CN112175984A - Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism - Google Patents
Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism Download PDFInfo
- Publication number
- CN112175984A CN112175984A CN202010983909.9A CN202010983909A CN112175984A CN 112175984 A CN112175984 A CN 112175984A CN 202010983909 A CN202010983909 A CN 202010983909A CN 112175984 A CN112175984 A CN 112175984A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- sequence
- plasmid
- modified
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
Abstract
The application provides a molecular cloning method combining gene synthesis and a saccharomyces cerevisiae endogenous homologous recombination system, which is not limited by the type (deletion, mutation or insertion) and complexity of sequence change, only relates to simple in vitro molecular cloning operation, realizes seamless modification of an original vector by utilizing a synthetic sequence with homologous arms at two ends and yeast homologous recombination, can realize synchronous transformation of a plurality of discontinuous DNA segments on a shuttle plasmid of 4-150kbp and batch construction of a plurality of versions, is simple to operate, has higher construction efficiency and higher construction power, and is suitable for multi-version and high-flux seamless cloning operation.
Description
Technical Field
The application belongs to the technical field of molecular cloning, and particularly relates to a molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism.
Background
With the development of technology, the manipulation ability of DNA is gradually improved, and the demand for efficient molecular cloning of plasmids of different sizes is more diversified. With the development of sequencing and DNA synthesis technologies, the ability of researchers to manipulate DNA is greatly enhanced. In the field of gene synthesis, researchers have now successfully chemically synthesized the genomes of viruses and prokaryotes, as well as portions of the chromosomes of the eukaryotic organism Saccharomyces cerevisiae. In 2016, the genome compilation plan (GP-Write) initiates the research of disassembly, reassembly and analysis of oversized and complex genomes to explore the scientific problem which is difficult to research by the traditional method. In the field of metabolic engineering, the total synthesis of natural compounds with important physiological activities and medical health care functions by using microorganisms has become a world research hotspot, and the construction and assembly of complex metabolic pathways are required. In these fields, researchers often need to manipulate large amounts of sequences longer than 10kbp, with the demand for the use of shuttle plasmids (yeast CEN-E.coli) of 10-150kbp increasing. However, due to the sequence length, the fixed-point modification of this kind of plasmids has certain difficulty, and it is difficult to implement the simultaneous deep reconstruction of the upper segments, not to mention the simultaneous construction of multiple reconstructed versions.
Molecular cloning technology, as a core technology of modern biology, is widely applied to various fields such as synthetic biology, protein purification, biopharmaceuticals and the like, and the following methods are currently applied to the modification of gene fragments, including: (1) the traditional cloning method of restriction enzyme comprises two different methods, one is that restriction enzyme is used for specifically recognizing the target DNA and the enzyme cutting site on the vector and cutting, then the target plasmid is obtained by connecting the two together through ligase, which is also called as a recombinant vector, but the method often occurs in the situation that no available enzyme cutting site exists at the position needing to be operated; and in addition, a new enzyme cutting site is artificially introduced, a base fragment of 6-8bp of the enzyme cutting site is added between two fragments connected by adopting the method, and the scar sequence can influence the target DNA fragment and cannot realize seamless splicing. (2) The Golden Gate method is established, the characteristic that the cutting sites of IIs type restriction endonuclease are separated from the recognition sequence is utilized, and through reasonable design, the target sequence for splicing multiple fragments does not contain corresponding cutting sites, so that seamless splicing of the multiple fragments is realized. A Gibson assembly method is established, the method is also suitable for seamless splicing of a plurality of linear DNA fragments, short overlapping sequences of about 20-80bp are added to the DNA fragments adjacent in sequence, and meanwhile, one-step assembly of the plurality of DNA fragments is realized by using exonuclease, polymerase and DNA ligase. However, when the number of fragments is increased and the length of the fragments is increased, the efficiency of correct splicing in the two ways is greatly reduced. The Golden Gate method is even less applicable if there are multiple cleavage sites for the type IIs enzyme used within the fragment. In addition, when the shuttle plasmid of 10-150kbp is subjected to multi-site sequence modification by the two methods, modified fragments need to be amplified by primers and enzyme cutting sites or homologous arms are introduced. Sequence amplification is susceptible to sequence length, GC content, and sequence duplication, and for longer DNA fragments, e.g., greater than 10kbp, unintended mutations can easily occur within the sequence. (3) A combined method of a CRISPR/Cas9 system and Gibson assembly is established, a 22kbp plasmid is cut in vitro by using the CRISPR/Cas9 system, an insert fragment is amplified by PCR, a homologous sequence is added, and the insertion of a 783bp DNA fragment at any site on a 22kbp plasmid vector is realized by Gibson assembly. (4) A molecular cloning method based on CRISPR/Cas9 and saccharomyces cerevisiae cell endogenous homologous recombination is established, the method realizes one or more cutting of an initial vector in vitro by designing a specific target gRNA and utilizing a CRISPR/Cas9 system, the recovered initial vector and a replaced DNA sequence with a homologous sequence at a gap are transformed into yeast together to realize the construction of a plasmid, and one-time transformation screening operation is carried out to complete the insertion or deletion of one or more target DNA fragments. The above methods allow molecular cloning, but there are several major limitations: firstly, a gRNA expression vector specifically targeting a site to be modified needs to be designed and constructed, and the more modification sites are, the more the number of gRNA vectors is required; secondly, corresponding reagents are purchased or self-prepared for in vitro transcription of sgRNA and in vitro cleavage of Cas 9; thirdly, the success rate of cloning is limited by the specificity of gRNA and the efficiency of an in vitro cutting system; and fourthly, when the plasmid needs to be modified at multiple positions, each version needs to directionally prepare a plurality of sequence fragments with homologous arms, so that the method is relatively complex and difficult to generate multi-version combined mutation at the same time. At present, a universal molecular cloning strategy which can efficiently realize synchronous seamless modification of a plurality of discontinuous DNA segments on a mesoscale plasmid and simultaneously construct a plurality of deeply modified versions is still lacked in the field aiming at a shuttle plasmid (yeast-escherichia coli) of 10-150 kbp.
Disclosure of Invention
The application aims to provide a molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, and aims to solve the problem that a general and efficient molecular cloning strategy for synchronously and seamlessly transforming a single or a plurality of discontinuous DNA segments is lacked for a large shuttle plasmid in the prior art.
In order to achieve the purpose of the application, the technical scheme adopted by the application is as follows:
in a first aspect, the present application provides a molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, comprising the following steps:
providing a vector to be modified, carrying out sequence comparison on the vector to be modified, and determining a modified region of the vector to be modified and a marker gene for replacing the modified region;
designing a first homology arm primer sequence of the marker gene and amplifying to obtain the marker gene, co-transforming the marker gene segment and the vector to be modified to wild type saccharomyces cerevisiae cells, and screening to obtain saccharomyces cerevisiae cells containing a first plasmid precursor, wherein the first plasmid precursor comprises the marker gene;
and synthesizing a donor sequence with a homology arm, carrying out linearization treatment to obtain a linearized donor sequence, transforming the linearized donor sequence into the saccharomyces cerevisiae cell containing the first plasmid precursor, and screening to obtain the target saccharomyces cerevisiae cell containing the donor sequence plasmid.
In a second aspect, the present application provides a molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, the molecular cloning method comprising the steps of:
providing a vector to be modified, carrying out sequence comparison on the vector to be modified, and determining a modified region of the vector to be modified and a marker gene for replacing the modified region;
designing a second homologous arm primer sequence of the marker gene and amplifying to obtain a marker gene segment, co-transforming the marker gene segment and the vector to be modified to wild saccharomyces cerevisiae cells, screening to obtain saccharomyces cerevisiae cells containing a second plasmid precursor, extracting the second plasmid precursor and carrying out enrichment treatment, wherein the second plasmid precursor comprises the marker gene and a second restriction endonuclease recognition site;
synthesizing a donor sequence with a homology arm, and respectively carrying out linearization treatment on the donor sequence and the second plasmid precursor to obtain a linearized donor sequence and a linearized second plasmid precursor;
and co-transforming the linearized donor sequence and the linearized second plasmid precursor into wild saccharomyces cerevisiae cells, and screening to obtain the target saccharomyces cerevisiae cells containing donor sequence plasmids.
The molecular cloning method provided by the first aspect of the application utilizes a homologous recombination mechanism of a synthetic gene and saccharomyces cerevisiae, positions a modification region of a vector to be modified, designs a pair of primers with homologous arms for amplifying a marker gene, then utilizes the endogenous homologous recombination mechanism of the saccharomyces cerevisiae to carry out efficient directional substitution on any region to be modified by a marker gene fragment, obtains a saccharomyces cerevisiae cell containing a plasmid precursor, realizes the positioning of DNA modification, further utilizes a gene synthesis technology to generate a donor sequence with the homologous arms, directly transforms the synthetic fragment into the saccharomyces cerevisiae cell containing the plasmid precursor, utilizes a linearized synthetic fragment and the homologous recombination mechanism of the yeast to realize seamless repair of the corresponding region, obtains a target saccharomyces cerevisiae cell containing the donor sequence plasmid, and can combine multiple modification sites into one modification region, the insertion substitution of the marker gene is carried out at any position of the vector to be modified, and the plasmid precursor is quickly and efficiently obtained; donor sequences are provided by combining a gene synthesis technology, seamless substitution of the donor sequences for marker genes is realized by homologous recombination of the synthetic sequences with homologous arms at two ends and yeast, modification of any type (deletion, mutation or insertion) of an original vector is realized, and other targeting vectors do not need to be additionally constructed; the synchronous transformation of a plurality of discontinuous DNA segments on the shuttle plasmid and the batch construction of various versions can be realized simply and efficiently.
