well plate in sequence and are subjected to amplification culture. Selecting a part of cells to extract genome DNA, detecting whether the gene is successfully knocked out by using a detection primer through PCR (polymerase chain reaction), finding out a positive clone with successfully knocked out, and respectively adopting 1) sequencing a PCR fragment and carrying out first-generation sequencing to identify a knocked-out sequence, and 2) carrying out Western Blot detection to identify the knocking-out effect of the gene in the positive cell genome and the reduction of the expression level of a target protein, so as to prove that the construction of a liver cancer cell strain with the knocked-out gene is successful, and finally obtaining a cell line with successfully knocked-out. By adopting the method, the gene knockout efficiency can reach more than 90 percent, and the stability is good.

(15) Compared with the prior art, the method can efficiently obtain the gene knockout stable hepatoma cell line by the optimized CRISPR/Cas9 gene editing technology, the experimental target cell is suitable for quickly establishing all hepatoma cell lines and other tumor (such as breast cancer) knockout cell lines, and the culture condition of the target cancer cell can be correspondingly adjusted according to the specific hepatoma cell line.

Drawings

FIG. 1: and a pattern diagram of a recombinant plasmid containing two sgRNAs for gene knockout at the same time.

As shown, U6 is the human U6 promoter sequence. The sequence of the double arrow indicates in order: the U6 promoter, sgRNA1, U6 promoter, sgRNA2, sgRNA1, and sgRNA2 are two sgRNA sequences, respectively. Wherein sgRNA1 represents primer I, sequence N (20) in 5 '-CGTCTCGCACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAG-3'; sgRNA2 represents primer IV, sequence N (20) 5 '-CGTCTCCAAACANNNNNNNNNNNNNNNNNNNNCGGTGTTTCGTCCTTTCCAC-3'.

FIG. 2: LM3 cell line knock-out of the human CPQ gene was monocloned in an inverted microscope (40-fold magnification).

FIG. 3: PCR identification of LM3 stable cell line with human CPQ gene knocked out. Since the detection primer is designed to be positioned in the knockout missing part, no amplification product exists in the PCR, and no PCR product exists if the knockout is successful. The figure shows that two pairs of primers are adopted to carry out PCR detection by respectively taking the genomic DNA as a template. The number KO1-1CE is a knockout combination of sgRNA1 and sgRNA2, and the number KO2-1CE is a knockout combination of sgRNA3 and sgRNA 4. Primer pair 2F and 22R detect knock-out CPQ effects of sgRNA1 and sgRNA2 of KOCPQ; primer pairs TestKOCPQ1F and TestKOCPQ1R tested KOCPQ for knock-out effect on sgRNA3 and sgRNA 4.

Wherein, the sequences of the detection primer pair 2F and 22R are as follows:

2F：5′-ATCTTCGCATTTTTCGGTGGTG-3′

22R：5′-CTTCTGGAGGAGTCCCAATGC-3′

the sequences of the detection primer pair TestKOCPQ1F and TestKOCPQ1R are as follows:

TestKOCPQ1F：5′-ACAGATGACAGCTGAGAAGGC-3′

TestKOCPQ1R：5′-TGGCTTTTTCTAGGTTCTTGG-3′

FIG. 4: the LM3 stable cell line generation sequencing analysis result of knocking out human CPQ gene. A) LM3KO1-1 is used for sequencing and knocking out sgRNA1&2, and knocking out a 165bp fragment; B) LM3KO2-1 is a sequencing knockout sgRNA3&4, knocking out a 106bp fragment.

FIG. 5: and (3) detecting a LM3 stable cell line Western Blot of knocking out the human CPQ gene. From left to right are: lane 1 is the LM3 cell line transfected with a control plasmid (sgRNA sequence of human AAVS), lane 2 is the stable knock-out cell line KO1-1CE, lane 3 is the stable knock-out cell line KO2-1CE, and the Antibody is rabbitti-CPQ Antibody (purchased from ProteinTech).

FIG. 6: and (3) performing Western Blot detection on an LM3 stable cell line with a knocked-out human MTDH gene. From left to right are: lane 1 is Marker, lane 2 is LM3 cell line transfected with control plasmid (sgRNA sequence of human AAVS), lane 3 is MTDH, lane 4 is MTDH2, and antibody is rabbitti-MTDH antibody (purchased from ProteinTech).

