WO2023093007A1 - Site for stably expressing protein in cho cell gene nw_003614889.1, and use thereof - Google Patents

Abstract

Provided are a site for stably expressing a protein in the CHO cell gene NW_003614889.1, and the use thereof, wherein the obtained site for stable expression is located within a range of 100 bp upstream and downstream of the 103431st base of the CHO cell gene NW_003614889.1, that is, an exogenous protein gene can be integrated at the 103331st-103531st bases and stably expressed. In the present invention, a target gene is integrated to the above-mentioned region for stable expression by means of site-specific integration, which solves the problem of unclear integration sites caused by random integration; and by means of the site-specific integration of an exogenous gene at the site for stable expression in a CHO genome which is located within a range of the 103331st-103531st bases upstream and downstream of the 103431st base of gene NW_003614889.1, the problems of expression instability caused by the position effect and a repetitive and tedious cell strain screening process are overcome.

Description

A site for stably expressing protein in CHO cell gene NW_003614889.1 and its application technical field

The invention relates to a site for stably expressing protein in CHO cell gene NW_003614889.1 and an application thereof, belonging to the field of gene technology.

Background technique

Chinese hamster ovary (CHO) cells were established in Dr. Theodore T. Puck's laboratory in 1957. They are immortalized non-secreting cells that rarely secrete endogenous proteins; Post-translational modifications closer to human natural proteins, less susceptible to human virus infection, and large-scale culture in serum-free medium with defined chemical components, etc., are widely used in the field of biopharmaceuticals, and more than 70% of proteins are produced drug. However, as mammalian cells, CHO cells have a long culture cycle and high culture costs. At the same time, the demand for recombinant products such as monoclonal antibodies continues to increase. The continuous growth of demand means that the specific productivity still needs to be optimized. Although the expression level can be increased by increasing the copy number of the gene, developing a new strong promoter, finding a suitable enhancer, etc., the expression level of most CHO cells is unstable during the long-term culture process, which directly affects the supervision of the product by the regulatory authorities. Approval and listing issues. Therefore, it is very important to construct a CHO expression strain that stably and highly expresses the target gene for the development and marketing of protein drugs.

There are currently two strategies for constructing stable and high-expressing cell lines. One is the combination of traditional random integration and high-throughput screening, and the other is the combination of gene editing technology and homology-directed repair to integrate the target gene into a predetermined chromosomal site. However, due to the uncertainty of the integration site and the existence of position effects in random integration, the genotypes of the constructed cells are very different, and expression instability is prone to occur in the process of long-term passage, resulting in a very long screening process in the later stage. In an industrial setting, the entire process of generating recombinant cell lines by random integration usually takes 6-12 months; compared with random integration, site-directed integration utilizes gene editing technology, especially CRISPR/Cas9-mediated, which has been widely used in recent years Genome fixed-point editing technology greatly reduces the time and cost of research and development, and because the sequence is known, the information after fixed-point integration is clearer than that after random integration.

Random integration is the most mature traditional method for constructing protein expression systems, but obtaining stable high-expression cell lines through random integration requires multiple screenings, which is time-consuming and expensive. At the same time, for the cell lines obtained by random integration, the loss of expression stability of the cells in the later stage of culture is completely unpredictable: this instability may not occur at all; it may also gradually appear after numerous cell divisions; It is also possible that apparent instability occurs after only a few generations of cell division. The stability issue will not only affect the time to market of the product, but will also conflict with drug regulatory management. In addition, the information of random integration sites is not clear, and the site effect of exogenous gene integration will also lead to a significant decrease in the expression level of the target gene. According to existing literature reports, this instability of recombinant CHO cell lines occurs in all recombinant CHO cell lines, making the problem of unstable expression an extremely common problem.

Contents of the invention

In order to solve the above technical problems, the present invention provides a site for stably expressing proteins in the genome of CHO cells. The screening process and time in the cell construction process reduce the cost of research and development.

The first object of the present invention is to provide a stable protein expression site in the CHO cell genome, and the stable protein expression site is located in the 103331-103531 base of the CHO cell gene NW_003614889.1.

Further, the nucleotide sequence of bases 103331-103531 of the CHO cell gene NW_003614889.1 is shown in SEQ ID NO.1.

Further, when the CRISPR/Cas9 technology is used to site-directly transfer the coding gene of the target protein, the site for stably expressing the protein can be recognized by the 5'NNNNNNNNNNNNNNNNNNNGG 3' sequence of the CRISPR/Cas9 technology.