The molecular cloning method provided by the second aspect of the application utilizes a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, positions a modification region of a vector to be modified, provides a primer sequence containing a homologous arm for amplification to obtain a marker gene fragment, carries out efficient directional substitution on any region to be modified by the marker gene fragment, screens to obtain a plasmid precursor comprising the marker gene and a second restriction enzyme recognition site, introduces the restriction enzyme recognition site into the plasmid precursor by utilizing the saccharomyces cerevisiae endogenous homologous recombination mechanism, and in a subsequent test, only needs to adopt the restriction enzyme to carry out in-vitro enzyme digestion and yeast transformation to realize plasmid construction, the operation is very simple, and a kit for in-vitro transcription of sgRNA and in-vitro cutting of Cas9 is not needed; meanwhile, the plasmid precursors are enriched to obtain a large amount of plasmid precursors, which is beneficial to the subsequent enzyme digestion treatment; further utilizing gene synthesis technology to provide donor sequences with homologous arms, utilizing an enzyme digestion method to respectively carry out in vitro linearization treatment on the donor sequences and plasmid precursors obtained by enrichment, co-transferring the donor sequences and the plasmid precursors into saccharomyces cerevisiae cells, utilizing in vitro linearization of the plasmid precursors and the donor sequences and yeast homologous recombination to realize seamless modification of any types of vector sequences to be modified, and efficiently and seamlessly constructing multi-version plasmids containing the donor sequences in batches, wherein the plasmid precursors obtained by construction are enriched and then subjected to linearization treatment, so that the false positive rate during construction of target plasmids can be reduced, and the construction power of the target plasmids containing the donor sequences can be improved. The molecular cloning method combines a plurality of modification sites into modification regions, only needs to carry out in-vitro enzyme digestion on a plasmid precursor and a synthesized donor fragment which comprise a marker gene fragment and a restriction enzyme recognition site replacing the modification regions during fragment preparation by using restriction enzymes, and then carries out cotransformation into wine brewing cells, has very simple operation, higher construction efficiency and higher construction power, and is suitable for multi-version and high-flux seamless cloning operation.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a schematic and schematic flow chart of a method for molecular cloning according to example 1 of the present application.
FIG. 2 is a proto-vector map of pJS379 provided in example 1 of the present application.
FIG. 3 is a colony PCR result of positive clones of the first plasmid precursor as provided in example 1 of the present application.
FIG. 4 shows the PCR results of the donor sequences provided in example 1 of the present application.
FIG. 5 is the colony PCR validation results of the transformants provided in example 1 of the present application.
FIG. 6 is a high fidelity DNA polymerase PCR result of positive transformants as provided in example 1 of the present application.
FIG. 7 shows the sequencing results of the high fidelity DNA polymerase PCR amplification products of the positive transformants provided in example 1 of the present application.
FIG. 8 is a schematic and schematic flow chart of a method for molecular cloning according to example 2 of the present application.
FIG. 9 is a proto-vector map of pJS380 provided in example 2 of the present application.
FIG. 10 shows the results of colony PCR validation of yeast transformants which may contain a second plasmid precursor as provided in example 2 of the present application.
FIG. 11 shows the alignment results of the region to be modified S4, the URA3 fragment of marker gene, the SG016 donor sequence, SG017 donor sequence, S4-v1 modified (plasmid containing SG016 donor sequence), S4-v2 modified (plasmid containing SG017 donor sequence) provided in example 2 of the present application.
FIG. 12 shows the result of linearization of the second plasmid precursor, donor sequence SG016 and donor sequence SG017 provided in example 2 of the present application.
FIG. 13 is a colony PCR validation of yeast transformants of modified S4-v1 (which may contain the donor sequence plasmid of SG 016) as provided in example 2 of the present application.
FIG. 14 is a colony PCR validation of yeast transformants which were modified from S4-v2 (which may contain the plasmid SG017 donor sequence) as provided in example 2 of the present application.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects to be solved by the present application more clearly apparent, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.
It should be understood that, in various embodiments of the present application, the sequence numbers of the above-mentioned processes do not mean the execution sequence, some or all of the steps may be executed in parallel or executed sequentially, and the execution sequence of each process should be determined by its function and inherent logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.
The terminology used in the embodiments of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in the examples of this application and the appended claims, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.
The first aspect of the embodiments of the present application provides a molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, the molecular cloning method comprising the following steps:
s01, providing a carrier to be modified, carrying out sequence comparison on the carrier to be modified, and determining a modification area of the carrier to be modified and a marker gene of a replacement modification area;
s02, designing a first homology arm primer sequence of a marker gene and amplifying to obtain a marker gene segment, co-transforming the marker gene segment and a vector to be modified to a wild type saccharomyces cerevisiae cell, and screening to obtain a saccharomyces cerevisiae cell containing a first plasmid precursor, wherein the first plasmid precursor comprises the marker gene;
s03, synthesizing a donor sequence with a homology arm, carrying out linearization treatment to obtain a linearized donor sequence, transforming the linearized donor sequence into a saccharomyces cerevisiae cell containing a first plasmid precursor, and screening to obtain a target saccharomyces cerevisiae cell containing a donor sequence plasmid.
The invention provides a molecular cloning method combining gene synthesis and a saccharomyces cerevisiae endogenous homologous recombination system, which is not limited by the type (deletion, mutation or insertion) and complexity of sequence change, only relates to simple in vitro molecular cloning operation, realizes seamless modification of an original vector by utilizing a synthetic sequence with homologous arms at two ends and yeast homologous recombination, and can realize synchronous transformation of a plurality of discontinuous DNA segments on a shuttle plasmid of 4-150kbp and batch construction of a plurality of versions.
Specifically, in step S01, a vector to be modified is provided, the vector to be modified is subjected to sequence alignment, and a modified region of the vector to be modified and a marker gene that replaces the modified region are determined.
The vector to be modified is a vector in which deletion, mutation or insertion of a desired fragment can be performed. Preferably, the vector to be modified is selected from shuttle vectors of escherichia coli and saccharomyces cerevisiae, so that the vector can be subjected to a shuttle test in the molecular cloning method, replication in saccharomyces cerevisiae cells can be ensured to enrich the vector, and massive replication in escherichia coli can be realized to enrich the vector.
Further preferably, the vector to be modified is also shuttled for use in other cells. In some embodiments, the vector to be modified includes, but is not limited to, a shuttle vector of escherichia coli-saccharomyces cerevisiae-streptomyces, a shuttle vector of escherichia coli-saccharomyces cerevisiae-bacillus subtilis, a shuttle vector of escherichia coli-saccharomyces cerevisiae-corynebacterium glutamicum, a shuttle vector of escherichia coli-saccharomyces cerevisiae-filamentous fungi, a shuttle vector of escherichia coli-saccharomyces cerevisiae-mammalian cells, and a shuttle vector of escherichia coli-saccharomyces cerevisiae-plant cells.
In some embodiments, the vector to be modified is selected from a circular plasmid vector.
In some embodiments, the vector to be modified includes, but is not limited to, an empty vector or a recombinant vector carrying the gene of interest. The provided molecular cloning method is suitable for the modification of various types of vectors, can be used for modifying fragments of certain marker genes in empty vectors, and can also be used for modifying marker genes of recombinant vectors carrying target genes or target genes, and is simple and efficient.
Preferably, the number of bases of the vector to be modified is 4-150kbp, and the molecular cloning method provided by the application is suitable for modifying shuttle plasmids with the number of bases of 4-150 kbp.
Furthermore, the sequence of the vector to be modified is compared, and the modified region of the vector to be modified and the marker gene of the replacement modified region are determined. Comparing the provided vector to be modified with the existing sequence to determine a modification area of the vector to be modified; and providing a marker gene replacing the modified region.
In some embodiments, the modified region includes, but is not limited to, one or more DNA fragments. In some embodiments, the modified region includes, but is not limited to, a plurality of discrete DNA fragments.
In some embodiments, marker genes include, but are not limited to, one or more marker genes.
Preferably, in the marker gene of the modified region, one or more (including but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) DNA fragments of the vector to be modified can be replaced by one marker gene. In some embodiments, multiple discrete DNA fragments are combined into a DNA fragment region and replaced with a marker gene. In the specific embodiment of the present invention, there is no particular limitation on the number of segments of the marker gene to be replaced with respect to a certain modified region. Preferably, the marker gene includes, but is not limited to, a gene encoding antibiotic resistance, a gene associated with auxotrophy, a fluorescent protein, or a fusion fluorescent protein. In some embodiments, marker genes include, but are not limited to, auxotrophic gene fragments of URA3, TRP1, HIS3, LYS2, LEU2, or ADE 2. In some embodiments, the marker gene includes, but is not limited to, an antibiotic resistance gene encoding KanMX4 or hygxm 4, NatMX 4.
Specifically, in step S02, a first homology arm primer sequence of the marker gene is designed and amplified to obtain a marker gene fragment, the marker gene fragment and the to-be-modified vector are co-transformed into a wild-type saccharomyces cerevisiae cell, and the saccharomyces cerevisiae cell containing a first plasmid precursor is obtained by screening, wherein the first plasmid precursor includes the marker gene.
The invention adopts a homologous recombination system endogenous in a saccharomyces cerevisiae cell to realize the replacement of a marker gene segment on a modification region of a modification vector, and utilizes the marker gene to screen recombinants. Homologous recombination refers to recombination that occurs between or within DNA molecules containing homologous sequences. Preferably, in the step of designing the first homology arm primer sequence of the marker gene, the first homology arm primer sequence comprises homology arm sequences at both sides of the modified region and an amplification primer sequence of the target DNA in sequence from 5 '-3' end, the homology arm sequences at both sides of the modified region are designed, the homology arm sequences are used for identifying and recombining the region where the marker gene is transformed by yeast, and the homology arm sequences are used for replacing the modified region in the vector to be modified. More preferably, the length of the homologous arm sequence is 45-50 nt.