Detailed Description

Example 1 construction of a CPQ gene-knocked-out LM3 hepatoma cell line by using an optimized CRISPR/Cas9 technology

(1) A Lentivirus V2 vector (Zhang Feng Lab, MIT) is used as a basic framework, a genome sequence of a human CPQ gene is downloaded from NCBI and analyzed for structure, a transcription initiation region is found, a pair of sgRNAs is designed and selected on line aiming at the region, and the sequences of the sgRNAs at the upper and lower reaches are respectively as follows:

sgRNA1 CTTATCTTCGCATTTTTCGG(TGG)

sgRNA2 CAGAAGTGCCAATCGCTCAT(AGG)

wherein three bases in parentheses are PAM domain (NGG)

Four primer sequences were designed:

KOCPQ primer I (sequence sgRNA1 underlined)

5′-CGTCTCGCACCGCTTATCTTCGCATTTTTCGGgttttagagctaGAAAtag-3′

KOCPQ primer II

5′-CAAAAAAGCACCGACTCGGTGCCACTTTTTC-3′

The first PCR was performed using primers primer I and primer II to obtain a PCR product of 115bp

KOCPQ primer III

5′-agtcggtgcTTTTTTGCCTATTTCCCatgattcc-3′

KOCPQ primer IV (reverse complement of sgRNA2 sequence underlined)

5′-CGTCTCcAAACAATGAGCGATTGGCACTTCTGCGGTGTTTCGTCCTTTCCAC-3′

The second PCR was performed using primers III and IV to obtain a PCR product of 293bp

The PCR amplification systems adopted for the first time and the second time are both 25 microliter reaction systems:

and (3) PCR reaction conditions:

94 ℃ for 5 min; (94 ℃,30 s; 71 ℃,30 s; 72 ℃,1 min). times.2 (Touch Down PCR from 71 ℃ to 63 ℃ lowering 2 ℃ per 2 cycles), (94 ℃,30 s; 61 ℃,30 s; 72 ℃,1 min). times.25; 72 ℃ for 10 min; hold 4 ℃.

Finally, using 100-fold diluted first round PCR mixture as template, the second round PCR using primer I and primer IV to complete the final amplification, and 2-fold above 25 microliter PCR reaction system (i.e. 50 microliter) to obtain a 386bp insert for subsequent plasmid ligation.

(2) The PCR product is recovered and purified after removing primers and impurities by using TaKaRa MiniBEST DNA Fragment Purification Kit of Takara biological company, and the quality of the PCR product is detected by electrophoresis.

(3) Carrying out enzyme digestion on the recovered PCR product by ESP3I, wherein the enzyme digestion reaction system is as follows:

mu.l of the digested mixture was added with 3. mu.g of the PCR product, 1. mu.l of 10U of ESP3I, and 3. mu.l of 10 XFastDigestbuffer (Thermo Co.), and ddH was added to the mixture₂And supplementing O, mixing uniformly, and putting into a water bath at 37 ℃ for incubation for 20 min.

(4) The cleaved product was electrophoresed on 1.0% (g/ml) 1 XTAE agarose gel, and the desired fragment was recovered by cutting the gel. The TaKaRa MiniBEST Agarose Gel DNA Extraction Kit was used, and the procedures were carried out according to the product instructions, and the Kit was dissolved in 30. mu.l of sterile water. Finally, the CPQ knockout insert with the length of 386bp is obtained.

(5) The linear lentiviral vector Lentivirus V2 was obtained by digestion with ESP 3I. Carrying out enzyme digestion on the backbone plasmid Lentivirus V2 by using ESP3I restriction endonuclease, and incubating for 0.5h in water bath at 37 ℃; the linear vector was then recovered by electrophoresis on a 1% agarose gel and excised.

(6) By T₄DNA ligase the lentivirus V2 linear vector and the digested insert obtained in step (4) above were ligated in a 10. mu.l system at 25 ℃ for 2 h.

(7) Stbl3 competent cells were transformed with the above ligation reaction mixture at a ratio of 1:10 by a 42 ℃ heat shock transformation method, and then cultured overnight on an LB solid culture plate containing 100. mu.g/ml Ampicillin, and then cultured overnight at 37 ℃ after spreading the strain solution.

(8) Picking a single colony with a larger diameter on the next day, performing shake culture for 5h by using a 1.5ml centrifugal tube, performing bacteria liquid PCR identification, performing amplification culture on a positive colony by using a 15ml centrifugal tube, centrifugally collecting thalli to extract recombinant plasmids, and determining the plasmid concentration by adopting NanoDrop 1000.

