CN113969284B

CN113969284B - Site for stably expressing protein in CHO cell gene NW _003614889.1 and application thereof

Info

Publication number: CN113969284B
Application number: CN202111395511.4A
Authority: CN
Inventors: 陈蕴; 金坚; 瞿丽丽; 丁学峰; 李华钟; 蔡燕飞; 朱景宇; 杨兆琪; 鲁晨; 戴云峰
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-11-23
Filing date: 2021-11-23
Publication date: 2022-07-12
Anticipated expiration: 2041-11-23
Also published as: WO2023093007A1; CN113969284A

Abstract

The invention discloses a site for stably expressing protein in a CHO cell gene NW _003614889.1 and application thereof, wherein the stable expression site obtained by the invention is positioned at the base in the range of 100bp upstream and downstream of the 103431 th base of the CHO cell gene NW _003614889.1, namely, at the 103331 st and 103531 th bases, and can integrate a foreign protein gene and stably express the foreign protein gene. The target gene is integrated into the stable expression region in a fixed-point integration mode, so that the problem of uncertain integration sites caused by random integration is solved; the invention overcomes the expression instability caused by position effect and the repeated and tedious screening process of cell strains by integrating the exogenous gene at the position of 103331-103531 upstream and downstream of the 103431 base of the stable expression site NW-003614889.1 in a CHO genome at a fixed point.

Description

Site for stably expressing protein in CHO cell gene NW _003614889.1 and application thereof

Technical Field

The invention relates to a site for stably expressing protein in a CHO cell gene NW _003614889.1 and application thereof, belonging to the technical field of genes.

Background

Chinese Hamster Ovary (CHO) cells, established in the laboratory of dr. theodore t. puck in 1957, are immortalized, non-secretory cells, secreting little endogenous protein; meanwhile, the protein has the advantages of closer posttranslational modification to human natural protein, difficult infection by human viruses, large-scale culture in serum-free culture medium with definite chemical components and the like, is widely applied to the field of biological pharmacy, and produces more than 70 percent of protein medicines. However, CHO cells have long culture period and high culture cost as mammalian cells, and meanwhile, the demand for recombinant products such as monoclonal antibodies is increasing, and the continuously increasing demand means that the specific productivity needs to be optimized. Although the expression quantity can be improved by increasing the copy number of genes, developing a new strong promoter, searching a proper enhancer and the like, the expression level of most CHO cells in the long-term culture process is unstable, and the problems of product approval and product marketing of a supervision department are directly influenced. Therefore, the construction of stable and high expression CHO expression strain is very important for the research and development of protein drugs and the marketing.

There are two strategies for constructing stable and highly expressed cell lines. One is the traditional method of combining random integration with high-throughput screening, and the other is the method of combining gene editing technology with homologous directed repair to integrate the target gene into a predetermined chromosomal locus in a fixed-point manner. However, due to uncertainty of integration sites and existence of position effects, the constructed cell genotypes have great difference in random integration, and the problem of unstable expression is easily caused in the long-term passage process, so that the later screening process is very long, and the whole process of generating the recombinant cell line by a random integration mode in an industrial environment usually needs 6-12 months; compared with random integration, the site-directed integration utilizes a gene editing technology, particularly a genome site-directed editing technology widely applied in recent years and mediated by CRISPR/Cas9, greatly reduces the development time and cost, and because the sequence is known, the information after the site-directed integration is clearer and more definite than the information after the random integration.

Random integration is the most mature traditional method for constructing a protein expression system, but multiple screening is needed to obtain a stable high-expression cell strain in a random integration mode, so that the time consumption is long, and the cost is high. Meanwhile, for the cell line obtained by random integration, the loss of expression stability of the cells in the later period of culture cannot be predicted at all: such instability may not occur at all; it is also possible that the cells develop after an infinite number of divisions; it is also possible that after the cell has divided for only a few passages, significant instability occurs. The stability problem not only affects the time of the product on the market, but also conflicts with the drug regulation management. In addition, the information of random integration sites is unclear, and the site effect of exogenous gene integration can also cause the expression level of the target gene to be remarkably reduced. According to the existing literature reports, the instability of the recombinant CHO cell line appears in all recombinant CHO cell lines, and the problem of unstable expression becomes an extremely common problem.