Further, the 5'NNNNNNNNNNNNNNNNNNNNNNNGG 3' sequence in the embodiment of the present invention selects the following 9 sequences: 5'-ATCTTACTTTGCAACTACCAAGG-3', 5'-CACTTTTATCTAACACTGGCCAGG-3', 5'-AGCAACACTTTTATCTAACACTGG-3', 5'-GCACTCTGTGTGGAGCAAAGAGG-3', 5'-GCAAATGAGTAAAGTTCTCCTGG-3', 5'-TGCAGTGATAGCACTCTGTGTGG-3', 5'-AACAGGATGAAAATGTATGGAGG-3', 5'-TTCATCCTGTTCTCTGTTCTGGG-3', 5'-TTTCATCCTGTTCTCTGTTCTGG- 3'.

In the present invention, the above-mentioned 9 groups of sequences are distributed within the 103331-103531 bases of the CHO cell gene NW_003614889.1 and cover most of the upper, middle and downstream sequences within the 200 bases of the present invention, indicating that the 200 bases of the present invention All bases can be used as sites for stably expressing proteins.

The present invention does not limit the above nine groups of sequences. The above nine groups of sequences are only used as the preferred technical means to introduce the coding gene of the target protein into the stable expression site. The purpose of stably expressing the protein of the present invention can be achieved.

Further, the protein is a protein with a molecular weight less than 160KDa.

Further, the protein is one of polypeptides, functional proteins, antibodies, and fusion proteins.

The second object of the present invention is to provide the application of the stable protein expression sites in the CHO cell genome in the stable expression of foreign proteins in CHO cells.

Further, the application specifically involves constructing a gene encoding an exogenous protein or polypeptide at the site of stably expressing the protein in the CHO cell gene NW_003614889.1.

The third object of the present invention is to provide an expression vector for expressing protein in CHO cells, the coding gene of the protein is located between the 5' homology arm and the 3' homology arm of the expression vector region, the 5' homology arm and the 3' homology arm are sequences with a length of 600 bp upstream and downstream of the stable protein expression site respectively.

In the present invention, the expression vector is a vector suitable for expression in CHO cells.

Further, the expression vector also includes a promoter sequence located upstream of the gene encoding the protein, and the promoter controls the expression of the protein.

Further, the promoters are: CMV (strong mammalian expression promoter derived from human cytomegalovirus), EF-1a (strong mammalian expression promoter derived from human elongation factor 1α), SV40 (simian vacuolar virus 40 derived mammalian expression promoter), PGK1 (mammalian promoter derived from phosphoglycerate kinase gene), UBC (mammalian promoter derived from human ubiquitin C gene), humanbeta actin (β-actin gene derived mammalian promoter), CAG (strong hybrid mammalian promoter), etc.

In the present invention, it also includes a method for constructing an expression vector for expressing a protein in CHO cells, comprising the following steps: inserting the gene encoding the protein into the region between the 5'arm and the 3'arm of the plasmid, making the protein encoding The gene is located downstream of the promoter and is regulated by the promoter to obtain the expression vector for expressing the protein in CHO cells.

The fourth object of the present invention is to provide a CHO recombinant cell with site-specific integration and stable expression of protein. The CHO recombinant cell is obtained by using the expression vector for expressing protein in CHO cells and the sgRNA corresponding to the target sequence. Plasmids and Cas9 plasmids were transformed into CHO cells.

Further, the target sequence is preferably 5'-ATCTTACTTTGCAACTACCAAGG-3', 5'-CACTTTTATCTAACACTGGCCAGG-3', 5'-AGCAACACTTTTATCTAACACTGG-3', 5'-GCACTCTGTGTGGAGCAAAGAGG-3', 5'-GCAAATGAGTAAAGTTCTCCTGG-3', 5'-TGCAGTGATAGCACTCTGTGTGG-3', 5'-AACAGGATGAAAATGTATGGAGG-3', 5'-TTCATCCTGTTCTCTGTTCTGGG-3' or 5'-TTTCATCCTGTTCTCTGTTCTGG-3'.

