CN109295092B

CN109295092B - Application of NW _003613638-1 stable expression protein in CHO cell genome

Info

Publication number: CN109295092B
Application number: CN201811274637.4A
Authority: CN
Inventors: 李华钟; 金坚; 周松涛; 陈蕴; 段作营; 龚笑海
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-10-30
Filing date: 2018-10-30
Publication date: 2021-06-29
Anticipated expiration: 2038-10-30
Also published as: CN109295092A; WO2020088300A1; SG11202009389QA

Abstract

The invention discloses an application of a protein stably expressed by NW _003613638-1 in a CHO cell genome, wherein a site for stably expressing the protein in the CHO cell genome is positioned at the 1969647 th base of a CHO cell gene NW _ 003613638.1; the 5'NNNNNNNNNNNNNNNNNNNNNGG3' recognized by CRISPR/Cas9 technology within the vicinity of the site 1969591-1969721 is the target sequence. The invention discloses a method for stably expressing different protein genes introduced into a fixed position in a CHO cell genome.

Description

Application of NW _003613638-1 stable expression protein in CHO cell genome

Technical Field

The invention relates to the technical field of genes, in particular to a CHO cell recombinant gene for stably expressing protein.

Background

Chinese Hamster Ovary Cells (CHO) as the dominant cell line in the biopharmaceutical field, many different types of CHO cell lines have been developed, including cell lines that can be used to expand the copy number of genes. However, an increase in the copy number of the transgene is not clearly directly correlated with an increase in the yield of the protein of interest. And even if the protein expression is increased, the expression level of most CHO cells is unstable. The method for constructing stably transfected cells, which is currently widely used, is time-consuming and labor-consuming, mainly because a large number of monoclonal screening processes need to be repeated, so that a method for obtaining cells with high expression and stable expression in a short time is generally expected in the field of cell line construction, and the constructed recombinant cell line has the same quality level compared with the traditional method so as to ensure the approval of a regulatory agency.

The traditional method for constructing the exogenous protein expression cell line is to obtain the exogenous protein high expression cell line by randomly integrating exogenous genes on a cell genome and screening a series of high expression monoclonal cells. Due to the diversity of site effect differences, the expression level of recombinant cells generated by random integration varies, so that a long time and many steps are needed for selecting high-expression monoclonal cells at a later stage. The monoclonal cells obtained by random integration cannot ensure the stable expression of the polypeptide/protein in cell passage, and the monoclonal screening needs to be repeatedly carried out every time the recombinant cell is constructed, so that the research and development cost of the biopharmaceutical is increased.

Site effects hamper the efficiency of traditional random integration to construct recombinant cell lines, and repeated high expression monoclonal screening is time consuming, labor intensive, and costly. How to overcome the site effect and rapidly and efficiently obtain stably expressed monoclonal cells by utilizing a fixed-point integration technology has been discussed in academia for many years and has not been developed in a breakthrough way.

Disclosure of Invention

In view of the above problems in the prior art, the present applicant provides an application of NW _003613638-1 in CHO cell genome to stably express protein. The invention is applied to introduce different protein genes into a fixed position in a CHO cell genome and carry out stable expression; in addition, in the process of realizing the fixed-point integration, a plurality of monoclonals do not need to be selected to obtain a higher expression cell strain, and a great amount of time is saved.

The technical scheme of the invention is as follows:

use of a site within the genome of a CHO cell for stable expression of a protein, said site within the genome of the CHO cell being at base 1969647 of the CHO cell gene NW _ 003613638.1;

the 5'NNNNNNNNNNNNNNNNNNNNNGG3' which can be recognized by CRISPR/Cas9 technology in the range of 1969591-1969721 near the site is a target sequence.

The protein is a protein with a molecular weight of less than 160 KDa.

The protein is one of red fluorescent protein, polypeptide, functional protein, antibody and fusion protein.

The target sequence is located at about base 1969647 of the CHO cell gene NW _003613638.1 at base 1969633-1969655.

Further the target sequence is 5'-CCATGAGGAAAACTTTTTGAGGG-3'.

The target sequence is 5'-ATTTATATTCAGTATACATTTGG-3'.

The target sequence is 5'-TTTATATTCAGTATACATTTGGG-3'.

The target sequence is 5'-GTGTATCTTCGAACCAAAACTGG-3'.