Disclosure of Invention

In order to solve the technical problems, the invention provides a site for stably expressing protein in a CHO cell genome, the site has clear information, the site can realize the site-specific integration of protein genes, can stably express the protein, can greatly shorten the screening process and time in the cell construction process, and reduces the research and development cost.

The first objective of the invention is to provide a site for stably expressing a protein in the CHO cell genome, wherein the site for stably expressing the protein is located within 103331-103531 th bases of a CHO cell gene NW _ 003614889.1.

Further, the nucleotide sequence of 103331-103531 bases of the CHO cell gene NW _003614889.1 is shown as SEQ ID NO. 1.

Further, when the CRISPR/Cas9 technology is used for site-directed transfer of a coding gene of a target protein, the site for stably expressing the protein can be recognized by a 5'NNNNNNNNNNNNNNNNNNNNNGG 3' sequence of the CRISPR/Cas9 technology.

Further, in the embodiment of the present invention, the 5'NNNNNNNNNNNNNNNNNNNNNGG 3' sequence is selected from the following 9 groups of sequences: 5'-ATCTTACTTTGCAACTACCAAGG-3', 5'-CACTTTATCTAACACTGGCCAGG-3', 5'-AGCAACACTTTATCTAACACTGG-3', 5'-GCACTCTGTGTGGAGCAAAGAGG-3', 5'-GCAAATGAGTAAAGTTCTCCTGG-3', 5'-TGCAGTGATAGCACTCTGTGTGG-3', 5'-AACAGGATGAAAATGTATGGAGG-3', 5'-TTCATCCTGTTCTCTGTTCTGGG-3', 5'-TTTCATCCTGTTCTCTGTTCTGG-3'.

In the present invention, the above-mentioned 9 sequences cover most of the sequences at the upstream, middle and downstream within 200 bases of the present invention within 103331-103531 bases of the CHO cell gene NW-003614889.1, indicating that 200 bases of the present invention can be used as sites for stably expressing proteins.

The present invention is not limited to the above 9 sequences, but the above 9 sequences are only preferred technical means for introducing the gene encoding the target protein into the stable expression site, and the purpose of stably expressing the protein of the present invention can be achieved by using other sequences, even other means for introducing the target gene.

Further, the protein is a protein with a molecular weight of less than 160 KDa.

Further, the protein is one of polypeptide, functional protein, antibody and fusion protein.

The second purpose of the invention is to provide the application of the site for stably expressing the protein in the CHO cell genome in the stable expression of the foreign protein in the CHO cell.

Furthermore, the application specifically comprises constructing a foreign protein or polypeptide encoding gene at a site where the protein is stably expressed in the CHO cell gene NW _ 003614889.1.

The third purpose of the invention is to provide an expression vector for expressing protein in CHO cells, wherein the coding gene of the protein is positioned in the middle region of a 5 'homologous arm and a 3' homologous arm on the expression vector, and the 5 'homologous arm and the 3' homologous arm are respectively sequences with the upstream and downstream length of 600bp of the site for stably expressing the protein.

In the invention, the expression vector is a vector suitable for CHO cell expression.

Furthermore, the expression vector also comprises a promoter sequence positioned at the upstream of the coding gene of the protein, and the promoter controls the expression of the protein.

Further, the promoter is: CMV (a strong mammalian expression promoter derived from human cytomegalovirus), EF-1a (a strong mammalian expression promoter derived from human elongation factor 1 α), SV40 (a mammalian expression promoter derived from simian vacuolating virus 40), PGK1 (a mammalian promoter derived from phosphoglycerate kinase gene), UBC (a mammalian promoter derived from human ubiquitin C gene), human beta actin (a mammalian promoter derived from beta-actin gene), CAG (a strong hybrid mammalian promoter), and the like.

In the present invention, there is also included a method of constructing an expression vector for expressing a protein in CHO cells, comprising the steps of: inserting the coding gene of the protein into the region between 5 'arm and 3' arm of the plasmid, and enabling the coding gene of the protein to be positioned at the downstream of the promoter and to be controlled by the promoter to obtain the expression vector for expressing the protein in the CHO cell.