In some embodiments, the first homology arm primer sequence is used as an amplification primer of the marker gene, and other vectors containing the marker gene are used as a template for PCR amplification to obtain a marker gene fragment.
In some embodiments, the step of co-transforming the marker gene fragment and the vector to be modified into the wild-type s.cerevisiae cell includes, but is not limited to, the step of co-transforming the marker gene fragment and the vector to be modified into the wild-type s.cerevisiae cell by using a lithium acetate transformation method, an electric transformation method or a protoplast transformation method.
In some embodiments, in the step of selecting the saccharomyces cerevisiae cells containing the first plasmid precursor, the antibiotic resistance gene or auxotrophic selection marker gene carried by the first plasmid precursor and different from the vector to be modified is selected for selection, so that the transformant can grow on a selective medium added with antibiotics or without certain essential nutrients, and since the vector to be modified does not contain the selection marker, neither the yeast transformant without any vector nor the yeast transformant without the marker gene to be modified can grow on the selective medium, and the saccharomyces cerevisiae cells containing the first plasmid precursor are selected by the method.
Further, the first plasmid precursor comprises a marker gene; the marker gene utilizes a homologous recombination mechanism of saccharomyces cerevisiae endogenous to carry out efficient directional substitution on any region to be modified by the marker gene segment to obtain a saccharomyces cerevisiae cell containing a plasmid precursor, thereby realizing the positioning of DNA modification.
Specifically, in step S03, a donor sequence with a homology arm is synthesized and linearized to obtain a linearized donor sequence, the linearized donor sequence is transformed into a Saccharomyces cerevisiae cell containing a first plasmid precursor, and the target Saccharomyces cerevisiae cell containing a donor sequence plasmid is selected.
Preferably, both ends of the donor sequence include a first restriction enzyme recognition site, which is added to facilitate transformation of the donor sequence into s.cerevisiae cells containing the first plasmid precursor using linearization treatment. Further preferably, the first restriction enzyme recognition site is a restriction enzyme recognition site that is not present in the donor sequence.
Further, the step of transforming the linearized donor sequence into the saccharomyces cerevisiae cells containing the first plasmid precursor includes, but is not limited to, selecting a lithium acetate transformation method, an electrical transformation method, or a protoplast transformation method to transform the linearized donor sequence into the saccharomyces cerevisiae cells containing the first plasmid precursor.
Further, the step of selecting the Saccharomyces cerevisiae cells of interest containing the donor sequence plasmid includes, but is not limited to, selection using multiplex PCR, antibiotic resistance medium, or auxotrophic medium.
Preferably, the molecular cloning method further comprises: extracting donor sequence-containing plasmids from target saccharomyces cerevisiae cells containing the donor sequence plasmids, and transforming the donor sequence-containing plasmids into escherichia coli for enrichment treatment. Because the provided plasmid to be modified is a shuttle vector of escherichia coli-saccharomyces cerevisiae, the plasmid containing the donor sequence is transformed into escherichia coli for enrichment treatment, enzyme digestion identification and sequencing analysis, so that the donor sequence plasmid with high purity and high concentration is obtained, and the subsequent biological related research is facilitated.
The method is quick, simple and convenient, can realize seamless modification of an original vector, and does not need to additionally construct other targeting vectors.
In a second aspect, the embodiment of the present application provides a molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, the molecular cloning method comprising the following steps:
G01. providing a carrier to be modified, carrying out sequence comparison on the carrier to be modified, and determining a modification region of the carrier to be modified and a marker gene for replacing the modification region;
G02. designing a second homologous arm primer sequence of the marker gene and amplifying to obtain a marker gene segment, co-transforming the marker gene segment and a vector to be modified into a wild saccharomyces cerevisiae cell, screening to obtain a saccharomyces cerevisiae cell containing a second plasmid precursor, extracting the second plasmid precursor and carrying out enrichment treatment, wherein the second plasmid precursor comprises the marker gene and a second restriction endonuclease recognition site;
G03. synthesizing a donor sequence with a homology arm, and respectively carrying out linearization treatment on the donor sequence and the second plasmid precursor to obtain a linearized donor sequence and a linearized second plasmid precursor;
G04. and co-transforming the linearized donor sequence and the linearized second plasmid precursor into wild saccharomyces cerevisiae cells, and screening to obtain the target saccharomyces cerevisiae cells containing donor sequence plasmids.
The molecular cloning method provided by the second aspect of the application utilizes a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism, and adds a recognition site of restriction endonuclease on a designed primer; simultaneously, the plasmid precursor is enriched to obtain a large amount of plasmid precursor containing the marker gene, the plasmid precursor containing the marker gene and the synthesized donor sequence are subjected to in vitro linearization and then co-transformation, the linear plasmid precursor, the donor sequence and yeast homologous recombination are utilized to realize seamless modification of any type of the vector sequence to be modified, multi-version plasmid containing the donor sequence is constructed in a batch and efficient seamless manner, the construction power of the donor sequence plasmid is improved, and the cloning of the plasmid vector can be carried out quickly and efficiently.
Specifically, in step G01, a vector to be modified is provided, and the sequence of the vector to be modified is aligned to determine a modified region of the vector to be modified and a marker gene that replaces the modified region. Here, the content discussed in G01 is identical to the content discussed in S01, and for brevity, the description is omitted here.
Preferably, the vector to be modified is selected from shuttle vectors of escherichia coli and saccharomyces cerevisiae, so that the vector can be subjected to a shuttle test in the molecular cloning method, can be stably existed in saccharomyces cerevisiae cells, and can be massively replicated in escherichia coli to enrich the vector.
Preferably, the number of bases of the vector to be modified is 4-150kbp, and the molecular cloning method provided by the second aspect of the present application is suitable for the modification of shuttle plasmids with the number of bases of 4-150 kbp. Further preferably, the number of bases of the vector to be modified is 20-30 kbp, and the molecular cloning method provided by the second aspect of the application is adopted for modifying the vector to be modified with the number of bases of 20-30 kbp, so that the operation is very simple, the construction efficiency is high, and the construction power is high.
Specifically, in the step G02, a second homology arm primer sequence of the marker gene is designed and amplified to obtain a marker gene fragment, the marker gene fragment and the vector to be modified are co-transformed into a wild-type saccharomyces cerevisiae cell, a saccharomyces cerevisiae cell containing a second plasmid precursor is obtained by screening, the second plasmid precursor is extracted and subjected to enrichment treatment, wherein the second plasmid precursor comprises the marker gene and a second restriction endonuclease recognition site.
Preferably, in the step of designing the second homology arm primer sequence of the marker gene, the second homology arm primer sequence comprises homology arm sequences at two sides of the modification region, a second restriction enzyme recognition site and an amplification primer sequence of the marker gene from 5 '-3' end, wherein the homology arm sequences at two sides of the modification region are designed, the homology arm sequences are used for recognizing and recombining the region to make the marker gene transformed by yeast, and the homology arm sequences are used for replacing the modification region in the vector to be modified; and further, the method also comprises a second restriction enzyme recognition site, wherein the second restriction enzyme recognition site is introduced into a second plasmid precursor, so that in subsequent experiments, the second plasmid precursor which is enriched and has high purity is subjected to in-vitro enzyme digestion, and the in-vitro linearization of the plasmid precursor and a donor sequence and yeast homologous recombination are utilized to realize the batch and efficient seamless construction of multi-version target plasmids, improve the construction power of the vector, and simultaneously avoid the occurrence of more false positives in subsequent steps and influence on the accuracy.
Further preferably, the second restriction enzyme recognition site is an enzyme cutting site which does not exist on the vector to be modified, so that specific linearization treatment is ensured, and successful assembly of the donor sequence and the plasmid precursor is facilitated.
More preferably, the length of the homologous arm sequence is 45-50 nt.
Further, the step of co-transforming the marker gene fragment and the vector to be modified into the wild saccharomyces cerevisiae cell includes, but is not limited to, a lithium acetate transformation method, an electrical transformation method and a protoplast transformation method which are selected to co-transform the marker gene fragment and the vector to be modified into the saccharomyces cerevisiae cell.
Further, in the step of screening to obtain the saccharomyces cerevisiae cells containing the second plasmid precursor, an antibiotic resistance gene or an auxotrophic selection marker gene carried by the second plasmid precursor and different from the vector to be modified is selected for screening, so that the transformant can grow on a selective medium added with antibiotics or without containing a certain necessary nutrient component, and because the vector to be modified does not contain the selection marker, the yeast transformant without any vector or the yeast transformant without the marker gene to be modified can not grow on the selective medium, and the saccharomyces cerevisiae cells containing the second plasmid precursor are screened by the method. In some embodiments, the validation method of colony PCR is further used to screen saccharomyces cerevisiae cells containing the second plasmid precursor.
Furthermore, the second plasmid precursor comprises a marker gene and a second restriction enzyme recognition site, the second restriction enzyme recognition site is designed in the second homologous arm primer sequence, so that the marker gene and the second restriction enzyme recognition site are arranged in the second plasmid precursor, and after the second plasmid precursor is extracted, enriched and subjected to in-vitro enzyme digestion, the second plasmid precursor is favorable for efficient recombination with a donor sequence, the subsequent transformation and assembly accuracy is ensured to be high, and more false positives cannot occur.
Preferably, the step of extracting the second plasmid precursor and performing enrichment treatment comprises: and extracting a second plasmid precursor from the saccharomyces cerevisiae cells containing the second plasmid precursor, and transforming the second plasmid precursor into escherichia coli for monoclonal purification and enrichment treatment. Because the provided modified plasmid is a shuttle vector comprising escherichia coli and saccharomyces cerevisiae, the second plasmid precursor is transformed into escherichia coli for enrichment treatment to obtain the second plasmid precursor with high purity and high concentration, so that subsequent enzyme digestion linearization and yeast transformation tests are facilitated, and the accuracy is improved.