The target sequence is 5'-TGTATCTTCGAACCAAAACTGGG-3'.

The target sequence is 5'-ACTGGGTCACAAAATGTTTTAGG-3'.

The target sequence is 5'-TTTACTCTTTCAACATTCTGAGG-3'.

The target sequence is 5'-AACATTCTGAGGACTGCTCAAGG-3'.

The target sequence is 5'-AACATTTTGTGACCCAGTTTTGG-3'.

A recombinant donor vector containing the recombinant donor vector for expressing a protein.

The recombinant donor vector is a vector expressed by CHO cells.

The preparation method of the recombinant donor vector comprises the following steps: inserting the protein gene into the middle region between 5 'arm and 3' arm of plasmid to make the nucleotide sequence be positioned at the downstream of promoter and controlled by it so as to obtain the recombinant CHO cell expression plasmid.

The promoter is: CMV (strong mammalian expression promoter derived from human cytomegalovirus), EF-1a (strong mammalian expression promoter derived from human elongation factor 1. alpha.), SV40 (mammalian expression promoter derived from simian vacuolating virus 40), PGK1 (mammalian promoter derived from phosphoglycerate kinase gene), UBC (mammalian promoter derived from human ubiquitin C gene), human beta actin (mammalian promoter derived from beta-actin gene), and CAG (strong hybrid mammalian promoter).

A CHO recombinant cell line for stable expression of a protein.

A method for expressing protein by CHO cell gene is characterized by comprising the following steps:

(1) transforming CHO cells by using the recombinant donor vector to obtain recombinant CHO cells;

(2) culturing the recombinant CHO cells on a flat plate, collecting supernatant to detect expression level, and performing suspension domestication on the adherent recombinant CHO cells;

(3) suspension domesticated recombinant CHO cells were cultured in small shake flasks and the expression level of the protein was examined.

The application of the invention also provides selection of stable expression sites in the CHO cell genome:

1) fluorescent tagged lentiviruses were constructed and their titers calculated. After the igk-luc gene is integrated into the multiple cloning site of the pLVX-CMV-MCS-T2A-Zsgreen vector, three plasmids of pSPAX2 and pMD2G are simultaneously used for transfection to HEK-293T cells, cell supernatants are taken twice at 48 hours and 72 hours, and the lentivirus is obtained by ultracentrifuging the supernatant after collection.

2) CHO cells were plated on 6-well plates for overnight culture, and the following day lentiviruses were diluted and infected at a lower MOI (MOI <1) (virus particles per cell). After 96 hours of infection, the cells were sorted by flow cytometry, and the fraction with the brightest fluorescence intensity was directly seeded into a 96-well plate. After one week, when the cells grew into monoclonal colonies, the cells were observed under a fluorescence microscope, and the brightest colony cells with normal morphology and growth were selected and transferred to a 24-well plate for expansion culture. Transferring the cultured cells to a 6-well plate for culture when the confluency of the cultured cells reaches nearly 90%, finally expanding the cells to a culture dish of 10cm for culture, freezing and storing a part of cells, and continuously expanding and culturing the rest cells.

3) All CHO cell gene Integration sites of lentiviruses were found using the chromosome walking technique Lenti-X Integration Site Analysis Kit (Clontech: 631263).

And taking a plurality of cell lines with the brightest fluorescence intensity and normal cell morphology and growth speed as materials, and carrying out overnight enzyme digestion on the genome DNA by adopting three restriction enzymes of ADrai I, SspI and HpaI. Wherein the genome DNA is 2.5 mu g, the restriction enzyme is 80U, and a 100 mu L reaction system is prepared. The digestion was carried out overnight at 37 ℃ (16-18 hours).

And purifying and recovering the enzyme digestion product by using a DNA recovery kit. 4.8 mu L of genome DNA after enzyme digestion is added with 1.9 mu L of chromosome walking linker genome Walker adapter (25 mu M) and 0.5 mu LT4 ligase to prepare an 8 mu L system for ligation experiment. The ligation was performed overnight at 16 ℃. The ligation system was heated at 70 ℃ for 5 minutes to inactivate the ligase. Each system was prepared into a corresponding library by adding 32. mu.L of TE buffer.