In the present invention, a method for constructing CHO recombinant cells is also provided, comprising the steps of:

(1) Transfect the plasmid vector into CHO cells by liposome transfection to obtain a recombinant CHO cell pool;

Wherein, the plasmids are respectively the expression vector for expressing protein in CHO cells, the sgRNA plasmid and the Cas9 plasmid corresponding to the target sequence;

(2) screening the recombinant cell pool to obtain CHO recombinant cells expressing foreign proteins;

(3) Adhesive culture of CHO recombinant cells, detection of protein expression levels, and suspension acclimatization of highly expressed adherent CHO recombinant cells;

(4) Suspension and acclimatization of CHO recombinant cells for culture and stability verification, and detection of protein expression levels.

The beneficial effects of the present invention are:

The stable expression site obtained by the present invention is located within 100 bp upstream and downstream of base 103431 of CHO cell gene NW_003614889.1, that is, base 103331-103531, and can integrate foreign protein genes and perform stable expression. The present invention integrates the target gene into the stable expression region through fixed-point integration, which solves the problem of unclear integration sites caused by random integration; the present invention uses base 103431 of the stable expression site NW_003614889.1 in the CHO genome The site-specific integration of exogenous genes within the range of 103331-103531 bases upstream and downstream of the base overcomes the expression instability caused by the position effect and the repeated and tedious cell line screening process, reducing the original screening time of 6-12 months to 1-3 months, effectively shortening the R&D time for constructing stable expression cell lines and reducing costs.

Description of drawings:

Fig. 1 is a schematic diagram of fixed-point integration of the present invention;

Figure 2 shows the expression of EGFP at different passages in cells constructed with different target sequences.

Figure 3 shows the expression of anti-EGFR at different passages in cells constructed with different target sequences.

Detailed ways

The present invention will be further described below in conjunction with specific examples, so that those skilled in the art can better understand the present invention and implement it, but the given examples are not intended to limit the present invention.

Involved detection methods:

The method for measuring the average fluorescence intensity of cells: culture the cells until the confluence reaches about 90%, digest the cells with 0.25% trypsin, and terminate the digestion with a complete medium equal to the amount of trypsin, and collect the cells in a sterile centrifuge tube at 1000rpm/ Centrifuge for 5 min, discard the supernatant and resuspend with PBS, pass through a cell strainer and collect in a flow loading tube, and use a blank CHO-K1 cell as a control to analyze the fluorescence intensity of the cells with a flow cytometer.

Example 1: Screening of stable expression sites

The CHO-K1-2d9 cells expressing the Zsgreen1 reporter gene screened by high-throughput flow cytometry were cultured in an adherent culture until they were in good condition, and the CHO cells at this time were regarded as the 0th generation, and then cultured continuously for 20 days. The expression of Zsgreen1 protein in cells at passages 0, 10, and 20 was observed under an inverted fluorescence microscope, and the average fluorescence intensity of cells at passages 0, 10, and 20 was detected by BD flow cytometry.

Observation by inverted fluorescence microscope and detection by flow cytometry showed that after 20 passages, CHO-K1-2d9 cells could still express 100% Zsgreen1 protein in the adherent culture state, and Zsgreen1 protein between different passages The expression levels are basically the same, and there is a strong green fluorescent signal.

The CHO-K1-2d9 cells that passed the verification of anchorage stability were subjected to suspension acclimation, and the CHO-K1-2d9 cells that were successfully acclimatized in suspension were continuously passaged for 60 passages, and the success of acclimation in suspension was regarded as the 0th passage. The expression of Zsgreen1 protein in the cells at passages 0, 10, 20, 30, 40, 50, and 60 was observed under an inverted fluorescence microscope, and at the same time, the cells at passages 0, 10, 20, 30, 40, and 50 were detected by flow cytometry. Mean fluorescence intensity of cells at passage 60.

Observation by inverted fluorescence microscope and detection by flow cytometry showed that after 60 passages, CHO-K1-2d9 cells could still express 100% Zsgreen1 protein in suspension culture state, and Zsgreen1 protein expression between different passages The levels are basically the same, and there is a strong green fluorescent signal. It shows that CHO-K1-2d9 cells can stably express the Zsgreen1 reporter gene, and at the same time, it shows that the integrated site of the lentivirus carrying the Zsgreen1 reporter gene is a stable expression site.