Specifically, in the above step G03, a donor sequence with a homology arm is synthesized, and the donor sequence and the second plasmid precursor are linearized to obtain a linearized donor sequence and a linearized second plasmid precursor, respectively. Preferably, both ends of the donor sequence include a first restriction enzyme recognition site added to linearize the donor sequence. Further preferably, the first restriction enzyme recognition site is a restriction enzyme recognition site that is not present within the donor sequence. And further, carrying out linearization treatment on the enriched second plasmid precursor by using restriction endonuclease to obtain a linearized second plasmid precursor, and carrying out linearization treatment on the donor sequence by using restriction endonuclease to obtain a linearized donor sequence.
Specifically, in the step G04, the linearized donor sequence and the linearized second plasmid precursor are co-transformed into wild-type Saccharomyces cerevisiae cells, and the target Saccharomyces cerevisiae cells containing the donor sequence plasmid are obtained by screening. The method realizes seamless modification of any type of vector sequences to be modified by utilizing the in vitro linearization of plasmid precursors and donor sequences and yeast homologous recombination, seamlessly constructs multi-version plasmids containing the donor sequences in batches and efficiently, enriches the constructed plasmid precursors and then carries out linearization treatment, improves the construction power of the donor sequence plasmids, and can quickly and efficiently clone the plasmid vectors.
Further, co-transforming the linearized donor sequence and the linearized second plasmid precursor into a wild-type s.cerevisiae cell, including but not limited to selecting lithium acetate transformation, electrical transformation, or protoplast transformation methods to co-transform the linearized donor sequence and the linearized second plasmid precursor into a wild-type s.cerevisiae cell. The assembly of two linear sequences in the yeast cells converted by sequence splicing realizes the seamless modification of any type of vector sequences to be modified, seamlessly constructs multi-version plasmids containing donor sequences in batches and efficiently, improves the construction power of the donor sequences, and can quickly and efficiently clone the plasmid vectors.
Further, the step of selecting the Saccharomyces cerevisiae cells of interest containing the donor sequence plasmid includes, but is not limited to, selection using multiplex PCR, antibiotic resistance medium, or auxotrophic medium. In some embodiments, the validation method of colony PCR is further used to screen saccharomyces cerevisiae cells containing the second plasmid precursor.
Preferably, the molecular cloning method further comprises: extracting donor sequence-containing plasmids from target saccharomyces cerevisiae cells containing the donor sequence plasmids, and transforming the donor sequence-containing plasmids into escherichia coli for enrichment treatment. Because the provided plasmid to be modified is a shuttle vector comprising escherichia coli and saccharomyces cerevisiae, the plasmid containing the donor sequence is transformed into escherichia coli for enrichment treatment, enzyme digestion identification and sequencing analysis to obtain the donor sequence plasmid with high purity and high concentration, which is beneficial to subsequent biological related research.
The molecular cloning method combines a plurality of modification sites into modification regions, only needs to carry out in-vitro enzyme digestion on a plasmid precursor and a synthesized donor fragment which comprise a marker gene fragment and a restriction enzyme recognition site replacing the modification regions during fragment preparation by using restriction enzymes, and then carries out cotransformation into wine brewing cells, has very simple operation, higher construction efficiency and higher construction power, and is suitable for multi-version and high-flux seamless cloning operation.
The following description will be given with reference to specific examples.
Example 1
Molecular cloning method of pJS379 based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism
The principle and main process of a molecular cloning method of pJS379 based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism (the molecular cloning method provided by the first aspect of the application utilizes the synthetic gene and the saccharomyces cerevisiae homologous recombination mechanism) are shown in the attached figure 1, and the specific steps are as follows:
(1) providing a vector pJS379 to be modified, wherein pJS379 is a shuttle plasmid of Escherichia coli-Saccharomyces cerevisiae, can realize autonomous replication in Escherichia coli cells and Saccharomyces cerevisiae cells and grow under corresponding screening conditions, carries ampicillin resistance gene and yeast HIS3 marker gene (marker gene A), and also carries a plurality of mammalian gene expression units, and the original plasmid size is 29.2kbp, as shown in figure 2.
Carrying out comparison analysis on the vector pJS379 to be modified, and determining that the modified region of the vector to be modified is a region of about 50bp containing the base to be modified in the S2 gene sequence; the plasmid which achieves single base substitution after molecular experiments is named S2-mut.
Further, the marker gene of the selected replacement modified area is URA 3.
(2) Designing a first homology arm primer sequence of a marker gene URA 3: wherein the first homologous arm primer sequence sequentially comprises homologous arm sequences on two sides of the modification region and an amplification primer sequence of the marker gene from the 5 '-3' end; specifically, the first homology arm primer sequences of the marker gene URA3 are JSO1415 and JSO1416, wherein the sequence of the JSO1415 is seq.id No.1 (wherein, the bold base sequences are homology arm sequences):
the sequence of JSO1416 is as shown in seq. ID No.2 (wherein the bold base sequence is the sequence of the homology arm):
amplification marker gene URA3 sequence: and (2) taking the yeast integration type vector pRS406 as a template and JSO1415 and JSO1416 as amplification primers, and amplifying to obtain a marker gene URA3-1 fragment with a homology arm, wherein the length of the marker gene URA3-1 fragment with the homology arm is 1276 bp.
The sequence of the DNA URA3-1 fragment is shown as seq.ID No.3, and the specific base sequence of seq.ID No.3 is shown as seq.ID No.3 in the sequence list.
And thirdly, co-transforming the marker gene segment and the vector to be modified into wild saccharomyces cerevisiae cells: and (3) co-transforming the marker gene URA3 fragment and the vector pJS379 to be modified into the Saccharomyces cerevisiae cell BY4742 BY a lithium acetate transformation method. Wherein the transformation process is as follows: inoculating a single colony of saccharomyces cerevisiae BY4742 into a YPD culture medium, culturing overnight at 30 ℃, and transferring to a new YPD liquid culture medium; adjusting the initial cell concentration to OD600Culturing at 30 deg.C and 220rpm for 4-5 hr until the cell density is OD 0.16000.4-0.5; 5mL of the cells were collected, centrifuged at 3000rpm at 4 ℃ for 5min and the first cell pellet was collected and washed with 5mL of ddH2Centrifuging the O resuspended cell sediment for 5min at 4 ℃ and 3000rpm and collecting a second cell sediment, resuspending the second cell sediment by using 1mL of 0.1mol/L LiOAc/TE solution, transferring the second cell sediment into a 1.5mL EP tube, centrifuging the second cell sediment at 4 ℃ and 3000rpm for 5min and collecting a third cell sediment, and resuspending the third cell sediment by using 100 mu L of 0.1mol/L LiOAc/TE solution to obtain yeast competent cells; adding the marker gene URA3 fragment to be transformed and the vector pJS380 to be modified into the yeast competent cell to obtain the first yeast competent cellPerforming the following steps; during the preparation of competent cells, salmon sperm DNA (ssDNA) is treated for 5 minutes at 100 ℃ and rapidly placed on ice for cooling for standby; providing 312 mu L of PEG 3350 conversion solution with the mass percentage concentration of 50%, 41 mu L of 1mol/L LiOAc solution and 25 mu L of 10mg/ml salmon sperm DNA (ssDNA), adding the mixture into an EP tube containing yeast competence and conversion DNA, shaking, uniformly mixing, and incubating at 30 ℃ for 45 minutes to obtain a first mixed cell; adding 50 mu L DMSO into the first mixed cell, performing water bath heat shock at 42 ℃ for 15 minutes, and centrifuging at 3000rpm for 1min to collect a first mixed cell precipitate; 500 mu.L of 5mmol/L CaCl is used2Washing the first mixed cell sediment with the solution, centrifuging at 3000rpm for 1min to collect the second mixed cell sediment, and adding 200 μ L ddH2And O, re-suspending the second mixed cell sediment to obtain a third mixed cell solution.
Screening to obtain the saccharomyces cerevisiae cells containing the first plasmid precursor: and (3) coating the third mixed cell solution on a plate of SC-URA, placing the plate in an incubator at 30 ℃ for culturing for 48 hours, selecting partial colonies for colony PCR verification, and screening to obtain the saccharomyces cerevisiae cells containing the first plasmid precursor.
In the colony PCR verification step, verification is performed by adopting a verification primer JSO1040 and a verification primer 12311, the sequence of the verification primer JSO1040 is shown as seq.ID No.4, and the sequence of the verification primer JSO1040 is shown as follows: CCCAACAGGTCTCTTGATGGTC, respectively; the sequence of the screening primer 12311 is shown as seq.ID No.6, and seq.ID No.6 is as follows: CTGTGCTCCTTCCTTCGTTC are provided.
Further, a verification primer JSO1221 and a primer JSO1419 are used for screening, and the sequence of the verification primer JSO1221 is shown as seq.ID No.5, and the sequence of the verification primer JSO 1225 is shown as follows: CGTGGATGATGTGGTCTCTACAGG, respectively; the sequence of the verification primer JSO1419 is shown as seq.ID No.9, and the sequence of the verification primer JSO1419 is shown as follows: CTTGCAATATTCCTACCTGGTGTCTC are provided.
(3) Firstly, two long primers are adopted to construct a donor sequence with homologous arms, a replaced base is designed in the two long primers, the two long primers are respectively provided with homologous arms at the left side and the right side of a modification region and homologous sequences at about 50nt, and a single-point mutation point is in an overlapping nearby region of the two long primers.
Long primers JSO1417 and JSO1418 are provided, the sequence of the long primer JSO1417 is as shown in seq.id No.7, and the sequence of seq.id No.7 is as follows (wherein bold and underlined bases "T" are the bases to be replaced for the purpose):
the sequence of the long primer JSO1418 is shown as seq.ID No.8, and the sequence of the long primer JSO1418 is shown as the following
5’-AGTGGTAAGGGTTTACACATACTTCATCCTTTTTAAGATTAAAAGCATATTCGCAGTTTTCGATAGCTTTCAGCTCGTGGTG-3’。
Annealing and matching through a PCR program, then filling, splicing the two single-chain primers into a short-chain DNA fragment, and obtaining a donor sequence.