The library was subjected to 2 rounds of nested PCR to amplify the LTR region from the adjacent genomic region. The relevant PCR reaction procedures can be performed with reference to the Lenti-X Integration Site Analysis Kit (Clontech:631263) Kit instructions.

And finally, carrying out electrophoresis on the PCR product, cutting the main strip into gel, recovering the gel and then sequencing. After obtaining all lentiviral integration information for each cell line, the information on CHO cell lines with only single copy lentiviral integration was selected and their sequence information was aligned with the CHO-K1 genomic information on BLAST to find integration sites with high expression.

The beneficial technical effects of the invention are as follows:

the invention adopts a fixed-point integration method, can well overcome the problem of uncertainty of integration sites caused by random integration by integrating target genes into a stable expression region in a fixed point manner, effectively avoids repeated rounds of high-expression monoclonal screening, can effectively reduce the research and development time of constructing a stable expression cell line by biopharmaceuticals, and reduces the cost.

The invention introduces protein gene at the fixed point of CHO cell gene, and stably expresses.

Drawings

FIG. 1 is a schematic view of the present invention.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings and examples.

FIG. 1 is a schematic representation of a donor plasmid used for integration at this site and a simulated schematic representation of how site-specific integration by homologous recombination occurs. Among them, GOI is our gene of interest that integrates site-specifically into the target site by two homologous recombination arms, 5 'arm and 3' arm, under 4. mu.g/mL puromycin selection pressure. Furthermore, the sequence upstream of the 5' arm is a negative selection tag which can be used to remove randomly integrated monoclonal cells, ensuring that the final recombinant CHO cell line is obtained with site-directed integration.

Example 1

Selecting a high expression site;

NW-003613638.1, 1969647 bases, where the Zsgreen1 gene was integrated. For this fluorescent cell, subculture was performed for not less than 50 passages, and the expression level of fluorescence was examined by flow cytometry. The 50 th generation fluorescent cells still have better green fluorescent protein expression level, and the fluorescent signals can be stably maintained in the passage process of the cells.

In addition, the fluorescent cells are subjected to suspension domestication, and the expression level of the fluorescent protein after suspension domestication is detected again by using a flow cytometer. The detection result shows that more than 95% of the recombinant CHO cells suspended for 50 generations still keep the expression of the green fluorescent protein after suspension, and the site is considered to be extremely stable, so that the fluorescent protein gene integrated at a fixed point cannot be lost due to cell passage.

Example 2

Selecting a specific target point;

according to the principle of proximity, the sequence:

5’TCTAGATCCTGATACACTGATGTCCCCCTATTTTAAAATGTCCCTCAAAAAGTTTTCCTCATGGCCTGAAGACAAAAATCCTGGTATTTTAACTGACCTAATTTTTCAAGTGTCCAAGTTTCATAGGTTT 3’

inputting the target sequence into a CRISPRater system, predicting and selecting target sequences with lower off-target efficiency. Wherein the parameter settings are as follows: 1) the maximum number of mismatched bases of the first 15bp after NGG is 0; 2) the number of mismatched bases of all 21bp after NGG was 2.

After the above operations, the following sequences with a score of 0.73 were selected as target sequences according to their scores:

5’-CCATGAGGAAAACTTTTTGAGGG-3’；

according to the CRISPRater system, LOW efficacy (score < 0.56); MEDIUM efficacy (0.56 ═ score ≦ 0.74); HIGH efficacy (score > 0.74).

According to the CRISPR rater system, all target sequences in the range of 1969591-1969721 near the site NW _006880285.1 obtain a score of more than 0.56, are in a medium effective or high-efficiency range, and can be used as 5'NNNNNNNNNNNNNNNNNNNNNGG3' target sequences recognized by CRISPR/Cas9 technology.

Example 3 selection of promoters

The CMV (human cytomegalovirus-derived strong mammalian expression promoter) promoter position is replaced with a different promoter, and a common promoter such as EF-1a (human elongation factor 1 α -derived strong mammalian expression promoter), SV40 (simian vacuolating virus 40-derived mammalian expression promoter), PGK1 (phosphoglycerate kinase gene-derived mammalian promoter), UBC (human ubiquitin C gene-derived mammalian promoter), human beta (β -actin gene-derived mammalian promoter), or CAG (strong hybrid mammalian promoter) is included. Through detection, the promoters can regulate and control downstream red fluorescent protein gene sequences and express corresponding red fluorescent proteins.