The fourth purpose of the invention is to provide a CHO recombinant cell which can stably express protein in a fixed-point integration way, wherein the CHO recombinant cell is obtained by transferring the expression vector for expressing the protein in the CHO cell, sgRNA plasmid corresponding to a target sequence and Cas9 plasmid into the CHO cell.

Further, the target sequence is preferably 5'-ATCTTACTTTGCAACTACCAAGG-3', 5'-CACTTTATCTAACACTGGCCAGG-3', 5'-AGCAACACTTTATCTAACACTGG-3', 5'-GCACTCTGTGTGGAGCAAAGAGG-3', 5'-GCAAATGAGTAAAGTTCTCCTGG-3', 5'-TGCAGTGATAGCACTCTGTGTGG-3', 5'-AACAGGATGAAAATGTATGGAGG-3', 5'-TTCATCCTGTTCTCTGTTCTGGG-3' or 5'-TTTCATCCTGTTCTCTGTTCTGG-3'.

In the present invention, there is also provided a method for constructing a CHO recombinant cell, comprising the steps of:

(1) transfecting the plasmid vector into a CHO cell by a liposome transfection mode to obtain a recombinant CHO cell pool;

wherein, the plasmids are the expression vector for expressing the protein in the CHO cell, the sgRNA plasmid corresponding to the target sequence and the Cas9 plasmid respectively;

(2) screening the recombinant cell pool to obtain a CHO recombinant cell expressing the foreign protein;

(3) culturing CHO recombinant cells in an adherent manner, detecting the expression level of protein, and performing suspension domestication on high-expression adherent CHO recombinant cells;

(4) and (3) culturing and verifying stability of the suspension domesticated CHO recombinant cells, and detecting the expression level of the protein.

The invention has the beneficial effects that:

the stable expression site obtained by the invention is located in the range of 100bp upstream and downstream of the 103431 th base of the CHO cell gene NW-003614889.1, namely 103331-103531 th base, and can integrate the foreign protein gene and stably express the foreign protein gene. The target gene is integrated into the stable expression region in a fixed-point integration manner, so that the problem of undefined integration site caused by random integration is solved; the invention overcomes the expression instability caused by position effect and the repeated and tedious screening process of cell strains by integrating the exogenous gene at the position of 103331-103531 upstream and downstream bases of 103431 th base of a stable expression site NW _003614889.1 in a CHO genome at a fixed point, reduces the original screening time of 6-12 months to 1-3 months, effectively shortens the research and development time for constructing a stable expression cell line and reduces the cost.

Description of the drawings:

FIG. 1 is a schematic diagram of a fixed point integration according to the present invention;

FIG. 2 shows the EGFP expression of cells constructed with different target sequences in different generations.

FIG. 3 shows the expression of anti-EGFR in cells constructed with different target sequences at different generations.

Detailed Description

The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.

The related detection method comprises the following steps:

the method for measuring the average fluorescence intensity of the cells comprises the following steps: culturing the cells until the confluence reaches about 90%, digesting the cells by using 0.25% trypsin, terminating the digestion by using a complete culture medium with the same amount as the trypsin, collecting the cells in a sterile centrifuge tube, centrifuging for 5min at 1000rpm/min, discarding the supernatant, resuspending the cells by using PBS, collecting the cells in a flow-type sample tube through a cell filter screen, and analyzing the fluorescence intensity of the cells by using a flow cytometer by using a blank CHO-K1 cell as a control.

Example 1: screening for Stable expression sites

The CHO-K1-2d9 cells which are screened by a flow cytometer in high flux and express Zsgreen1 reporter genes are cultured to be in a good state under an adherent culture state, the CHO cells at the time are regarded as 0 generation, the CHO cells are continuously cultured for 20 generations, the conditions that the cells express Zsgreen1 protein at 0, 10 and 20 generations are observed under an inverted fluorescence microscope, and meanwhile, the average fluorescence intensity of the cells at 0, 10 and 20 generations is detected by a BD flow cytometer.

Through observation by an inverted fluorescence microscope and detection by a flow cytometer, after 20 generations of continuous passage, the CHO-K1-2d9 cells can still express Zsgreen1 protein in percentage under the adherent culture state, and the expression levels of the Zsgreen1 protein among different generations are basically consistent and have stronger green fluorescence signals.