(9) The recombinant plasmid was secondarily identified by the ESP3I enzyme cleavage method. Finding the insert by electrophoresis pattern can prove the success of the recombinant plasmid construction. And (3) sequencing the plasmid with positive identification insert by adopting a self-designed detection primer LV2-3, wherein two sgRNA sequences need to be found in a sequencing result. The sequence of the primer LV2-3 is as follows: 5'-CTCCTTTCAAGACCTAGCTAGC-3' are provided.

(10) Obtaining positive plasmid.

Establishment of a stable cell line LM3 liver cancer with the CPQ gene knocked out:

(1) the above recombinant plasmid was extracted and the plasmid concentration was determined by NanoDrop1000, followed by electrophoresis to check the integrity of the plasmid.

(2) 24h before cell transfection, the cells were seeded in 100mm culture dishes at a cell density of 5X 10⁵Every ml of HEK293T cells, the next day when the cell confluence reached 60% was used for transfection.

(3) Cell transfection experiments. The positive recombinant plasmid obtained in example one was transfected with the viral packaging plasmids pvvg and PSPA x2 according to a 10: 1: 9 (total mass 8. mu.g), adding into 500. mu.l Opti-MEM minimal medium, adding 32. mu.l transfection reagent, mixing, standing at room temperature for 30 min; meanwhile, the HEK293T cells were removed from the culture medium in the culture system and gently washed 1 time with 5ml of 1 × PBS; adding 2ml of DMEM medium without double antibody and serum, adding the above transfection reagent and plasmid incubation solution dropwise into HEK293 cells inoculated in a 100mm culture dish, and adding 5% CO at 37 deg.C₂Continuously culturing in the incubator; and 3h later, taking out the culture dish, supplementing 8ml of DMEM medium containing 1% double antibody and 10% serum, and putting the DMEM medium into an incubator for continuous culture.

(4) After 48h of culture, the cell culture medium supernatant containing the virus was collected and filtered using a 0.45 μm sterile filter to obtain virus solution for subsequent infection.

(5) 24h before the virus infection experiment, LM3 cells were inoculated in a 60mm culture dish, and the inoculation amount was 7X 10⁵The next day cell confluence reached 60% per ml of LM 3.

(6) And (4) virus infection. LM3 cell culture dish was removed, the cell culture medium was removed, 3ml of DMEM medium containing 1% diabody and 10% serum was added, the virus solution obtained in step (4) was added to the LM3 cell culture dish, 4ml of each dish was added, 6. mu.l of Polybrene (Polybrene) was added, and 5% CO was added at 37 ℃₂The incubator continues to culture for 24 h.

(7) The following day the dishes were removed from the incubator, virus-containing medium was removed, fresh DMEM medium containing 1% diabody and 10% serum was added, and incubation continued in the cell incubator for 48 h.

(8) After 48h, the cells were seen to grow more densely under the microscope. LM3 cells were digested with trypsin 0.25% 1ml per 10cm dish, centrifuged and re-plated in 100mm dishes, and positive cell selection was performed by adding Puromycin (Puromycin) to a final concentration of 2. mu.g/ml in 10ml of DMEM medium containing 1% diabody and 10% serum. DMEM fresh medium containing 2. mu.g/ml Puromycin was replaced every three days. Screening was continued for 5 days.

(9) And (4) screening cell monoclonals. Cells (with very low density) which are pre-screened for 5 days are digested by pancreatin, then are re-diluted with the density of 1.5 cells per well and are evenly inoculated to a 96-well plate, and are cultured until cell monoclonals can be observed by microscopic examination.

(10) And (4) identifying a positive cell line. Digesting the obtained monoclonal, sequentially transferring the digested monoclonal into a 24-pore plate, a 12-pore plate, a 6-pore plate and a 100mm culture dish, sequentially performing amplification culture, taking out part of positive cells of which the CPQ is knocked out by LM3, extracting genomic DNA, and respectively adopting 1) PCR identification, 2) one-generation sequencing identification and 3) Western Blot to identify the knocking-out effect of the CPQ gene in the positive cell genome and the reduction of the expression quantity of the CPQ protein, thereby proving that the construction of the CPQ knocked-out LM3 cell line is successful.