Example 4

Site-specific integration of the red fluorescent protein gene (DsRed, 26KDa) at specific sites: for later construction of CRISPR/Cas 9-mediated homologous recombination, sgRNA and Donor Plasmid were constructed as follows:

1. construction of SgRNA, first, the following sequence was synthesized

sgRNA-1fwd 5’TTTGCCATGAGGAAAACTTTTTGAGT 3’

sgRNA-1rev 5’TAAAACTCAAAAAGTTTTCCTCATGG 3’

1) Carrying out BBsI enzyme digestion on the PSK-u6-gRNA plasmid, and recovering the cut vector;

2) annealing of the synthesized fragment to a double strand with a sticky end

Water bath at 95 deg.C for 5min, and naturally cooling to room temperature in water bath kettle;

4) connecting and transforming;

5) selecting clone, and performing PCR identification by using identification primers as follows:

m13-synthetic R primers, positive clones with bands amplified.

2. Construction of Donorplamid

Specific donor prism information is shown in fig. 1: except for GOI, the rest parts are synthesized; the upstream and downstream 600bp sequences of the target point are the sequence information of the left and right homologous arms of the donor plasma, and the GOI is the process that the HSA is integrated on the donor plasma by the existing Novozan C115 kit.

3. Cas9 (Dr. Helene F Kildegaard donation, Denmark science and technology university), SgRNA and Donor plasmid 3 plasmids were CO-transfected at 37 ℃ with 5% CO₂CHO cells cultured under the condition, the molar ratio of the three plasmids is 1:1:1, the transfection reagent is Lipofectamine 3000(Thermo Fisher Scientific), the specific transfection method refers to the instruction, then the cells are added with 4 mu g/ml puromycin for screening, and the process is 10 days in total; monoclonal cell sorting was then performed using a MoFloXDP FACS machine (Beckman Coulter), and cells containing red fluorescence but not green fluorescence were selected and seeded into 96-well plates.

4. After the cells grow for 2 weeks, a part of the cells is taken for identification, and PCR identification is carried out, and identification is carried out by 5 'Junction PCR, 3' Junction PCR and out-out PCR. Positive cells were retained.

Example 5

The glucagon-like peptide-1-human serum albumin fusion protein gene (NGGH, 75KDa) is integrated at a specific site in a fixed-point mode: for later construction of CRISPR/Cas 9-mediated homologous recombination, sgRNA and Donor Plasmid were constructed as follows:

1. sgRNA was constructed as in example 4.

2. Construction of Donor plasmid.

Specific donor prism information is shown in fig. 1: except for GOI, the rest parts are synthesized; the upstream and downstream 600bp sequences of the target point are the sequence information of the left and right homologous arms of the donor plasma, and the GOI is the process that the NGGH is integrated on the donor plasma by the NGGH gene through the existing Novovozap company C115 kit.

3. Cas9, SgRNA and Donor plasmid 3 were CO-transfected at 37 ℃, 5% CO₂CHO cells cultured under the conditions, the molar ratio of the three plasmids is 1:1:1, the transfection reagent is Lipofectamine 3000(Thermo Fisher Scientific), and the specific transfection method is referred to the instruction. Cells were then screened by adding 4. mu.g/mL puromycin for a total of 10 days. Monoclonal cell sorting was then performed using a MoFloXDP FACS machine (Beckman Coulter), and cells without any fluorescence were selected and seeded into 96-well plates.

4. After 2 weeks of cell growth, a portion was taken for identification. The identification is carried out by carrying out PCR identification, 5 'Junction PCR, 3' Junction PCR and out-out PCR. Positive cells were retained.

Example 6

Site-specific integration of the antibody gene (Avastin,160KDa) at specific sites: for later construction of CRISPR/Cas 9-mediated homologous recombination, sgRNA and Donor Plasmid were constructed as follows:

1. sgRNA construction was the same as in example 4.

2. Construction of Donor plasmid.

Specific donor prism information is shown in fig. 1: except for GOI, the rest parts are synthesized; the upstream and downstream 600bp sequences of the target point are the sequence information of the left and right homologous arms of the donor plasma, and the GOI is the process that the Avastin gene completes the integration of the antibody gene to the donor plasma through the existing Novex company C115 kit.