Suspension domestication is carried out on CHO-K1-2d9 cells verified by adherence stability, and 60 generations of continuous passage are carried out on CHO-K1-2d9 cells successfully subjected to suspension domestication, and the CHO-K1-2d9 cells are taken as the 0 th generation when the suspension domestication is successfully carried out. And observing the Zsgreen1 protein expression condition of the cells at 0 th, 10 th, 20 th, 30 th, 40 th, 50 th and 60 th generations under an inverted fluorescence microscope, and simultaneously detecting the average fluorescence intensity of the cells at 0 th, 10 th, 20 th, 30 th, 40 th, 50 th and 60 th generations by using a flow cytometer.

Through observation by an inverted fluorescence microscope and detection by a flow cytometer, after 60 generations of continuous passage, the CHO-K1-2d9 cells can still express Zsgreen1 protein in percentage under the suspension culture state, and the expression levels of the Zsgreen1 protein among different generations are basically consistent and have stronger green fluorescence signals. The CHO-K1-2d9 cell is shown to be capable of stably expressing the Zsgreen1 reporter gene, and simultaneously, the integrated site of the lentivirus carrying the Zsgreen1 reporter gene is shown to be a stable expression site.

Example 2: lentiviral integration site analysis

The Integration Site of the lentiviral vector in CHO-K1-2d9 cells was analyzed using the Lenti-X Integration Site Analysis Kit (Clontech:631263) related to chromosome walking technology, and the specific steps were as follows:

(1) construction of lentivirus integration library

Collecting CHO-K1-2d9 cells, extracting a genome by using a DNA extraction kit, and carrying out enzyme digestion on the genome for 16-18h at 37 ℃ by using three restriction enzymes of DraI, SspI and HpaI respectively, wherein the enzyme digestion system is as follows:

purifying and recovering the product after enzyme digestion by using a PCR purification kit, and connecting a chromosome walking joint genomeWalker adapter to two ends of the purified enzyme digestion fragment, wherein the connection system is as follows:

after incubation at 16 ℃ overnight and at 70 ℃ for 5 minutes and termination of the reaction, 32. mu.l of TE (10/1, pH 7.5) was added to the system to obtain three lentivirus integration libraries.

(2) PCR amplification of lentivirus integration libraries

Two rounds of nested PCR were performed on each of the three lentivirus integration libraries obtained in step (1) of example 2. Using the adaptor primers AP1 and AP2 and the lentiviral sequence-specific primers LSP1 and LSP2 of the adaptor ligated in step (1) in example 2, LTR region was amplified from the adjacent genomic region of CHO-K1 cells

The one-round PCR reaction system is as follows:

the reaction procedure was as follows:

mu.l of one round of PCR product was diluted to 50. mu.l with deinized H2O.

The two-round PCR reaction system is as follows:

the reaction procedure was as follows:

(3) sequencing and analysis

The two rounds of PCR products were subjected to agarose gel electrophoresis and gel recovery sequencing, which was performed according to the Lenti-integration Site Analysis Kit (Clontech: 631263). The sequencing results were compared at NCBI with the CHO cell genome to obtain the lentiviral integration site information, which was located 103431 th base of CHO cell genome NW _003614889.1 in CHO-K1-2d9 cells.

Example 3: target sequence selection

According to the principle of closeness, the CCTOP CRISPR/Cas9 is used for predicting the sequences of 100bp upstream and downstream of 103431 base of a position NW _003614889.1 on line: TGCAGTGATAGCACTCTGTGTGGAGCAAAGAGGAAGAGATGGAGCAACACTTTATCTAACACTGGCCAGGAGAACTTTACTCATTTGCTATCTTACTTTGCAACTACCAAGGTCTCTCTTGTTTTCTGTTTTCTCACGTAGTCTACTTGAGTGAGTCATAGTTAACCTCCATACATTTTCATCCTGTTCTCTGTTCTGGG (SEQ ID NO.1), and selecting the target sequence with higher editing efficiency.

The relevant parameters are set as follows:

1) the maximum number of mismatch bases of the first 13bp allowed in the 20bp sequence after the NGG is 1;

2) and the number of mismatched bases of all 20bp after NGG is 4.

The CCTOP CRISPR/Cas9 online prediction system scores the editing efficiency of the identified 5'NNNNNNNNNNNNNNNNNNNNNGG 3' target sequence, LOW efficacy (score < 0.56); MEDIUM efficacy (0.56 [ < 0.74 ]); HIGH efficacy (score > 0.74).

Sequences in which the predicted editing efficiency was higher than 0.56 were selected as target sequences.

Target sequence 5'-ATCTTACTTTGCAACTACCAAGG-3' (SEQ ID No.2), score 0.65

Target sequence 5'-CACTTTATCTAACACTGGCCAGG-3' (SEQ ID No.3), score 0.62

Target sequence 5'-AGCAACACTTTATCTAACACTGG-3' (SEQ ID NO.4), score 0.59

Target sequence 5'-GCACTCTGTGTGGAGCAAAGAGG-3' (SEQ ID No.5), score 0.83

Target sequence 5'-GCAAATGAGTAAAGTTCTCCTGG-3' (SEQ ID NO.6), score 0.57

Target sequence 5'-TGCAGTGATAGCACTCTGTGTGG-3' (SEQ ID No.7), score 0.68

Target sequence 5'-AACAGGATGAAAATGTATGGAGG-3' (SEQ ID No.8), score 0.77

Target sequence 5'-TTCATCCTGTTCTCTGTTCTGGG-3' (SEQ ID No.9), score 0.66

Target sequence 5'-TTTCATCCTGTTCTCTGTTCTGG-3' (SEQ ID NO.10), score 0.69

Example 4: site-directed integration of EGFP

The CRISPR/Cas9 mediated genome site-directed editing technology and homologous recombination are utilized to integrate the green fluorescent protein gene (EGFP, 26.7KDa) at the target site in a site-directed manner. The CRISPR/Cas 9-mediated homologous recombination technology requires the construction of sgRNA Plasmid and Donor Plasmid, and the construction process is as follows:

1. sgRNA plasmid construction

1) Synthesis of an oligonucleotide chain according to the target sequence selected in example 3

sgRNA-F1 5' TTTGATCTTACTTTGCAACTACCAGT 3'(SEQ ID NO.11)

sgRNA-R1 5' TAAAACCCTTGGTAGTTGCAAAGTAAGAT 3'(SEQ ID NO.12)

sgRNA-F2 5' TTTGCACTTTATCTAACACTGGCCGT 3'(SEQ ID NO.13)

sgRNA-R2 5' TAAAACCCTGGCCAGTGTTAGATAAAGTG 3'(SEQ ID NO.14)

sgRNA-F3 5' TTTGAGCAACACTTTATCTAACACGT 3'(SEQ ID NO.15)

sgRNA-R3 5' TAAAACCCAGTGTTAGATAAAGTGTTGCT 3'(SEQ ID NO.16)

sgRNA-F4 5' TTTGGCACTCTGTGTGGAGCAAAGGT 3'(SEQ ID NO.17)

sgRNA-R4 5' TAAAACCCTCTTTGCTCCACACAGAGTGC 3'(SEQ ID NO.18)

sgRNA-F5 5' TTTGGCAAATGAGTAAAGTTCTCCGT 3'(SEQ ID NO.19)

sgRNA-R5 5' TAAAACCCAGGAGAACTTTACTCATTTGC 3'(SEQ ID NO.20)

sgRNA-F6 5' TTTGTGCAGTGATAGCACTCTGTGGT 3'(SEQ ID NO.21)

sgRNA-R6 5' TAAAACCCACACAGAGTGCTATCACTGCA3'(SEQ ID NO.22)

sgRNA-F7 5' TTTGAACAGGATGAAAATGTATGGGT 3'(SEQ ID NO.23)

sgRNA-R7 5' TAAAACCCTCCATACATTTTCATCCTGTT 3'(SEQ ID NO.24)

sgRNA-F8 5' TTTGTTCATCCTGTTCTCTGTTCTGT 3'(SEQ ID NO.25)

sgRNA-R8 5' TAAAACCCCAGAACAGAGAACAGGATGAA 3'(SEQ ID NO.26)

sgRNA-F9 5' TTTGTTTCATCCTGTTCTCTGTTCGT 3'(SEQ ID NO.27)

sgRNA-R9 5' TAAAACCCAGAACAGAGAACAGGATGAAA 3'(SEQ ID NO.28)