Example 2: Analysis of Lentiviral Integration Sites

Use the Lenti-X Integration Site Analysis Kit (Clontech: 631263) related to chromosome walking technology to analyze the integration site of the lentiviral vector in CHO-K1-2d9 cells. The specific steps are as follows:

(1), construction of lentiviral integration library

Collect CHO-K1-2d9 cells, use the DNA extraction kit to extract the genome, use DraI, SspI, HpaI three restriction endonucleases to digest the genome at 37°C for 16-18h, and the digestion system is as follows:

The digested product was purified and recovered using a PCR purification kit, and the chromosome walking adapter GenomeWalker Adaptor was connected to both ends of the purified digested fragment. The connection system was as follows:

Incubate overnight at 16°C and incubate at 70°C for 5 minutes. After terminating the reaction, add 32 μl TE (10/1, pH 7.5) to the system to obtain three lentiviral integration libraries.

(2), PCR amplification of lentiviral integration library

Two rounds of nested PCR were respectively performed on the three lentiviral integration libraries obtained in step (1) of Example 2. Using the adapter primers AP1 and AP2 of the walking adapter connected in the step (1) of Example 2, and the lentiviral sequence-specific primers LSP1 and LSP2, the LTR region and the adjacent CHO-K1 cell genome region were amplified

A round of PCR reaction system is as follows:

The reaction procedure is as follows:

Take 1 μl of a round of PCR product and dilute to 50 μl with deionized H2O.

The second round of PCR reaction system is as follows:

The reaction procedure is as follows:

(3), sequencing and analysis

The second round of PCR products were subjected to agarose gel electrophoresis and gel recovery sequencing, and the sequencing was performed according to the kit Lenti-X Integration Site Analysis Kit (Clontech: 631263). The lentivirus integration site information can be obtained by comparing the sequencing results with the CHO cell genome on NCBI. The lentivirus integration site in CHO-K1-2d9 cells is located at base 103431 of the CHO cell genome NW_003614889.1.

Example 3: Target Sequence Selection

According to the principle of proximity, use the CCTOP CRISPR/Cas9 online prediction system to align the sequence of 100 bp upstream and downstream at base 103431 of NW_003614889.1: TGCAGTGATAGCACTCTGTGTGGAGCAAAGAGGAAGAGATGGAGCAACACTTTTATCTAACACTGGCCAGGAGAACTTTACTCATTTGCTATCTTACTTTGCAACTACCAAGGTCTCTCTT GTTTTCTGTTTTTCTCACGTAGTCTACTTGAGTGAGTCATAGTTAACCTCCATACATTTTCATCCTGTTCTCTGTTCTGGG (SEQ ID NO.1) is predicted and the target with higher editing efficiency is selected sequence.

The relevant parameters are set as follows:

1) The maximum number of base mismatches allowed in the first 13 bp within the 20 bp sequence after NGG is 1;

2) The number of all 20bp mismatched bases after NGG is 4.

The CCTOP CRISPR/Cas9 online prediction system will score the editing efficiency of the identified 5'NNNNNNNNNNNNNNNNNNNNNGG 3' target sequence, LOW efficiency(score<0.56); MEDIUM efficiency(0.56<=s core<=0.74); HIGH efficiency(score> 0.74).

Sequences in which the predicted editing efficiency was higher than 0.56 were selected as target sequences.

Target sequence 5'-ATCTTACTTTGCAACTACCAAGG-3'(SEQ ID NO.2), score=0.65

Target sequence 5'-CACTTTATCTAACACTGGCCAGG-3'(SEQ ID NO.3), score=0.62

Target sequence 5'-AGCAACACTTTTATCTAACACTGG-3'(SEQ ID NO.4), score=0.59

Target sequence 5'-GCACTCTGTGTGGAGCAAAGAGG-3'(SEQ ID NO.5), score=0.83

Target sequence 5'-GCAAATGAGTAAAGTTCTCCTGG-3'(SEQ ID NO.6), score=0.57

Target sequence 5'-TGCAGTGATAGCACTCTGTGTGG-3'(SEQ ID NO.7), score=0.68

Target sequence 5'-AACAGGATGAAAATGTATGGAGG-3'(SEQ ID NO.8), score=0.77

Target sequence 5'-TTCATCCTGTTCTCTGTTCTGGG-3'(SEQ ID NO.9), score=0.66

Target sequence 5'-TTTCATCCTGTTCTCTGTTCTGG-3'(SEQ ID NO.10), score=0.69

Example 4: Fixed-point integration of EGFP

Using CRISPR/Cas9-mediated genome editing technology and homologous recombination, the green fluorescent protein gene (EGFP, 26.7KDa) will be integrated at the target site. CRISPR/Cas9-mediated homologous recombination technology needs to construct sgRNA plasmid and Donor Plasmid, the construction process is as follows:

1. sgRNA plasmid construction

1), according to the target sequence selected in embodiment 3, synthetic oligonucleotide chain

sgRNA-F1 5'TTTGATCTTACTTTGCAACTACCAGT 3'(SEQ ID NO.11)

sgRNA-R1 5'TAAAACCCTTGGTAGTTGCAAAGTAAGAT 3'(SEQ ID NO.12)

sgRNA-F2 5'TTTGCACTTTTATCTAACACTGGCCGT 3'(SEQ ID NO.13)

sgRNA-R2 5'TAAAACCCTGGCCAGTGTTAGATAAAGTG 3'(SEQ ID NO.14)

sgRNA-F3 5'TTTGAGCAACACTTTTATCTAACACGT 3'(SEQ ID NO.15)

sgRNA-R3 5'TAAAACCCAGTGTTAGATAAAGTGTTGCT 3'(SEQ ID NO.16)

sgRNA-F4 5'TTTGGCACTCTGTGTGGAGCAAAGGT 3'(SEQ ID NO.17)

sgRNA-R4 5'TAAAACCCCTCTTTGCTCCACACAGAGTGC 3'(SEQ ID NO.18)

sgRNA-F5 5'TTTGGCAAATGAGTAAAGTTCTCCGT 3' (SEQ ID NO.19)

sgRNA-R5 5'TAAAACCCAGGAGAACTTTACTCATTTGC 3'(SEQ ID NO.20)

sgRNA-F6 5'TTTGTGCAGTGATAGCACTCTGTGGT 3'(SEQ ID NO.21)

sgRNA-R6 5'TAAAACCCACACAGAGTGCTATCACTGCA 3'(SEQ ID NO.22)

sgRNA-F7 5'TTTGAACAGGATGAAAATGTATGGGT 3' (SEQ ID NO.23)

sgRNA-R7 5'TAAAACCCTCCATACATTTTCATCCTGTT 3'(SEQ ID NO.24)

sgRNA-F8 5'TTTGTTCATCCTGTTCTCTGTTCTGT 3' (SEQ ID NO.25)

sgRNA-R8 5'TAAAACCCCAGAACAGAGAACAGGATGAA 3'(SEQ ID NO.26)

sgRNA-F9 5'TTTGTTTCATCCCTGTTCTCTGTTCGT 3' (SEQ ID NO.27)

sgRNA-R9 5'TAAAACCCAGAACAGAGAACAGGATGAAA 3'(SEQ ID NO.28)

2), annealing the synthesized oligonucleotide chains (1-9 pairs) respectively

Metal bath at 95°C for 5 minutes, then naturally lower to room temperature;

3), the PSK-u6-gRNA plasmid is digested with BBsI enzyme, and the vector after digestion is gel recovered;

4), Ligate the recovered plasmid vector with the annealed oligonucleotide chain

Ligate at 22°C for 1 hour or overnight at 4°C;

5), transformed into DH5α competent;

6), select positive clones and use universal primer M13fwd for sequencing;

7) Expand and cultivate positive cloned strains and extract plasmids.

2. Construction of Donor plasma: The information of Donor plasma is shown in Figure 1, which was obtained by transforming the existing plasmid vector expressing EGFP. 5'arm and 3'arm are the upstream and downstream homology arms of the target sites recognized by each pair of sgRNAs, with a length of 600bp, and GOI is the integrated target gene.

1) Through primer design and PCR amplification, the 5'arm and 3'arm with a length of 600 bp upstream and downstream of the homologous fragment of the plasmid were obtained;

2), using double enzyme digestion and gel recovery to remove the original homology arm of Donor plasmamid;

3) Connect the 5'arm and 3'arm corresponding to the target site by means of homologous recombination;

4) The EGFP sequence of the target gene is carried by the original plasmid.

3. Co-transfect the constructed sgRNA plasmid, Donor plasmid and Cas9-DTU plasmid (donated by Dr.Helene F Kildegaard, Technical University of Denmark) with Lipofectamine 3000 transfection reagent at a mass ratio of 1.8:1.8:1 at 37°C, 5% CHO-K1 cells cultured under CO2 conditions, and a blank control group was set at the same time. After 24 hours of transfection, 10 μg/ml puromycin was used to perform pressure selection until all the cells in the control group died, and the cell pool after screening was expanded, and the cells that only emitted green fluorescence and did not emit red fluorescence were sorted out by BD flow cytometry. Clone cells.

4. After expanding the cloned cell line, take a part to extract the genome, and identify it by 5'junction PCR, 3'Junction PCR and out-out PCR, as shown in Figure 1.

5. Keep the positive clonal cell lines.

Example 5: fixed-point integration of anti-EGFR

Using CRISPR/Cas9-mediated genome site-directed editing technology and homologous homology, the humanized antibody gene (anti-EGFR, 150KDa) expressing epidermal growth factor receptor was site-directedly integrated at the target site. CRISPR/Cas9-mediated homologous recombination technology needs to construct sgRNA plasmid and Donor Plasmid, the construction process is as follows:

1. sgRNA plasmid construction:

1), according to the target sequence selected in embodiment 3, synthetic oligonucleotide chain

sgRNA-F1 5'TTTGATCTTACTTTGCAACTACCAGT 3'

sgRNA-R1 5'TAAAACCCTTGGTAGTTGCAAAGTAAGAT 3'

sgRNA-F2 5'TTTGCACTTTTATCTAACACTGGCCGT 3'

sgRNA-R2 5'TAAAACCCTGGCCAGTGTTAGATAAAGTG 3'

sgRNA-F3 5'TTTGAGCAACACTTTTATCTAACACGT 3'

sgRNA-R3 5'TAAAACCCAGTGTTAGATAAAGTGTTGCT 3'

sgRNA-F4 5'TTTGGCACTCTGTGTGGAGCAAAGGT 3'

sgRNA-R4 5'TAAAACCCCTCTTTGCTCCACACAGAGTGC 3'

sgRNA-F5 5'TTTGGCAAATGAGTAAAGTTCTCCGT 3'

sgRNA-R5 5'TAAAACCCAGGAGAACTTTACTCATTTGC 3'

sgRNA-F6 5'TTTGTGCAGTGATAGCACTCTGTGGT 3'

sgRNA-R6 5'TAAAACCCACACAGAGTGCTATCACTGCA 3'

sgRNA-F7 5'TTTGAACAGGATGAAAATGTATGGGT 3'

sgRNA-R7 5'TAAAACCCTCCATACATTTTCATCCTGTT 3'

sgRNA-F8 5' TTTGTTCATCCTGTTCTCTGTTCTGT 3'

sgRNA-R8 5'TAAAACCCCAGAACAGAGAACAGGATGAA 3'

sgRNA-F9 5'TTTGTTTCATCCCTGTTCTCTGTTCGT 3'

sgRNA-R9 5'TAAAACCCAGAACAGAGAACAGGATGAAA 3

2), annealing the synthesized oligonucleotide chains (1-9 pairs) respectively

Metal bath at 95°C for 5 minutes, then naturally lower to room temperature;

3), the PSK-u6-gRNA plasmid is digested with BBsI enzyme, and the vector after digestion is gel recovered;

4), Ligate the recovered plasmid vector with the annealed oligonucleotide chain

Ligate at 22°C for 1 hour or overnight at 4°C;

5), transformed into DH5α competent;

6), select positive clones and use universal primer M13fwd for sequencing;

7), expanding positive clones and extracting plasmids;

2. Donor plasma construction: Donor plasma information is shown in Figure 1. 5'arm and 3'arm are the upstream and downstream homology arms of the target site, respectively, with a length of 600bp, and GOI is the integrated target gene.

1) Through primer design and PCR amplification, the 5'arm and 3'arm with a length of 600 bp upstream and downstream of the homologous fragment of the plasmid were obtained;

2), using double enzyme digestion and gel recovery to remove the original homology arm of Donor plasmamid;

3) Connect the 5'arm and 3'arm corresponding to the target site by means of homologous recombination;

4) Obtain the target gene anti-EGFR by PCR amplification, and connect it to the plasmid vector by restriction restriction linking.

3. Co-transfect the constructed sgRNA plasmid, Donor plasmid and Cas9-DTU plasmid (donated by Dr. Helene F Kildegaard, Technical University of Denmark) with Lipofectamine 3000 transfection reagent at a mass ratio of 1.8:1.8:1 at 37°C, 5% CHO-K1 cells cultured under CO ₂ conditions, and a blank control group was set at the same time. After 24 hours of transfection, 10 μg/ml puromycin was used for pressure selection until all cells in the control group died, and the cell pool after screening was expanded, and monoclonal cells without any fluorescence were sorted out by BD flow cytometry.