The Western Blot identification process comprises the following steps: total protein of the stable knockout cell strain is extracted after RIPA is cracked, protein quantification is carried out by using a BCA method, and then Western Blot is carried out to detect the expression quantity of the CPQ protein (see figure 5). The specific operation method comprises the following steps: the method comprises the following steps of (1) passaging LM3 cells knocked out by CPQ to a 100mm culture dish, sucking out a culture medium after the cells grow fully, adding 5ml of precooled 1 XPBS (phosphate buffer solution) for cleaning for 1 time, removing a supernatant, adding 350 mu l of precooled RIPA cell lysate (ThermoFisher) to the culture dish, placing the culture dish on ice to lyse the cells for 1 hour, and shaking and mixing the cells uniformly for a plurality of times at intervals during the lysis period; then, cells were scraped off rapidly using a pre-cooled cell spatula and transferred to a 1.5ml centrifuge tube; centrifuge at 12000rpm for 15min at 4 ℃, carefully aspirate the supernatant and transfer to a new 1.5ml centrifuge tube. Protein concentration was determined by BCA method (ThermoFisher) with reference to product instructions. Sucking 20 μ g of protein extract, adding 4 xSDS PAGE Loading Buffer with final volume of 1/3, denaturing at 97 deg.C for 10min, performing 10% SDS-polyacrylamide gel electrophoresis at constant voltage of 80V; then, the protein is electrically transferred to a PVDF membrane, and the constant current is 250 mA; after membrane transfer, the PVDF membrane was blocked with 5% by mass/volume skim milk (prepared with TBST solution) for 1h, then washed with 1 XTSST solution for 3 times, 10min each time, added with rabbitanti-CPQ antibody, and incubated overnight at 4 ℃. Recovering primary antibody in the morning, washing the membrane with 1 × TBST for 3 times (10 min each time), adding rabbit secondary antibody, incubating at room temperature for 1h, and washing the membrane with 1 × TBST for 3 times (10 min each time). Imaging analysis was performed after addition of ECL chemiluminescent reagent. As shown in FIG. 5, the main band of CPQ protein can be seen in the control group, and the protein disappears at the position of the main band in the CPQ knockout group, indicating that the construction of the LM3 cell line of the CPQ knockout is successful.

(11) And (4) after the stable LM3 cell line which is successfully knocked out of the CPQ and is obtained in the step (10) is subjected to amplification culture, placing the stable LM3 cell line in liquid nitrogen for long-term storage for later use.

Example 2 establishment of a cell line stably knocking out MTDH gene LM3, the specific implementation steps are as follows:

(1) MTDH gene knock-out plasmids were constructed. The two pairs of sgRNA sequences are:

a first pair:

MTDH primer I 5′-CGTCTCGCACCGGAAATGCTCTCGGTCGGCCTGTTTTAGAGCTAGAAATAG-3′；

MTDH primer IV

5′-CGTCTCCAAACAGCGCCCGCAAAAAGCGGAGGCGGTGTTTCGTCCTTTCCAC-3′。

the second pair:

MTDH 2primer I

5′-CGTCTCGCACCGAAATGGGCGGACTGTTGAAGGTTTTAGAGCTAGAAATAG-3′；

MTDH 2primer IV

5′-CGTCTCCAAACATAGTGGATGGGTGGTAAAAGCGGTGTTTCGTCCTTTCCAC-3′。

after extracting the recombinant plasmid of the knocked-out MTDH gene obtained by the invention and determining the plasmid concentration by using NanoDrop1000, the integrity of the plasmid is detected by electrophoresis.

(2) 24h before cell transfection, the cells were seeded in 100mm culture dishes at a cell density of 8X 10⁵Every ml of HEK293T cells, the next day when the cell confluence reached 50% was used for transfection.

(3) Cell transfection experiments. The positive recombinant plasmid obtained in example one was transfected with the viral packaging plasmids pvvg and PSPA x2 according to a 10: 1: 9The mass ratio of (8 ug of total mass) is added into 500 ul of Opti-MEM minimal medium, 32 ul of transfection reagent is added, then the mixture is mixed evenly and kept stand for 30min at room temperature; meanwhile, the HEK293T cells were removed from the culture medium in the culture system and gently washed 1 time with 5ml of 1 × PBS; adding 2ml of DMEM medium without double antibody and serum, adding the above transfection reagent and plasmid incubation solution dropwise into HEK293 cells inoculated in a 100mm culture dish, and adding 5% CO at 37 deg.C₂Continuously culturing in the incubator; and 3h later, taking out the culture dish, supplementing 8ml of DMEM medium containing 1% double antibody and 10% serum, and putting the DMEM medium into an incubator for continuous culture.

(4) After 48h of culture, the cell culture medium supernatant containing the virus was collected and filtered using a 0.45 μm sterile filter to obtain virus solution for subsequent infection.

(5) 24h before the virus infection experiment, LM3 cells were inoculated in a 60mm culture dish, and the inoculation amount was 7X 10⁵The next day cell confluence reached 60% per ml of LM 3.

(6) And (4) virus infection. LM3 cell culture dish was removed, the cell culture medium was removed, 3ml of DMEM medium containing 1% diabody and 10% serum was added, the virus solution obtained in step (4) was added to the LM3 cell culture dish, 4ml of each dish was added, 6. mu.l of Polybrene (Polybrene) was added, and 5% CO was added at 37 ℃₂The incubator continues to culture for 24 h.

(7) The following day the dishes were removed from the incubator, virus-containing medium was removed, fresh DMEM medium containing 1% diabody and 10% serum was added, and incubation continued in the cell incubator for 48 h.

(8) After 48h, the cells were seen to grow more densely under the microscope. LM3 cells were digested with trypsin 0.25% 1ml per 10cm dish, centrifuged and re-plated in 100mm dishes, and positive cell selection was performed by adding Puromycin (Puromycin) to a final concentration of 2. mu.g/ml in 10ml of DMEM medium containing 1% diabody and 10% serum. DMEM fresh medium containing 2. mu.g/ml Puromycin was replaced every three days and the selection was continued for 7 days.

(9) And (4) screening cell monoclonals. Cells (with very low density) which are pre-screened for 7 days are digested by pancreatin, then are re-diluted with the density of 1 cell per well and are evenly inoculated to a 96-well plate, and the cells are cultured until cell monoclonals can be observed by microscopic examination.

(10) And (5) identifying positive cell strains. Digesting the obtained monoclonal, sequentially transferring the digested monoclonal into a 24-pore plate, a 12-pore plate, a 6-pore plate and a 100mm culture dish, sequentially carrying out amplification culture, taking out part of MTDH-knocked positive cells of LM3, and respectively adopting 1) genomic DNA extraction and PCR identification, 2) first-generation sequencing identification and 3) Western Blot to identify the knocking-out effect of MTDH genes and the reduction of MTDH protein expression quantity in positive cell genomes, thereby proving that the construction of MTDH-knocked-out LM3 cell lines is successful.

The Western Blot identification process comprises the following steps: extracting total protein of the stable knockout cell strain after RIPA lysis, carrying out protein quantification by adopting a BCA method, and then carrying out Western Blot to detect the expression quantity of MTDH protein. The specific operation method comprises the following steps: passaging the MTDH knock-out LM3 cells to a 100mm culture dish, sucking out the culture medium after the cells grow fully, adding 5ml of precooled 1 XPBS for cleaning for 1 time, removing the supernatant, adding 350 mu l of precooled RIPA cell lysate (ThermoFisher) to the culture dish, placing the culture dish on ice to lyse the cells for 1 hour, and shaking and mixing the cells uniformly for a plurality of times at intervals during the lysis period; then, cells were scraped off rapidly using a pre-cooled cell spatula and transferred to a 1.5ml centrifuge tube; centrifuge at 12000rpm for 15min at 4 ℃, carefully aspirate the supernatant and transfer to a new 1.5ml centrifuge tube. Protein concentration was determined by BCA method (ThermoFisher) with reference to product instructions. Sucking 20 μ g of protein extract, adding 4 xSDS PAGE Loading Buffer with final volume of 1/3, denaturing at 97 deg.C for 10min, performing 10% SDS-polyacrylamide gel electrophoresis at constant voltage of 80V; then, the protein is electrically transferred to a PVDF membrane, and the constant current is 250 mA; after membrane transfer, the PVDF membrane was blocked with 5% by mass/volume skim milk (prepared with TBST solution) for 1h, then washed with 1 XTSST solution for 3 times, 10min each time, added with rabbitanti-MTDH antibody, and incubated overnight at 4 ℃. Recovering primary antibody in the morning, washing the membrane with 1 × TBST for 3 times (10 min each time), adding rabbit secondary antibody, incubating at room temperature for 1h, and washing the membrane with 1 × TBST for 3 times (10 min each time). Imaging analysis was performed after addition of ECL chemiluminescent reagent. As shown in FIG. 6, the major band of MTDH protein was observed in the control group, while the protein disappeared at the major band position in the MTDH knock-out group, indicating that the construction of MTDH-knock-out LM3 cell line was successful.