2) Annealing and connecting the synthesized oligonucleotide chains (1-9 pairs) respectively

Performing metal bath at 95 ℃ for 5min, and naturally cooling to room temperature;

3) carrying out enzyme digestion on the PSK-u6-gRNA plasmid by BBsI enzyme, and carrying out gel recovery on the vector subjected to enzyme digestion;

4) connecting the recovered plasmid vector with the annealed oligonucleotide chain

Ligation at 22 ℃ for 1h or overnight at 4 ℃;

5) transformation to DH5 α competence;

6) selecting positive clones, and sequencing by using a universal primer M13 fwd;

7) and expanding and culturing the positive clone bacterial strain and extracting plasmid.

2. Construction of Donor plasmid: the Donor plasmid information is shown in FIG. 1, and is obtained by modifying a plasmid vector expressing EGFP. The 5 'arm and the 3' arm are respectively an upstream homologous arm and a downstream homologous arm of the target site recognized by each pair of sgRNAs, the length is 600bp, and the GOI is an integrated target gene.

1) Obtaining 5 'arm and 3' arm with the length of 600bp upstream and downstream of the site with the plasmid homologous fragment through primer design and PCR amplification;

2) respectively utilizing double enzyme digestion and glue recovery to cut out the original homology arm of the Donor plasma;

3) respectively connecting 5 'arm and 3' arm corresponding to the target site by a homologous recombination method;

4) and the EGFP sequence of the target gene is carried by the original plasmid.

3. The constructed sgRNA plasmid, Donor plasmid and Cas9-DTU plasmid (donated by dr. helene F Kildegaard, denmark science and technology university) were transfected with Lipofectamine 3000 transfection reagent at 1.8: the CHO-K1 cells cultured at 37 ℃ and 5% CO2 were CO-transfected at a mass ratio of 1.8:1, and a blank control was set. After 24h of transfection, pressure screening was performed using puromycin at 10. mu.g/ml until all the control cells were dead, the post-screening cell pool was expanded, and monoclonal cells emitting only green fluorescence and not emitting red fluorescence were sorted out using a BD flow cytometer.

4. After the cloning cell strain is amplified, a part of the amplified cell strain is extracted to obtain a genome, and the genome is identified by 5 'Junction PCR, 3' Junction PCR and out-out PCR, as shown in FIG. 1.

5. The positive clone cell line was retained.

Example 5: site-directed integration anti-EGFR

The gene (anti-EGFR, 150KDa) of the humanized antibody expressing the epidermal growth factor receptor is integrated at a target site in a site-specific manner by using a CRISPR/Cas9 mediated genome site-specific editing technology and homologous homology. The CRISPR/Cas 9-mediated homologous recombination technology requires the construction of sgRNA Plasmid and Donor Plasmid, and the construction process is as follows:

1. construction of sgRNA plasmid:

sgRNA-F1 5' TTTGATCTTACTTTGCAACTACCAGT 3'

sgRNA-R1 5' TAAAACCCTTGGTAGTTGCAAAGTAAGAT 3'

sgRNA-F2 5' TTTGCACTTTATCTAACACTGGCCGT 3'

sgRNA-R2 5' TAAAACCCTGGCCAGTGTTAGATAAAGTG 3'

sgRNA-F3 5' TTTGAGCAACACTTTATCTAACACGT 3'

sgRNA-R3 5' TAAAACCCAGTGTTAGATAAAGTGTTGCT 3'

sgRNA-F4 5' TTTGGCACTCTGTGTGGAGCAAAGGT 3'

sgRNA-R4 5' TAAAACCCTCTTTGCTCCACACAGAGTGC 3'

sgRNA-F5 5' TTTGGCAAATGAGTAAAGTTCTCCGT 3'

sgRNA-R5 5' TAAAACCCAGGAGAACTTTACTCATTTGC 3'