4. After expanding the cloned cell line, take a part to extract the genome, and identify it by 5'junction PCR, 3'Junction PCR and out-out PCR, as shown in Figure 1.

5. Keep the positive clonal cell lines.

Test case:

1. Detect the green fluorescence intensity of the cell line constructed in Example 4 with a BD flow cytometer

Detection method: the cell lines obtained in Example 4 were continuously passaged for 60 passages, and the cells were collected for 15 passages per passage, and the cell fluorescence was detected with a flow cytometer and the intensity was detected, as shown in Figure 2. In 4, more than 98% of the cells constructed according to different target sequences still expressed green fluorescent protein after 60 consecutive passages, and the fluctuation range of green fluorescence intensity between the 0th passage and the 60th passage was not more than 30%.

2. ELISA kit to detect the expression of EGFR antibody

Detection method: The cell line obtained in Example 5 was continuously passaged for 60 generations under serum-free culture conditions, and the cell fermentation supernatant of this generation was collected every 15 generations, and the anti-EGFR content in the fermentation broth was detected by ELISA kit , the analysis of the detection results showed that the cells constructed according to different target sequences in Example 5 had a stable ability to express anti-EGFR at different passages, as shown in FIG. 3 .

The 9 sets of target sequences screened in Example 3 of the present invention cover most of the upper, middle and downstream sequences within the 200 bp base of the present invention, and the 103331-103531 base range in the CHO cell gene NW_003614889.1 of the present invention is all A stable expression cell line with site-specific integration can be successfully constructed, and all of them can stably express the target protein.

The above-mentioned embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be determined by the claims.

Claims (10)

1. A site for stably expressing protein in CHO cell gene NW_003614889.1, characterized in that the site for stably expressing protein is located within base 103331-103531 of CHO cell gene NW_003614889.1.
2. According to the site of stably expressing protein in the CHO cell gene NW_003614889.1 according to claim 1, it is characterized in that, the nucleotide sequence of the 103331-103531 base of the CHO cell gene NW_003614889.1 is as SEQ ID NO .1 shown.
3. According to the site of stably expressing protein in CHO cell gene NW_003614889.1 according to claim 1, it is characterized in that, the site of stably expressing protein can be recognized by CRISPR/Cas9 technology with 5'NNNNNNNNNNNNNNNNNNNNNNNGG 3' as the target sequence .
4. The site for stably expressing protein in the CHO cell gene NW_003614889.1 according to claim 1, wherein the protein is a protein or polypeptide with a molecular weight less than 160KDa.
5. The application of the stable expression protein site in the CHO cell gene NW_003614889.1 described in any one of claims 1 to 4 in the stable expression of foreign proteins or polypeptides in CHO cells.
6. The application according to claim 5, characterized in that, the application is specifically constructing the gene encoding the exogenous protein or polypeptide at the site of stably expressing the protein in the CHO cell gene NW_003614889.1.
7. An expression vector for expressing proteins in CHO cells, characterized in that the coding gene of the protein is located in the region between the 5' homology arm and the 3' homology arm of the expression vector, and the The 5' homology arm and the 3' homology arm are sequences with a length of 600 bp upstream and downstream of the site of stably expressing the protein according to claim 1, respectively.
8. The expression vector according to claim 7, characterized in that, the expression vector further comprises a promoter sequence located upstream of the gene encoding the protein, and the promoter controls the expression of the protein.
9. The expression vector according to claim 8, wherein the promoters are: a strong mammalian expression promoter derived from human cytomegalovirus, a strong mammalian expression promoter derived from human elongation factor 1α, and a simian vacuolar Mammalian expression promoter derived from virus 40, mammalian promoter derived from phosphoglycerate kinase gene, mammalian promoter derived from human ubiquitin C gene, mammalian promoter derived from β-actin gene, strong hybridization One of the mammalian promoters.
10. A CHO recombinant cell for site-specific integration and expression of protein, characterized in that, the CHO recombinant cell is characterized in that the expression vector for expressing protein in CHO cells according to claim 7, the sgRNA plasmid corresponding to the target sequence and the Cas9 plasmid obtained by transferring into CHO cells.

Images