3. Cas9 (Dr. Helene F Kildegaard donation, Denmark science and technology university), SgRNA and Donor plasmid 3 plasmids were CO-transfected at 37 ℃, 5%, CO₂CHO cells cultured under the conditions, the molar ratio of the three plasmids is 1:1:1, the transfection reagent is Lipofectamine 3000(Thermo Fisher Scientific), and the specific transfection method is referred to the instruction. Cells were then screened by adding 4. mu.g/mL puromycinThe process is selected for 10 days. Monoclonal cell sorting was then performed using a MoFloXDP FACS machine (Beckman Coulter), and cells without any fluorescence were selected and seeded into 96-well plates.

Example 7

The human serum albumin gene (HSA,68KDa) was site-directed integrated at a specific site: for later construction of CRISPR/Cas 9-mediated homologous recombination, sgRNA and Donor Plasmid were constructed as follows:

1. sgRNA construction was the same as in example 4.

2. Construction of Donor plasmid.

3. Cas9 (Dr. Helene F Kildegaard donation, Denmark science and technology university), SgRNA and Donor plasmid 3 plasmids were CO-transfected at 37 ℃, 5%, CO₂CHO cells cultured under the conditions, the molar ratio of the three plasmids is 1:1:1, the transfection reagent is Lipofectamine 3000(Thermo Fisher Scientific), and the specific transfection method is referred to the instruction. Cells were then screened by adding 4. mu.g/mL puromycin for a total of 10 days. Monoclonal cell sorting was then performed using a MoFloXDP FACS machine (Beckman Coulter), and cells without any fluorescence were selected and seeded into 96-well plates.

4. After 2 weeks of cell growth, a portion was taken for identification. The identification is carried out by carrying out PCR identification, 5 'Junction PCR, 3' Junction PCR and out-out PCR. Retaining positive cells

Test example:

ELISA tests were performed on the three cell lines prepared in examples 4-7 to see if the target protein was expressed and if it was stably expressed for a long period of time.

The detection method comprises the following steps: all the three detections are carried out by an ELISA method, all selected positive cells are cultured in a 6-well plate, whether the target protein is stably expressed for a long time is detected, and the used Kit is a Human Albumin ELISA Kit (RK00157) and a Human IgG (Total) ELISA Kit (RK00393) of Abclonal company.

The red fluorescent protein expressing cell line prepared in example 4 was examined by flow cytometry, and expression of red fluorescence was observed, and all cells stably expressed red fluorescent protein within 50 passages.

The detection method comprises the following steps: after the cells with different passage times are collected, the flow cytometer is directly used for detecting the expression of red fluorescence, and the percentage of the red fluorescence protein expressed by the recombinant CHO cells with different passages is detected to be more than 95%.

After the 5'-CCATGAGGAAAACTTTTTGAGGG-3' sequences are selected and tested as above, good results are obtained, so that the target sequences can successfully construct a site-directed integration stable expression cell line and can stably express the target protein.

Claims

1. The application of a CHO cell in stably expressing protein, which is characterized in that a protein coding gene is introduced into the CHO cell at the 1969647 th base site of a gene NW _ 003613638.1;

5'-CCATGAGGAAAACTTTTTGAGGG-3' near the site, which can be recognized by CRISPR/Cas9 technology within the range of 1969633 and 1969655, is a target sequence.

2. Use according to claim 1, characterized in that the protein is a protein with a molecular weight of less than 160 KDa.

3. The use of claim 1, wherein the protein is one of a functional protein and a fusion protein.

4. The use of claim 1, wherein the protein is an antibody.

5. A recombinant donor vector for stably expressing a protein, wherein a protein-encoding gene is inserted into a region between 5 'arm and 3' arm in a plasmid so that a nucleotide sequence of the protein-encoding gene is located downstream of and under the control of a promoter to obtain a recombinant CHO cell expression plasmid, i.e., a recombinant donor vector; the 5 'arm and the 3' arm are homologous arms of 5'-CCATGAGGAAAACTTTTTGAGGG-3' which can be recognized by CRISPR/Cas9 technology in the range of 1969633-1969655 near the 1969647 th base of the CHO cell gene NW _ 003613638.1.

6. A CHO recombinant cell line for stable expression of a protein comprising the recombinant donor vector of claim 5.