sgRNA-F6 5' TTTGTGCAGTGATAGCACTCTGTGGT 3'

sgRNA-R6 5' TAAAACCCACACAGAGTGCTATCACTGCA 3'

sgRNA-F7 5' TTTGAACAGGATGAAAATGTATGGGT 3'

sgRNA-R7 5' TAAAACCCTCCATACATTTTCATCCTGTT 3'

sgRNA-F8 5' TTTGTTCATCCTGTTCTCTGTTCTGT 3'

sgRNA-R8 5' TAAAACCCCAGAACAGAGAACAGGATGAA 3'

sgRNA-F9 5' TTTGTTTCATCCTGTTCTCTGTTCGT 3'

sgRNA-R9 5' TAAAACCCAGAACAGAGAACAGGATGAAA 3

Ligation was performed at 22 ℃ for 1h or at 4 ℃ overnight;

5) transformation to DH5 α competence;

7) expanding and culturing positive clone strains and improving quality;

2. construction of Donor Plasmid: the Donor plasma information is shown in fig. 1. The 5 'arm and the 3' arm are respectively the upstream and downstream homologous arms of the target site, the length is 600bp, and the GOI is the integrated target gene.

4) and obtaining the target gene anti-EGFR through PCR amplification, and connecting the gene anti-EGFR to a plasmid vector by utilizing enzyme digestion linkage.

3. The constructed sgRNA plasmid, Donor plasmid and Cas9-DTU plasmid (donated by dr. helene F Kildegaard, denmark science and technology university) were transfected with Lipofectamine 3000 transfection reagent at 1.8: 1.8:1 mass ratio cotransfection at 37 ℃ with 5% CO₂CHO-K1 cells cultured under conditions, while a blank control was set. After 24h of transfection, pressure screening was performed using puromycin at 10. mu.g/ml until all cells in the control group died, the post-screening cell pool was expanded and monoclonal cells that did not fluoresce were sorted out using a BD flow cytometer.

4. After the cloning cell strain is expanded, a part of the extracted genome is identified by 5 'Junction PCR, 3' Junction PCR and out-out PCR, as shown in FIG. 1.

5. The positive clone cell line was retained.

Test example:

1. the green fluorescence intensity of the cell line constructed in example 4 was measured by a BD flow cytometer

The detection method comprises the following steps: the cell strains obtained in example 4 are continuously passaged for 60 generations, cells are collected for 15 generations, the fluorescence of the cells is detected by a flow cytometer and the intensity is detected, as shown in fig. 2, the detection result shows that more than 98% of the cells constructed according to different target sequences in example 4 still express green fluorescent protein after the cells are continuously passaged for 60 generations, and the fluctuation range of the green fluorescent intensity between the 0 th generation and the 60 th generation does not exceed 30%.

2. ELISA kit for detecting EGFR antibody expression condition

The detection method comprises the following steps: the cell strains obtained in example 5 are continuously passaged for 60 generations under a serum-free culture condition, cell fermentation supernatants under the generations are collected every 15 generations, the content of anti-EGFR in fermentation liquor is detected by using an ELISA kit, and analysis of detection results shows that the cells constructed according to different target sequences in example 5 have stable ability of expressing the anti-EGFR at different generations, as shown in FIG. 3.

The 9 sets of target sequences screened in the example 3 of the present invention cover most of the sequences at the upper, middle and lower reaches within 200bp of the present invention, and the 103331-103531 base ranges in the CHO cell gene NW _003614889.1 of the present invention can successfully construct site-specific integration stable expression cell lines, and can stably express the target protein.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Sequence listing

<110> university in south of the Yangtze river

<120> site for stably expressing protein in CHO cell gene NW _003614889.1 and application thereof

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 200

<212> DNA

<213> (Artificial sequence)