② the linearized donor sequence is transformed into a saccharomyces cerevisiae cell containing a first plasmid precursor: the linearized donor sequence is transformed into a s.cerevisiae cell containing the first plasmid precursor, as described in (2) above.
Thirdly, screening to obtain the target saccharomyces cerevisiae cells containing the donor sequence plasmids: coating the saccharomyces cerevisiae cells transformed with the donor sequence and the first plasmid precursor on an SC-HIS plate, and culturing for 24 hours at the temperature of 30 ℃ to obtain a first plate bacterial colony; and (3) carrying out photocopy on the colonies of the first plate on an SC-HIS +5-FOA (1g/L) plate, an SC-URA and the plate, carrying out colony PCR (polymerase chain reaction) identification on yeast colonies on the SC-HIS +5-FOA plate at the temperature of 30 ℃ for 48 hours, and screening to obtain the target saccharomyces cerevisiae cells containing donor sequence plasmids.
Wherein, in the step of selecting a yeast colony on an SC-HIS +5-FOA plate for colony PCR identification, a colony PCR identification primer JSO1040 and a colony PCR identification primer JSO1419 are adopted for identification, and the sequence of the colony PCR identification primer JSO1040 is shown as seq.ID No.4, and the sequence of the colony PCR identification primer JSO1040 is shown as follows: CCCAACAGGTCTCTTGATGGTC, respectively; the sequence of the colony PCR identification primer JSO1419 is shown as seq.ID No.9, and the sequence of the seq.ID No.9 is shown as follows: CTTGCAATATTCCTACCTGGTGTCTC are provided.
The colony PCR reaction system for colony PCR identification is as follows:
picking the bacterial colony to be detected to 20 mu L of 20mM NaOH, placing the bacterial colony in a PCR instrument (98 ℃ for 3min,4 ℃ for 2min), carrying out 5 cycles, and standing for later use;
then, the mixed solution was prepared according to the colony PCR reaction system shown in table 1 below, and PCR reaction was performed according to the PCR reaction procedure shown in table 2 below.
TABLE 1
TABLE 2
PCR sequencing: because of point mutation, whether the colony is positive or not needs to be determined through sequencing, a DNA fragment covering a point mutation region is amplified by high-fidelity enzyme from a primary positive colony, and a PCR product is sent for sequencing, so that the positive clone can be determined finally.
And (4) analyzing results:
the results of example 1 were analyzed as follows:
results analysis (I)
According to the fourth step (2) of example 1, the third mixed cell solution was applied to a plate of SC-URA, cultured in an incubator at 30 ℃ for 48 hours, and 16 colonies were selected and subjected to colony PCR verification, as shown in FIG. 3, and it was found that 13 colonies each had two positive bands, that the fragment sizes were 245bp and 347bp, respectively, as positive clones, and that all were Saccharomyces cerevisiae cells containing the first plasmid precursor, and further subjected to statistics of the positive rate, as shown in Table 3 below, that the number of transformants was 181, the positive clone ratio was 13/16, and the positive rate was 81.25%.
TABLE 3
Analysis of results (ii):
according to the first step (3) of example 1, the donor sequence is shown in FIG. 4, and FIG. 4(1, 2) shows the PCR result of using two long primers to construct a donor sequence with homologous arms, and synthesizing a fragment by overlapping PCR products with a single-point mutation primer of S2, wherein the fragment size is 143 bp.
Results analysis (III)
(iii) according to the third step (3) in example 1, wherein the SC-HIS +5-FOA plate is used for removing the false positive yeast which also contains the first plasmid precursor in the cells while screening the cells of the correct recombinant plasmid; SC-URA plates are mainly used to infer the approximate proportion of false positive yeasts. Experiments show that colonies growing on a Sc-Ura plate are very many, the number of yeast colonies on an SC-HIS +5-FOA plate is small, yeast colonies on the SC-HIS +5-FOA plate are selected for colony PCR identification, and in the step of screening to obtain target saccharomyces cerevisiae cells containing donor sequences, as shown in FIG. 5, 51 colonies in 84 verified transformants have positive bands, the fragment size is 218bp, the positive clones are used as positive clones, the positive rate statistics is further carried out, as shown in Table 4 below, the transformants are 84 transformants, the positive clone ratio is 51/84, and the positive rate is 60.7%.
TABLE 4
Further adopting high-fidelity DNA polymerase to carry out PCR amplification on the mutation-containing region amplified by the S2-mut primary positive colony, wherein the result is shown in FIG. 6, a, b, c and d are positive clones, the fragment size is 218bp, and further carrying out sequencing analysis.
Results analysis (IV)
Two PCR products of the four positive clones are randomly selected for sequencing analysis, the sequencing result is shown in figure 7, the sequencing result of 2 PCR products is consistent with the target, and correct repair is realized.
The embodiment 1 proves that the molecular cloning method provided by the invention carries out single-point transformation on the plasmid pJS379, the molecular transformation method is very simple to operate, the construction efficiency is higher, and other targeting vectors do not need to be additionally constructed. The method is more suitable for the condition that a proper second restriction site is not available and the plasmid is too large in size and difficult to extract, and the obtained transformants by the method are possibly few, but the final construction efficiency is higher and the process is simple.
Example 2
Molecular cloning method of pJS380 based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism
The principle and main process of a molecular cloning method of pJS380 based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism (the molecular cloning method provided by the second aspect of the application utilizes the synthetic gene and the saccharomyces cerevisiae homologous recombination mechanism) are shown in the attached figure 8, and the specific steps are as follows:
(1) the vector pJS380 to be modified is provided, wherein pJS380 is a shuttle plasmid of Escherichia coli-Saccharomyces cerevisiae, can realize autonomous replication in Escherichia coli cells and Saccharomyces cerevisiae cells and grow under corresponding screening conditions, carries ampicillin resistance gene and yeast HIS3 marker gene (marker gene A), and also carries a plurality of mammalian gene expression units, and the length of the plasmid is 27.29kbp, as shown in FIG. 9.
Comparing and analyzing the vector pJS380 to be modified, and determining that the modified region of the vector to be modified is S4 and the modified region is distributed in the region of 5.7 kbp;
further, the marker gene B selected to replace the modified region was URA 3.
(2) Designing a second homologous arm primer sequence of a marker gene URA 3: the second homologous arm primer sequence sequentially comprises homologous arm sequences at two sides of the modification region, a second restriction enzyme recognition site and an amplification primer sequence of the marker gene from the 5 '-3' end; selecting a Srf I recognition site as a second restriction enzyme through sequence analysis; specifically, the second homology arm primer sequences of the marker gene URA3 are JSO1620 and JSO1621, wherein the sequence of the JSO1620 is seq.id No.10 (wherein the bold base sequence is the homology arm sequence, and the underlined sequence is the recognition sequence of the restriction enzyme Srf I):
the sequence of JSO1621 is as shown in seq. ID No.11 (wherein the base sequence in bold is the homology arm sequence and the underlined sequence is the recognition sequence of restriction enzyme Srf I):
amplification marker gene URA3 sequence: and (3) taking the yeast integration type vector pRS406 as a template, and JSO1620 and JSO1621 as amplification primers, and amplifying to obtain a marker gene URA3-2 fragment with a homologous arm, wherein the length of the marker gene URA3-2 fragment with the homologous arm is 1288 bp.
The sequence of the DNA URA3-2 fragment is shown as seq.ID No.12, and the specific base sequence of seq.ID No.12 is shown as the sequence of seq.ID No.12 in the sequence table.
And thirdly, co-transforming the marker gene fragment B and the vector to be modified into the saccharomyces cerevisiae cell: and co-transforming the marker gene DNA URA3 fragment and the vector pJS380 to be modified into the Saccharomyces cerevisiae cell BY4742 BY a lithium acetate transformation method. Wherein, the transformation process and the transformation process in the embodiment 1(2) are that the marker gene segment and the vector to be modified are co-transformed into the wild saccharomyces cerevisiae cell: the transformation process of co-transforming the marker gene URA3 fragment and the vector pJS379 to be modified into the Saccharomyces cerevisiae BY4742 BY using the lithium acetate transformation method is the same, and the details are not repeated here. Screening to obtain the saccharomyces cerevisiae cells containing the second plasmid precursor: and coating the third mixed cell solution on a plate of SC-URA, culturing for 48 hours in an incubator at 30 ℃, selecting part of colonies for colony PCR verification, preparing the mixed solution by adopting a PCR reaction system provided in the following table 5, carrying out PCR reaction according to the PCR reaction program shown in the following table 6, and screening to obtain the saccharomyces cerevisiae cells containing the second plasmid precursor.
In the colony PCR verification step, verification is performed by adopting a verification primer JSO1061 and a verification primer 12311, wherein the sequence of the verification primer JSO1061 is shown as seq.ID No.13, and the sequence of the verification primer JSO1061 is shown as follows: GACAAGTTGGCAGCAACAACAC, respectively; the sequence of the verification primer 12311 is shown in seq.ID No.6, and seq.ID No.6 is as follows: CTGTGCTCCTTCCTTCGTTC are provided.
Screening to obtain a saccharomyces cerevisiae cell containing a second plasmid precursor, verifying by using a screening primer JSO1221 and a screening primer JSO1521, wherein the sequence of the verification primer JSO1221 is shown as seq.ID No.5, and the sequence of the verification primer JSO1221 is shown as follows:
CGTGGATGATGTGGTCTCTACAGG, respectively; the sequence of the verification primer JSO1521 is shown as seq.ID No.14, and the sequence of seq.ID No.14 is shown as follows: CTGAAGTTGCAAGACAATCTGAATTG are provided.