(11) And (4) carrying out amplification culture on the stable cell strain LM3 successfully knocking out the MTDH obtained in the step (10), and then placing the stable cell strain in liquid nitrogen for long-term storage for later use.

Claims (3)

1. A method for rapidly establishing a CRISPR gene editing liver cancer cell strain is characterized by comprising the following steps: the method takes liver cancer cells as target cells, realizes the purpose of editing liver cancer cell genes by using lentivirus-mediated sgRNA, and comprises the following steps:

1) design and selection of sgrnas: determining species (such as human or mouse) and a target gene sequence to be edited, analyzing the structure of the gene sequence, taking the gene sequence from the first exon to the third exon at the gene initiation codon as a target site, selecting a 200-and-250 bp sequence at the target site as a sgRNA design sequence, or selecting a candidate sgRNA according to sgRNA online design software;

2) preparation of sgRNA and construction of recombinant lentiviral plasmid: sequentially connecting 1 or more than 2 sgRNA sequences of a target gene in a direction from 5 'to 3', and cloning the sgRNA sequences as an insert into a LentiCRISPR V2 vector cut by BmsbI enzyme to obtain a recombinant knockout plasmid containing a plurality of sgRNAs;

3) sequencing and identifying the positive recombinant plasmid: transforming the obtained recombinant plasmid into a competent Stbl3 strain, culturing overnight, selecting a single colony, and shaking an ampicillin-resistant LB culture medium for 12-16 hours; extracting plasmid, carrying out enzyme digestion identification by BmbI (or isozyme ESP3I enzyme), cutting a fragment smaller than 2000bp to indicate the insertion of a target fragment, and then carrying out primer pair treatment on the plasmid: lenti V25: CTTGGGTAGTTTGCAGTTTTA and Lenti V23: CTCCTTTCAAGACCTAGCTAG performing PCR amplification, and performing amplification again to obtain a band less than 2000bp (due to different numbers of inserted sgRNAs, the sizes of PCR product fragments are different), wherein the PCR product sample can be sequenced to confirm the sequence of the sgRNAs (the sequencing primer suggests to use Lenti V23), and the target sgRNAs must be found in the sequencing sequence; the recombinant plasmid with correct sequencing can be used for subsequent virus packaging;

4) and (3) packaging the virus: packaging plasmid PVSVG: PSPAX 2: recombinant plasmid ═ 1: 9: 10, packaging lentivirus in a mass ratio; collecting the supernatant of the virus culture system within 48-72 hours;

5) transfection of target cells: paving target cells according to needs 24-48 hours in advance, adding virus-containing culture solution collected for 48-72 hours into the cultured target cells by filtering through a 0.45 micron filter, adding 8-10 microliter polybrene (polybrene) into a culture dish according to the proportion of 10ml of culture medium, continuously culturing for 24-48 hours, re-inoculating the cells into a new culture dish after trypsinizing the cells, and adding 2-6 micrograms of puromycin per milliliter according to the types of the target cells to pre-screen positive cell strains for 3-7 days;

6) monoclonality culture of cells: cells which are pre-screened for 3-7 days are digested by pancreatin, are re-diluted according to the density of 1-2 cells per well and are evenly inoculated to a 96-well plate, and are cultured until cell monoclonals can be observed by microscopic examination.

2. The method of claim 1, wherein:

identification of positive hepatoma cell strains with successful gene knockout: pre-screening cells after 3-7 days by using a 96-pore plate puromycin drug screen to obtain cell monoclone; digesting the cell monoclone with pancreatin, sequentially passing through a 24-pore plate, a 12-pore plate and a 6-pore plate, and carrying out amplification culture; selecting a part of cells to extract genome DNA, detecting whether the gene is successfully knocked out by using a detection primer through PCR (polymerase chain reaction), finding out a positive clone with successfully knocked out, and respectively adopting 1) sequencing a PCR fragment and first-generation sequencing to identify a knocked-out sequence, and 2) WesternBlot to identify the knocking-out effect of the gene in the positive cell genome and the reduction of the expression level of a target protein, so as to prove that a liver cancer cell strain with successfully knocked out is successfully constructed, and finally obtaining a cell strain with successfully knocked out.

3. A liver cancer cell strain with high gene knockout efficiency obtained by the construction method of claim 1 or 2.

Images