<400> 1

tgcagtgata gcactctgtg tggagcaaag aggaagagat ggagcaacac tttatctaac 60

actggccagg agaactttac tcatttgcta tcttactttg caactaccaa ggtctctctt 120

gttttctgtt ttctcacgta gtctacttga gtgagtcata gttaacctcc atacattttc 180

atcctgttct ctgttctggg 200

<210> 2

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 2

atcttacttt gcaactacca agg 23

<210> 3

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 3

cactttatct aacactggcc agg 23

<210> 4

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 4

agcaacactt tatctaacac tgg 23

<210> 5

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 5

gcactctgtg tggagcaaag agg 23

<210> 6

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 6

gcaaatgagt aaagttctcc tgg 23

<210> 7

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 7

tgcagtgata gcactctgtg tgg 23

<210> 8

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 8

aacaggatga aaatgtatgg agg 23

<210> 9

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 9

ttcatcctgt tctctgttct ggg 23

<210> 10

<211> 23

<212> DNA

<213> (Artificial sequence)

<400> 10

tttcatcctg ttctctgttc tgg 23

<210> 11

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 11

tttgatctta ctttgcaact accagt 26

<210> 12

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 12

taaaaccctt ggtagttgca aagtaagat 29

<210> 13

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 13

tttgcacttt atctaacact ggccgt 26

<210> 14

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 14

taaaaccctg gccagtgtta gataaagtg 29

<210> 15

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 15

tttgagcaac actttatcta acacgt 26

<210> 16

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 16

taaaacccag tgttagataa agtgttgct 29

<210> 17

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 17

tttggcactc tgtgtggagc aaaggt 26

<210> 18

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 18

taaaaccctc tttgctccac acagagtgc 29

<210> 19

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 19

tttggcaaat gagtaaagtt ctccgt 26

<210> 20

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 20

taaaacccag gagaacttta ctcatttgc 29

<210> 21

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 21

tttgtgcagt gatagcactc tgtggt 26

<210> 22

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 22

taaaacccac acagagtgct atcactgca 29

<210> 23

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 23

tttgaacagg atgaaaatgt atgggt 26

<210> 24

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 24

taaaaccctc catacatttt catcctgtt 29

<210> 25

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 25

tttgttcatc ctgttctctg ttctgt 26

<210> 26

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 26

taaaacccca gaacagagaa caggatgaa 29

<210> 27

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 27

tttgtttcat cctgttctct gttcgt 26

<210> 28

<211> 29

<212> DNA

<213> (Artificial sequence)

<400> 28

taaaacccag aacagagaac aggatgaaa 29

Claims

1. The application of a site for stably expressing a protein in a CHO cell gene NW _003614889.1 in stably expressing a foreign protein or polypeptide in a CHO cell is characterized in that a gene encoding the foreign protein or polypeptide is integrated into the site for stably expressing the protein in the CHO cell gene NW _003614889.1, and the site for stably expressing the protein is positioned in 103331-103531 th base of the CHO cell gene NW _ 003614889.1.

2. The use according to claim 1, wherein the site of stable protein expression is recognized by CRISPR/Cas9 technology with 5'NNNNNNNNNNNNNNNNNNNNNGG 3' as target sequence.

3. The use according to claim 1, wherein the protein is a protein having a molecular weight of less than 160 KDa.

4. An expression vector for expressing a protein in CHO cells, wherein a gene encoding the protein is located in a region between a 5 'homology arm and a 3' homology arm of the expression vector, and the 5 'homology arm and the 3' homology arm are sequences having a length of 600bp upstream and downstream of the site where the protein is stably expressed according to claim 1.

5. The expression vector of claim 4, further comprising a promoter sequence upstream of the gene encoding the protein, wherein the promoter controls the expression of the protein.

6. The expression vector of claim 5, wherein the promoter is: one of a human cytomegalovirus-derived strong mammalian expression promoter, a human elongation factor 1 α -derived strong mammalian expression promoter, a simian vacuolating virus 40-derived mammalian expression promoter, a phosphoglycerate kinase gene-derived mammalian promoter, a human ubiquitin C gene-derived mammalian promoter, a β -actin gene-derived mammalian promoter, and a strong hybrid mammalian promoter.

7. A CHO recombinant cell for expressing a protein in a site-specific integration manner, which is obtained by transferring the expression vector for expressing the protein in the CHO cell according to claim 4, a sgRNA plasmid corresponding to a target sequence and a Cas9 plasmid into the CHO cell, wherein the target sequence is shown as 5'NNNNNNNNNNNNNNNNNNNNNGG 3' in the specification.