Extracting a second plasmid precursor and carrying out enrichment treatment: selecting a saccharomyces cerevisiae cell colony containing a second plasmid precursor for culturing, extracting the second plasmid precursor by using a yeast plasmid extraction method, converting the second plasmid precursor into escherichia coli competent cells, and coating the escherichia coli competent cells on an ampicillin plate; carrying out PCR preliminary verification on the transformant, selecting and identifying a correct colony, culturing, extracting a plasmid precursor by using a commercial conventional plasmid extraction kit, carrying out enzyme digestion identification, and carrying out sequencing identification on a sequence containing a marker gene and homology arms on two sides of the plasmid precursor. And culturing positive cloning of escherichia coli, and enriching a large amount to obtain a second plasmid precursor with high purity and high concentration, wherein the second plasmid precursor comprises a DNA sequence of a marker gene B and a second restriction enzyme recognition site.
The specific process is as follows: inoculating the single colony of the saccharomyces cerevisiae cell containing the second plasmid precursor to an SC-URA culture medium for about 16 hours, centrifuging at 3000rpm for 5min, and collecting a first thallus precipitate; resuspending the first pellet with 840. mu.L SPE buffer (1M sorbent, 0.01M sodium phosphate,0.01M Na2-EDTA (pH 7.5)), adding 1. mu.L mercaptoethanol and 1. mu.L 20mg/ml Zymolyase 100T solution, mixing, placing in an incubator at 37 ℃ for 1 hour to obtain a second pellet solution, and reversing and mixing up and down once every 10 min; centrifuging the second thallus solution at 3000rpm for 5min, and collecting third thallus precipitate; adding 20. mu.L of 1mol/L sorbitol to resuspend the third bacterial pellet (vortexed when the plasmid was below 30 kbp), adding 3. mu.L of 10mg/mL RNase A and 420. mu.L of lysine buffer (0.05M Tris-HCl,0.02M EDTA, 1% SDS, pH 12.8), mixing, and culturing at 37 ℃ for 3Obtaining a fourth thallus solution in 0 minute, and evenly mixing the fourth thallus solution by turning upside down every 10 minutes; adding 420 μ L DNA extractive solution (phenol chloroform), mixing, placing in 4 deg.C centrifuge, and centrifuging at 4200g for 30 min; after the centrifugation is finished, removing the supernatant, washing the precipitate with 210 mu L of 70% ethanol solution, placing the precipitate in a centrifuge at 4 ℃, and centrifuging for 5min at 4200 g; after the centrifugation is finished, removing the supernatant, and drying in a 65 ℃ oven for 5min or in a vacuum concentrator for 10min at 45 ℃; after drying, use 20. mu.L ddH2O dissolves the DNA.
Transforming 5 mu L of second plasmid precursor solution into escherichia coli competent cells, coating the escherichia coli competent cells on an LB (lysogeny broth) plate containing ampicillin, culturing for 18 hours at 30 ℃, carrying out colony PCR (polymerase chain reaction) verification on transformants, selecting and inoculating correctly identified colonies to an LB liquid culture medium containing ampicillin, culturing for 12-16 hours at 30 ℃, extracting the second plasmid precursor by using a commercial conventional plasmid extraction kit, carrying out enzyme digestion verification and sequencing verification, and enriching to obtain the second plasmid precursor with high purity and high concentration, wherein the second plasmid precursor comprises a marker gene B and a second restriction endonuclease recognition site.
(3) Synthesis of donor sequences with homologous arms: adding homologous arms (45-500bp) at two sides of a region to be modified to generate a donor sequence, sending a gene synthesis company to synthesize the donor sequence with the homologous arms, cloning the donor sequence with the homologous arms on a bacterial vector (such as pUC57), adding Not I enzyme cutting sites at two ends of a synthesized fragment to obtain a synthesized fragment vector SG016 with the fragment size of 4292bp, and a synthesized fragment vector SG017 with the fragment size of 3292 bp.
Respectively carrying out linearization treatment on the donor sequence and the second plasmid precursor to obtain a linearized donor sequence and a linearized second plasmid precursor: carrying out enzyme digestion on the second plasmid precursor by using the new enzyme digestion site Srf I to release a linearized second plasmid vector; and carrying out in-vitro enzyme digestion on the obtained synthetic fragment vectors SG016 and SG017 by utilizing Not I, and releasing to obtain linearized SG016 and linearized SG017, wherein the corresponding enzyme digestion products can be directly repaired in the next step without carrying out glue recovery.
(4) Co-transforming the linearized donor sequence and the linearized second plasmid precursor into a s.cerevisiae cell: adding the linearized donor sequence and the linearized second plasmid precursor at a molar ratio of 3: 1, 200 ng of 500ng of the available DNA (only the sum of the parts of the recipient vector and the synthetic fragment) was transformed into the yeast BY 4742. Wherein the actual dosage of the receiving vector released by the plasmid precursor is 134ng, the partial dosage of the SG016 synthetic fragment is 80ng, and the partial dosage of the SG017 synthetic fragment is 62 ng; the process for co-transforming the linearized donor sequence and the linearized second plasmid precursor into s.cerevisiae cells is described in (2) above.
Secondly, screening to obtain the target saccharomyces cerevisiae cells containing the donor sequence plasmids: coating the saccharomyces cerevisiae cells transformed with the donor sequence and the second plasmid precursor on an SC-HIS plate, and culturing overnight at the temperature of 30 ℃ to obtain a first plate bacterial colony; and (3) carrying out photocopy printing on the colonies of the first plate on an SC-HIS +5-FOA (1g/L) plate, an SC-URA plate and an SC-HIS plate, selecting yeast colonies on the SC-HIS +5-FOA plate at the temperature of 30 ℃ for colony PCR identification, and screening to obtain the target saccharomyces cerevisiae cells containing the donor sequence plasmid, wherein the donor sequence plasmid containing the SG016 synthetic fragment is named as S4-v1, and the donor sequence plasmid containing the SG017 synthetic fragment is named as S4-v 2.
Wherein in the step of selecting a yeast colony on an SC-HIS +5-FOA plate for colony PCR identification, a colony PCR identification primer JSO1279 and a colony PCR identification primer JSO1521 are adopted to respectively identify S4-v1 and S4-v2, the sequence of the colony PCR identification primer JSO1279 is shown as seq.ID No.15, and the sequence of the colony PCR identification primer JSO1279 is shown as follows: AGTAGGTGGAATAGCTCCAGCTATC, respectively; the sequence of the colony PCR identification primer JSO1521 is shown as seq.ID No.14, and the sequence of seq.ID No.14 is shown as follows: CTGAAGTTGCAAGACAATCTGAATTG are provided.
The colony PCR reaction system for colony PCR identification is as follows:
picking the bacterial colony to be detected to 20 mu L of 20mM NaOH, placing the bacterial colony in a PCR instrument (98 ℃ for 3min and 4 ℃ for 2min), repeating 5 cycles, and standing for later use;
then, the mixed solution was prepared according to the colony PCR reaction system shown in table 5 below, and PCR reaction was performed according to the PCR reaction procedure shown in table 6 below.
TABLE 5
TABLE 6
Enrichment of plasmids containing donor sequences: and (3) extracting the plasmid containing the donor sequence from the yeast strain which is verified to be correct, wherein the specific process is shown as the step (2), the donor sequence plasmid is transformed into escherichia coli competent cells for massive enrichment, the donor sequence plasmid is extracted by utilizing a commercial conventional plasmid extraction kit, enzyme digestion verification and sequencing identification are carried out, and the donor sequence plasmid with high purity and high concentration is obtained by enrichment, so that the subsequent biological related research is facilitated.
And (4) analyzing results:
the results of example 2 were analyzed as follows:
results analysis (I)
According to the fourth step (2) in the embodiment 2, the third mixed cell solution is coated on a plate of SC-URA, the plate is placed in an incubator at 30 ℃ for culturing for 48 hours, 5 colonies are selected for colony PCR verification, the result of the colony PCR verification is shown in figure 10, and the PCR result verified by adopting a screening primer JSO1221 and a screening primer JSO1521 can find that 5 colonies all have positive bands, the fragment size is 871bp, the fragments are positive clones and are Saccharomyces cerevisiae cells containing the second plasmid precursor; when the JSO1061 and the primer 12311 are used for verification, the size of the obtained fragment is 586bp, and because the modified sequence is special and the amplified part has high GC% content, the fragment cannot be amplified by using the conventional DNA polymerase and amplification conditions, so that the fragment has no band.
Further, as shown in Table 7 below, the number of transformants was 155, the positive clone ratio was 5/5, and the positive rate was 100%.
TABLE 7
Analysis of results (ii):
according to the third step (3) of example 2, synthetic fragment vectors SG016 and SG017 are shown in FIG. 11, and FIG. 11 shows the sequence alignment results of the provided region to be modified S4, marker gene URA3 fragment, donor sequence SG016, donor sequence SG017, modified S4-v1 (donor sequence plasmid containing SG 016), and modified S4-v2 (donor sequence plasmid containing SG 017).
Results analysis (III)
According to the step (3) of the embodiment 2, in the step of obtaining the linearized donor sequence and the linearized second plasmid precursor by respectively performing linearization treatment on the donor sequence and the second plasmid precursor, the linearization result is shown in fig. 12, Lane 1/2 is the linearized second plasmid precursor of the second plasmid precursor after Srf I treatment, the fragment size is 21457bp, Lane 3/4 is the linearized SG016 of the synthesized donor sequence SG016 plasmid after Not I treatment, the fragment size is 4292bp, Lane 5/6 is the linearized SG017 of the synthesized donor sequence 017 SG plasmid after Not I treatment, the fragment size is 3292bp, the linearization is complete, the concentration is high, and no impurities exist.
Analysis of results (iv):
according to the second step (4) of the embodiment 2, the colony which does not grow on the first plate colony is photocopied on an SC-HIS +5-FOA (1g/L) plate and an SC-URA plate, a yeast colony on the SC-HIS +5-FOA plate is selected for colony PCR identification at the temperature of 30 ℃ for 48 hours, and a target saccharomyces cerevisiae cell containing a donor sequence plasmid is obtained by screening, wherein the SC-HIS +5-FOA plate is used for removing false positive yeast of a plasmid precursor which is remained in vivo due to incomplete enzyme digestion treatment while screening correctly assembled cells; SC-URA plates were mainly used to infer the approximate proportion of plasmid precursors remaining. The yeast colony on an SC-HIS +5-FOA plate is selected for PCR identification, the PCR identification result of the S4-v1 colony is shown in figure 13, the fragment size of a positive clone is 1050bp, the PCR identification result of the S4-v2 colony is shown in figure 14, the fragment size of the positive clone is 950bp, and it is found that 60% of yeast in S4-v1 and S4-v2 are correctly assembled and repaired, which indicates that the enzyme digestion product in the step (3) of the embodiment 1 is directly transformed and assembled, the efficiency is very high, the gel recovery and purification of corresponding DNA fragments are not needed, and the process is simple and rapid. The positive rates of S4-v1 and S4-v2 were further analyzed, as shown in Table 8 below: for the S4-v1 fragment, there were very many transformants on the SC-HIS +5-FOA plate, in which the positive clone ratio was 24/32 and the positive rate was 75%; for the S4-v2 fragment, there were very many transformants on the SC-HIS +5-FOA plate, in which the positive clone ratio was 20/32 and the positive rate was 62.5%.
TABLE 8
Example 2 shows that the molecular cloning method provided by the invention carries out multi-version deep transformation on the plasmid pJS380 with the original plasmid size of 27.2kbp, realizes the complex modification of a plurality of discontinuous regions, and successfully obtains the seamlessly transformed S4-v1 donor sequence plasmid and S4-v2 donor sequence plasmid.
The above description is only exemplary of the present application and should not be taken as limiting the present application, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.
SEQUENCE LISTING
<110> institute of advanced technology
<120> molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism
<130> 2020-08-07
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 77
<212> DNA
<213> Artificial Synthesis
<400> 1
aaggattgcc acatgttata tattgccgat tatggcgctg gcctgatctt cacaggcaga 60
ttgtactgag agtgcac 77
<210> 2
<211> 79
<212> DNA
<213> Artificial Synthesis
<400> 2
gtggtaaggg tttacacata cttcatcctt tttaagatta aaagcatatt cgcagttttc 60
tgtgcggtat ttcacaccg 79
<210> 3
<211> 1276
<212> DNA
<213> Artificial Synthesis
<400> 3
aaggattgcc acatgttata tattgccgat tatggcgctg gcctgatctt cacaggcaga 60
ttgtactgag agtgcaccat accacagctt ttcaattcaa ttcatcattt tttttttatt 120
cttttttttg atttcggttt ctttgaaatt tttttgattc ggtaatctcc gaacagaagg 180
aagaacgaag gaaggagcac agacttagat tggtatatat acgcatatgt agtgttgaag 240
aaacatgaaa ttgcccagta ttcttaaccc aactgcacag aacaaaaacc tgcaggaaac 300
gaagataaat catgtcgaaa gctacatata aggaacgtgc tgctactcat cctagtcctg 360
ttgctgccaa gctatttaat atcatgcacg aaaagcaaac aaacttgtgt gcttcattgg 420
atgttcgtac caccaaggaa ttactggagt tagttgaagc attaggtccc aaaatttgtt 480
tactaaaaac acatgtggat atcttgactg atttttccat ggagggcaca gttaagccgc 540
taaaggcatt atccgccaag tacaattttt tactcttcga agacagaaaa tttgctgaca 600
ttggtaatac agtcaaattg cagtactctg cgggtgtata cagaatagca gaatgggcag 660
acattacgaa tgcacacggt gtggtgggcc caggtattgt tagcggtttg aagcaggcgg 720
cagaagaagt aacaaaggaa cctagaggcc ttttgatgtt agcagaattg tcatgcaagg 780
gctccctatc tactggagaa tatactaagg gtactgttga cattgcgaag agcgacaaag 840
attttgttat cggctttatt gctcaaagag acatgggtgg aagagatgaa ggttacgatt 900
ggttgattat gacacccggt gtgggtttag atgacaaggg agacgcattg ggtcaacagt 960
atagaaccgt ggatgatgtg gtctctacag gatctgacat tattattgtt ggaagaggac 1020
tatttgcaaa gggaagggat gctaaggtag agggtgaacg ttacagaaaa gcaggctggg 1080
aagcatattt gagaagatgc ggccagcaaa actaaaaaac tgtattataa gtaaatgcat 1140
gtatactaaa ctcacaaatt agagcttcaa tttaattata tcagttatta ccctatgcgg 1200
tgtgaaatac cgcacagaaa actgcgaata tgcttttaat cttaaaaagg atgaagtatg 1260
tgtaaaccct taccac 1276
<210> 4
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 4
cccaacaggt ctcttgatgg tc 22
<210> 5
<211> 24
<212> DNA
<213> Artificial Synthesis
<400> 5
cgtggatgat gtggtctcta cagg 24
<210> 6
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 6
ctgtgctcct tccttcgttc 20
<210> 7
<211> 82
<212> DNA
<213> Artificial Synthesis
<400> 7
tcgaaaagga ttgccacatg ttatatattg ccgattatgg cgctggcctg atcttcacag 60
tcaccacgag ctgaaagcta tc 82
<210> 8
<211> 82
<212> DNA
<213> Artificial Synthesis
<400> 8
agtggtaagg gtttacacat acttcatcct ttttaagatt aaaagcatat tcgcagtttt 60
cgatagcttt cagctcgtgg tg 82
<210> 9
<211> 26
<212> DNA
<213> Artificial Synthesis
<400> 9
cttgcaatat tcctacctgg tgtctc 26
<210> 10
<211> 84
<212> DNA
<213> Artificial Synthesis
<400> 10
caccgcccga gcccaggtaa ccgcgccatg tcccctcccc ttcccccggc cgggcccggg 60
cgcagattgt actgagagtg cacc 84
<210> 11
<211> 85
<212> DNA
<213> Artificial Synthesis
<400> 11
ttgtattttg tagtccacca tcctgataag gttaagggcc ccaacggtaa aagaccgccc 60
gggctctgtg cggtatttca caccg 85
<210> 12
<211> 1288
<212> DNA
<213> Artificial Synthesis
<400> 12
ttgtattttg tagtccacca tcctgataag gttaagggcc ccaacggtaa aagaccgccc 60
gggctctgtg cggtatttca caccgcatag ggtaataact gatataatta aattgaagct 120
ctaatttgtg agtttagtat acatgcattt acttataata cagtttttta gttttgctgg 180
ccgcatcttc tcaaatatgc ttcccagcct gcttttctgt aacgttcacc ctctacctta 240
gcatcccttc cctttgcaaa tagtcctctt ccaacaataa taatgtcaga tcctgtagag 300
accacatcat ccacggttct atactgttga cccaatgcgt ctcccttgtc atctaaaccc 360
acaccgggtg tcataatcaa ccaatcgtaa ccttcatctc ttccacccat gtctctttga 420
gcaataaagc cgataacaaa atctttgtcg ctcttcgcaa tgtcaacagt acccttagta 480
tattctccag tagataggga gcccttgcat gacaattctg ctaacatcaa aaggcctcta 540
ggttcctttg ttacttcttc tgccgcctgc ttcaaaccgc taacaatacc tgggcccacc 600
acaccgtgtg cattcgtaat gtctgcccat tctgctattc tgtatacacc cgcagagtac 660
tgcaatttga ctgtattacc aatgtcagca aattttctgt cttcgaagag taaaaaattg 720
tacttggcgg ataatgcctt tagcggctta actgtgccct ccatggaaaa atcagtcaag 780
atatccacat gtgtttttag taaacaaatt ttgggaccta atgcttcaac taactccagt 840
aattccttgg tggtacgaac atccaatgaa gcacacaagt ttgtttgctt ttcgtgcatg 900
atattaaata gcttggcagc aacaggacta ggatgagtag cagcacgttc cttatatgta 960
gctttcgaca tgatttatct tcgtttcctg caggtttttg ttctgtgcag ttgggttaag 1020
aatactgggc aatttcatgt ttcttcaaca ctacatatgc gtatatatac caatctaagt 1080
ctgtgctcct tccttcgttc ttccttctgt tcggagatta ccgaatcaaa aaaatttcaa 1140
agaaaccgaa atcaaaaaaa agaataaaaa aaaaatgatg aattgaattg aaaagctgtg 1200
gtatggtgca ctctcagtac aatctgcgcc cgggcccggc cgggggaagg ggaggggaca 1260
tggcgcggtt acctgggctc gggcggtg 1288
<210> 13
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 13
gacaagttgg cagcaacaac ac 22
<210> 14
<211> 26
<212> DNA
<213> Artificial Synthesis
<400> 14
ctgaagttgc aagacaatct gaattg 26
<210> 15
<211> 25
<212> DNA
<213> Artificial Synthesis
<400> 15
agtaggtgga atagctccag ctatc 25
Claims (10)
1. A molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism is characterized by comprising the following steps:
providing a vector to be modified, carrying out sequence comparison on the vector to be modified, and determining a modified region of the vector to be modified and a marker gene for replacing the modified region;
designing a first homology arm primer sequence of the marker gene and amplifying to obtain a marker gene segment, co-transforming the marker gene segment and the vector to be modified to wild saccharomyces cerevisiae cells, and screening to obtain saccharomyces cerevisiae cells containing a first plasmid precursor, wherein the first plasmid precursor comprises the marker gene;
and synthesizing a donor sequence with a homology arm, carrying out linearization treatment to obtain a linearized donor sequence, transforming the linearized donor sequence into the saccharomyces cerevisiae cell containing the first plasmid precursor, and screening to obtain the target saccharomyces cerevisiae cell containing the donor sequence plasmid.
2. The molecular cloning method based on synthetic genes and Saccharomyces cerevisiae homologous recombination mechanism according to claim 1, wherein the first homology arm primer sequence comprises the homology arm sequences on both sides of the modified region and the amplification primer sequence of the marker gene in sequence from 5 '-3'.
3. The molecular cloning method based on synthetic genes and saccharomyces cerevisiae homologous recombination mechanism according to claim 2, wherein the length of the homologous arm sequence is 45-50 nt.
4. The molecular cloning method based on synthetic genes and saccharomyces cerevisiae homologous recombination mechanism according to claim 1, wherein the vector to be modified is selected from escherichia coli-saccharomyces cerevisiae shuttle vector; and the number of bases of the vector to be modified is 4-150 kbp.
5. A molecular cloning method based on a synthetic gene and a saccharomyces cerevisiae homologous recombination mechanism is characterized by comprising the following steps:
providing a vector to be modified, carrying out sequence comparison on the vector to be modified, and determining a modified region of the vector to be modified and a marker gene for replacing the modified region;
designing a second homologous arm primer sequence of the marker gene and amplifying to obtain a marker gene segment, co-transforming the marker gene segment and the vector to be modified to wild saccharomyces cerevisiae cells, screening to obtain saccharomyces cerevisiae cells containing a second plasmid precursor, extracting the second plasmid precursor and carrying out enrichment treatment, wherein the second plasmid precursor comprises the marker gene and a second restriction endonuclease recognition site;
synthesizing a donor sequence with a homology arm, and respectively carrying out linearization treatment on the donor sequence and the second plasmid precursor to obtain a linearized donor sequence and a linearized second plasmid precursor;
and co-transforming the linearized donor sequence and the linearized second plasmid precursor into wild saccharomyces cerevisiae cells, and screening to obtain the target saccharomyces cerevisiae cells containing donor sequence plasmids.
6. The molecular cloning method based on synthetic genes and Saccharomyces cerevisiae homologous recombination mechanism according to claim 5, wherein the step of extracting the second plasmid precursor and performing enrichment treatment comprises: and extracting the second plasmid precursor from the saccharomyces cerevisiae cells containing the second plasmid precursor, and transforming the second plasmid precursor into escherichia coli for enrichment treatment.
7. The molecular cloning method based on synthetic gene and Saccharomyces cerevisiae homologous recombination mechanism according to claim 5, wherein the second homology arm primer sequence comprises the homology arm sequences flanking the modified region, the second restriction enzyme recognition site and the amplification primer sequence of the target DNA in sequence from 5 '-3'.
8. The molecular cloning method based on synthetic genes and Saccharomyces cerevisiae homologous recombination mechanism according to claim 5, wherein the second restriction enzyme recognition site is an enzyme cutting site that is not present on the vector to be modified.
9. The molecular cloning method based on the synthetic genes and the homologous recombination mechanism of Saccharomyces cerevisiae according to claim 1 or 5, characterized in that it further comprises: extracting the plasmid containing the donor sequence from the target saccharomyces cerevisiae cell containing the plasmid containing the donor sequence, and transforming the plasmid containing the donor sequence into escherichia coli for enrichment treatment.
10. The molecular cloning method based on synthetic genes and homologous recombination mechanism of Saccharomyces cerevisiae according to claim 6, characterized in that the vector to be modified is selected from shuttle vectors of Escherichia coli-Saccharomyces cerevisiae; and the number of bases of the vector to be modified is 4 to 150 kbp.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010983909.9A CN112175984A (en) | 2020-09-18 | 2020-09-18 | Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism |
| PCT/CN2020/133550 WO2022057094A1 (en) | 2020-09-18 | 2020-12-03 | Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010983909.9A CN112175984A (en) | 2020-09-18 | 2020-09-18 | Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112175984A true CN112175984A (en) | 2021-01-05 |
Family
ID=73920160
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010983909.9A Pending CN112175984A (en) | 2020-09-18 | 2020-09-18 | Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112175984A (en) |
| WO (1) | WO2022057094A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113462724A (en) * | 2021-06-16 | 2021-10-01 | 北京擎科生物科技有限公司 | Large-fragment homologous recombination repair method |
| CN115927546A (en) * | 2022-12-29 | 2023-04-07 | 北京海创科业生物科技有限责任公司 | Novel plasmid site-directed mutagenesis method based on seamless cloning technology |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1444651A (en) * | 2000-06-23 | 2003-09-24 | 泰世基因公司 | Generation of libraries of antibodies in yeast and uses thereof |
| CN104087610A (en) * | 2014-07-23 | 2014-10-08 | 中国科学院武汉病毒研究所 | Shuttle plasmid vector, as well as construction method and applications thereof |
| CN104561080A (en) * | 2015-01-04 | 2015-04-29 | 浙江大学 | Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof |
| CN103917648B (en) * | 2011-06-20 | 2016-09-21 | 阿米卡纳生物技术公司 | For being converted and select box and the method for Yeast transformants by homologous recombination |
| CN112410366A (en) * | 2020-12-10 | 2021-02-26 | 科稷达隆生物技术有限公司 | Method for introducing linear plasmid into saccharomyces cerevisiae and prepared saccharomyces cerevisiae |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550605B (en) * | 2009-05-15 | 2012-04-18 | 江南大学 | Method for establishing saccharomyces integrated gene mutation library based on in vivo homologous recombination |
| WO2017101060A1 (en) * | 2015-12-17 | 2017-06-22 | Evonik Degussa (China) Co., Ltd. | Gene cassette for homologous recombination knock-out in yeast cells |
-
2020
- 2020-09-18 CN CN202010983909.9A patent/CN112175984A/en active Pending
- 2020-12-03 WO PCT/CN2020/133550 patent/WO2022057094A1/en active Application Filing
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1444651A (en) * | 2000-06-23 | 2003-09-24 | 泰世基因公司 | Generation of libraries of antibodies in yeast and uses thereof |
| CN103917648B (en) * | 2011-06-20 | 2016-09-21 | 阿米卡纳生物技术公司 | For being converted and select box and the method for Yeast transformants by homologous recombination |
| CN104087610A (en) * | 2014-07-23 | 2014-10-08 | 中国科学院武汉病毒研究所 | Shuttle plasmid vector, as well as construction method and applications thereof |
| CN104561080A (en) * | 2015-01-04 | 2015-04-29 | 浙江大学 | Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof |
| CN112410366A (en) * | 2020-12-10 | 2021-02-26 | 科稷达隆生物技术有限公司 | Method for introducing linear plasmid into saccharomyces cerevisiae and prepared saccharomyces cerevisiae |
Non-Patent Citations (3)
| Title |
|---|
| CHRISTOPHER K. RAYMON等: "General Method for Plasmid Construction Using Homologous Recombination", 《BIOTECHNIQUES》 * |
| 吴毅: "合成型酵母染色体的构建、缺陷靶点定位与基因组重排", 《中国优秀博硕士学位论文全文数据库(博士) 基础科学辑》 * |
| 林金水, 中国医药科技出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113462724A (en) * | 2021-06-16 | 2021-10-01 | 北京擎科生物科技有限公司 | Large-fragment homologous recombination repair method |
| CN115927546A (en) * | 2022-12-29 | 2023-04-07 | 北京海创科业生物科技有限责任公司 | Novel plasmid site-directed mutagenesis method based on seamless cloning technology |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022057094A1 (en) | 2022-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| CN109880851B (en) | Screening report vector and screening method for enriching CRISPR/Cas 9-mediated homologous recombination repair cells | |
| CN112175984A (en) | Molecular cloning method based on synthetic gene and saccharomyces cerevisiae homologous recombination mechanism | |
| WO2023093008A1 (en) | Site for stably expressing protein in cho cell gene nw_003613781.1, and use thereof | |
| CN114085841B (en) | Site for stably expressing protein in CHO cell gene NW _003614092.1 and application thereof | |
| WO2023093007A1 (en) | Site for stably expressing protein in cho cell gene nw_003614889.1, and use thereof | |
| WO2023093005A1 (en) | Site capable of stably expressing protein in cho cell gene nw_003613756.1 and use thereof | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN108424907B (en) | High-throughput DNA multi-site accurate base mutation method | |
| CN116286931B (en) | Double-plasmid system for rapid gene editing of Ralstonia eutropha and application thereof | |
| CN107574128B (en) | Method for rapidly optimizing metabolic pathway of strain in vitro | |
| CN111850050B (en) | Gene editing tool, preparation method thereof and multi-round gene editing method | |
| CN109536494A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN109897854B (en) | CRISPR/Cas9 system with ZYG11A gene knocked out by double sgRNA sites and application | |
| CN111979261A (en) | Multi-gene editing carrier and method for creating tomato fruit color material | |
| CN111748539B (en) | CRISPR/LpCas9 gene editing system and application thereof | |
| CN113355338B (en) | Method for targeted cloning of target fragment from genome library based on linear plasmid vector | |
| CN115960733B (en) | Genetically engineered saccharomycete for assembling large fragment DNA, construction method and application thereof | |
| CN115161305B (en) | Fusion protein comprising double-base editor and preparation method and application thereof | |
| CN117363644B (en) | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application | |
| CN117568402A (en) | Glutamine synthetase-defective CHO cell line and preparation method and application thereof | |
| CN114015724A (en) | Improved CRISPR-Cas9 gene editing method and application | |
| CN116003543A (en) | VPR mutant protein capable of activating saccharomyces cerevisiae gene expression | |
| CN113234759A (en) | Preparation method of NAMPT gene modified human umbilical cord mesenchymal stem cell exosome | |
| CN113652444A (en) | Method for constructing phaffia rhodozyma by using gene editing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |