CN117363644B - VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application - Google Patents
VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application Download PDFInfo
- Publication number
- CN117363644B CN117363644B CN202311671520.0A CN202311671520A CN117363644B CN 117363644 B CN117363644 B CN 117363644B CN 202311671520 A CN202311671520 A CN 202311671520A CN 117363644 B CN117363644 B CN 117363644B
- Authority
- CN
- China
- Prior art keywords
- vigs
- plasmid
- luc
- silencing efficiency
- ren
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000013612 plasmid Substances 0.000 title claims abstract description 54
- 230000030279 gene silencing Effects 0.000 title claims abstract description 51
- 238000000034 method Methods 0.000 title claims abstract description 21
- 230000028604 virus induced gene silencing Effects 0.000 title claims abstract 16
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 42
- 239000012634 fragment Substances 0.000 claims abstract description 27
- 210000001938 protoplast Anatomy 0.000 claims abstract description 20
- 239000005089 Luciferase Substances 0.000 claims abstract description 15
- 239000013598 vector Substances 0.000 claims abstract description 14
- 230000000694 effects Effects 0.000 claims abstract description 9
- 102000004190 Enzymes Human genes 0.000 claims abstract description 6
- 108090000790 Enzymes Proteins 0.000 claims abstract description 6
- 238000010367 cloning Methods 0.000 claims description 17
- 102000004169 proteins and genes Human genes 0.000 claims description 4
- 239000006166 lysate Substances 0.000 claims description 3
- 108091026890 Coding region Proteins 0.000 claims description 2
- 108020005038 Terminator Codon Proteins 0.000 claims description 2
- 238000003780 insertion Methods 0.000 claims description 2
- 230000037431 insertion Effects 0.000 claims description 2
- 101150061385 REN gene Proteins 0.000 claims 1
- 238000011160 research Methods 0.000 abstract description 5
- 230000014509 gene expression Effects 0.000 abstract description 4
- 238000012216 screening Methods 0.000 abstract description 4
- 230000003993 interaction Effects 0.000 abstract description 3
- 210000004027 cell Anatomy 0.000 abstract description 2
- 239000012636 effector Substances 0.000 abstract description 2
- 238000002474 experimental method Methods 0.000 abstract description 2
- 239000013603 viral vector Substances 0.000 abstract 2
- 230000007423 decrease Effects 0.000 abstract 1
- 230000004927 fusion Effects 0.000 abstract 1
- 230000001939 inductive effect Effects 0.000 abstract 1
- 241000196324 Embryophyta Species 0.000 description 11
- 101150108119 PDS gene Proteins 0.000 description 9
- 241000700605 Viruses Species 0.000 description 8
- 238000006243 chemical reaction Methods 0.000 description 8
- 238000012226 gene silencing method Methods 0.000 description 7
- 230000009466 transformation Effects 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 238000003776 cleavage reaction Methods 0.000 description 5
- 230000007017 scission Effects 0.000 description 5
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 4
- 229920000742 Cotton Polymers 0.000 description 3
- 108060001084 Luciferase Proteins 0.000 description 3
- 230000009977 dual effect Effects 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 230000032361 posttranscriptional gene silencing Effects 0.000 description 3
- 241000588724 Escherichia coli Species 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- 108020000999 Viral RNA Proteins 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000001976 enzyme digestion Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000011084 recovery Methods 0.000 description 2
- 238000007480 sanger sequencing Methods 0.000 description 2
- 239000000758 substrate Substances 0.000 description 2
- 241000219194 Arabidopsis Species 0.000 description 1
- 108060002716 Exonuclease Proteins 0.000 description 1
- 241000219146 Gossypium Species 0.000 description 1
- 241000208125 Nicotiana Species 0.000 description 1
- 235000002637 Nicotiana tabacum Nutrition 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 108020004459 Small interfering RNA Proteins 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 230000008260 defense mechanism Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000010864 dual luciferase reporter gene assay Methods 0.000 description 1
- 238000001952 enzyme assay Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 102000013165 exonuclease Human genes 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 230000009368 gene silencing by RNA Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000002401 inhibitory effect Effects 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 230000010076 replication Effects 0.000 description 1
- 108091008146 restriction endonucleases Proteins 0.000 description 1
- 230000001743 silencing effect Effects 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 239000012089 stop solution Substances 0.000 description 1
- 230000010474 transient expression Effects 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
- C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
- C12N15/8212—Colour markers, e.g. beta-glucoronidase [GUS], green fluorescent protein [GFP], carotenoid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/66—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of bioengineering, and particularly relates to a VIGS silencing efficiency reporting plasmid, a method for evaluating silencing efficiency and application thereof. The invention obtains the VIGS silencing efficiency report plasmid pVSr by forming fusion expression genes by plant endogenous gene fragments and LUC genes in a double-luciferase vector and inducing the expression by using a constitutive promoter. Co-transforming the plasmid with a viral vector into protoplasts, the LUC value decreases if the viral vector comprising a plant endogenous gene fragment induces the production of VIGS. Therefore, the silencing efficiency of the endogenous gene fragment VIGS of the plant can be rapidly evaluated within 1 day by the enzyme activity determination of LUC/REN. Meanwhile, the invention can also be used for screening the effector which promotes or inhibits the plant VIGS. Therefore, the invention can be used for the VIGS experiment and the research of plant-virus interaction, plant protection and other directions at the single cell level of protoplast.
Description
Technical Field
The application belongs to the technical field of bioengineering, and particularly relates to a VIGS silencing efficiency reporting plasmid, a method for evaluating silencing efficiency and application thereof.
Background
Virus-mediated gene silencing (VIGS) technology is a very important tool for functional gene research in the field of botanic research. For many plants with difficult genetic transformation, heterologous expression of genes and endogenous gene VIGS are the first choice for functional gene research. The principle of VIGS technology is based on the post-transcriptional gene silencing (PTGS) defense mechanism of plants against viruses, i.e., RNA produced by viruses is cleaved by DEL enzymes into 21 or 22 nt siRNAs, which form RNA-induced silencing complexes (RISC) with AGO and other proteins, followed by RISC cleavage of viral RNA to inhibit viral RNA expression. After introduction of the endogenous gene fragment into the viral genome, the plant is infected, and the plant can silence the endogenous gene while producing PTGS to the virus. Currently, VIGS technology has been widely used in tobacco, arabidopsis, cotton, and other species.
Studies have shown that the selection of VIGS silencing fragment length and its fragment region can significantly affect the effect of endogenous gene silencing. Typically the silent fragment length will be selected to be between 300 and 500 nt. Although the selection of gene silencing fragment regions can be aided by bioinformatics, the actual silencing effect still requires in vivo experimentation. RNA extraction and real-time fluorescent quantitative PCR (qRT-PCR) are currently the only methods to evaluate VIGS silencing efficiency. However, the experimental process of the method is complicated, and extraction of RNA is performed after new tissues of plants grow out. For example, at least two weeks after infection of cotton with TRV can be used for RNA detection. There is therefore a great need for a simple and rapid method to evaluate the silencing efficiency of designed VIGS fragments.
Disclosure of Invention
Because the qRT-PCR method is time-consuming and labor-consuming, the invention provides a VIGS silencing efficiency reporting plasmid, a method for evaluating the VIGS silencing efficiency of plant endogenous gene fragments based on the VIGS silencing efficiency reporting plasmid and related application thereof. The invention provides a quick and low-cost reporting system. The invention designs a novel VIGS silencing efficiency report plasmid (hereinafter abbreviated as pVSr) by using a double-luciferase report system.
In order to achieve the above purpose, the present invention proposes the following technical solutions:
the invention provides a VIGS silencing efficiency reporting plasmid, which comprises a LUC/REN dual-luciferase reporting system, a promoter and a multiple cloning site;
the sequence of the LUC/REN double-luciferase report system, the promoter and the multiple cloning site in the report plasmid is the promoter, the multiple cloning site and the LUC/REN double-luciferase report system;
the vector skeleton of the reporter plasmid is as follows: pGreenII 0800-Luc;
the promoter of the reporter plasmid is a constitutive promoter, and is further preferably a Ubi promoter;
the multiple cloning site is used for inserting the target gene.
In the practice of the present invention, the LUC/REN dual luciferase reporter system used is referred to in: hellens RP, allan AC, friel EN, et al Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants methods 2005;1:13.
The VIGS silencing efficiency report plasmid (pVSr) provided by the invention is shown in figure 2, the pVSr is modified based on a double-luciferase system, a Ubi promoter is used for driving LUC to express, and a multiple cloning site is placed in front of the LUC and used for cloning a target gene sequence.
In the present invention, the objective gene for the insertion of the multiple cloning site is: full-length coding region sequences of genes or fragment sequences comprising genes of interest to be silenced in VIGS vectors;
the target gene also comprises a treatment of deleting a termination codon;
the target gene is placed in the same protein coding frame as the LUC gene in the LUC/REN dual-luciferase reporter system.
The invention also provides application of the reporter plasmid in evaluating the silencing efficiency of the VIGS fragment.
The invention provides a method for evaluating the silencing efficiency of a plant endogenous gene fragment VIGS, which comprises the following steps:
carrying out cotransformation protoplast treatment on the reporter plasmid and a VIGS control plasmid and a plasmid of a VIGS silencing target gene respectively; and collecting the transformed protoplast at 12-24 h, mixing the transformed protoplast with a lysate, measuring the enzyme activities of LUC and REN, and comparing the LUC/REN ratio of the transformed protoplast of the VIGS control plasmid and the LUC/REN ratio of the transformed protoplast of the VIGS silencing target gene plasmid to confirm the silencing efficiency of the endogenous fragment.
The principle of the method for evaluating the VIGS silencing efficiency of the plant endogenous gene fragment is shown in figure 2, and through cotransformation of a VIGS virus plasmid and a VIGS silencing efficiency report plasmid into protoplasts, viruses in the virus plasmid induce VIGS reaction of protoplast cells during replication, so that the LUC gene mRNA in the report plasmid is degraded, and the LUC enzyme activity is reduced. And the REN enzyme driven by the 35S promoter is stably expressed and is not influenced by VIGS. The silencing efficiency of the VIGS plasmid containing the gene fragment of interest can be determined by measuring the LUC/REN enzyme activity.
The invention also provides application of the method in plant-virus interaction.
The invention also provides application of the method in high-efficiency screening of the VIGS silent fragments.
The invention also provides application of the method in screening the VIGS enhancement or inhibition factors.
The beneficial effects of the invention are as follows: the invention utilizes the silencing efficiency reporting system based on the double-luciferase reporting system, and can rapidly screen out the high-efficiency VIGS silencing fragments within 1-2 days. The method not only can help researchers to quickly screen out high-efficiency gene silencing fragments, but also can be used for screening out effector factors for promoting or inhibiting plant VIGS. Therefore, the invention not only can be used for VIGS experiments, but also can be used for research in plant-virus interaction, plant protection and other directions.
Drawings
FIG. 1 is a schematic diagram of a carrier for a VIGS efficiency reporting system VSr;
FIG. 2 is a schematic diagram of a VSr efficiency reporting system;
FIG. 3 shows the gene silencing efficiency of the VIGS efficiency reporting system VSr when plasmid 12 h is transformed;
FIG. 4 shows the gene silencing efficiency of the VIGS efficiency reporting system VSr when plasmid 20 h was transformed.
Detailed Description
The present application is further illustrated below with reference to examples.
Example 1
Evaluation of silencing efficiency of PDS Gene fragments by means of the VIGS silencing efficiency reporting System pVSr
In this example, pGreenII 0800-Luc plasmid was first modified, and the multiple cloning site was modified by adding a constitutive promoter to obtain the VIGS silencing efficiency reporting system pVSr. The PDS sequence was then cloned into pVSr to give plasmid pVSr-PDS. They were cotransported with the virus control plasmids pVSe and pVS-PDS, respectively. The silencing efficiency of PDS gene fragments was assessed by dual luciferase activity assay.
The specific implementation process is outlined as follows:
construction of pVSr plasmid
pRGEB32 plasmid was used as a DNA template amplification promoter Ubi, and the following primer pairs were used for PCR reaction:
0800Ubi F：5’- gtcgacggtatcgataagcttattcgggtcaaggcggaagc -3’，SEQ ID NO.1；
0800 Ubi R1：5’-ggtctcggatctcattgccccccggatgataactatctgcaagaaataatcaccaaac -3’，SEQ ID NO.2；
0800 Ubi R2：5’-atgtttttggcgtcttccatctcctcgcccttgctcaccatgagacctacggtctcggatctcattgcccc -3’，SEQ ID NO.3。
TABLE 1 PCR reaction System
TABLE 2 PCR amplification procedure
The amplified PCR product was recovered by agarose gel DNA recovery kit (enhancement type).
The backbone plasmid of the vector was pGreenII 0800-Luc plasmid, and the vector was linearized with restriction enzymes HindIII and Nco I, the original multiple cloning site.
TABLE 3 enzyme digestion system
The reaction system was placed in an incubator at 37℃overnight for cleavage.
Further, the linearized vector is recovered using an ultra-thin DNA product purification kit;
further, a ClonExpress II One Step Cloning Kit kit, recombinant PCR products and linearization vectors were used.
Further, the recombinant product was transformed with E.coli strain DH 5. Alpha. After the plates were grown overnight, the colonies were picked for colony PCR identification and positive transformants were screened.
Further, using the Sanger sequencing method, it was confirmed whether the Ubi promoter and the new multiple cloning site were constructed successfully. The plasmid constructed successfully is pVSr.
Construction of (II) pVSr-PDS plasmid
PDS fragments were amplified using the pVS-PDS plasmid as DNA template, and PCR reactions used the following primer pairs:
VSr PDS F：5’-atccggggggcaatgagatccttgcctgaagactggagagaga-3’，SEQ ID NO.4；
VSr PDS R：5’-ctcctcgcccttgctcaccattgctttactctgatctgcagatatttca-3’，SEQ ID NO.5。
TABLE 4 PCR reaction System
TABLE 5 PCR amplification procedure
The amplified PCR product was recovered by agarose gel DNA recovery kit (enhancement type).
The backbone plasmid of the vector was pVSr, and the vector was linearized using the restriction exonuclease Bsa I.
TABLE 6 enzyme digestion system
The reaction system was placed in an incubator at 37℃overnight for cleavage.
Further, the linearized vector is recovered using an ultra-thin DNA product purification kit;
further, a ClonExpress II One Step Cloning Kit kit, recombinant PCR products and linearization vectors were used.
Further, the recombinant product was transformed with E.coli strain DH 5. Alpha. After the plates were grown overnight, the colonies were picked for colony PCR identification and positive transformants were screened.
Further, the Sanger sequencing method was used to confirm whether the PDS gene fragment was correctly constructed into the pVSr plasmid.
As shown in FIG. 2, GOI (Gene of interest) is a PDS gene, which is a vector schematic of pVSr-PDS.
(III) protoplast transformation
pVSr-PDS, pVSe and pVS-PDS plasmids were extracted using endotoxin-free plasmid large extraction kit. The ratio of pVSe/pVS-PDS plasmid to pVSr-PDS reporter plasmid was adjusted to 3:1, added to 100. Mu.L of the isolated cotton protoplast (about 10000 cells), gently flicked, mixed and left in the dark for 10 minutes. Then adding the protoplast transformation solution, flicking, mixing evenly and placing for 30 minutes in a dark place. The reaction was stopped by adding W5 solution, the transformation solution was centrifuged off, and the transformed protoplasts were resuspended with W5 solution.
(IV) Dual luciferase Activity assay
The bifluorescence enzyme activity assay was performed using Dual Luciferase Reporter Assay Kit from nupran corporation. The protoplast was collected by centrifugation, after which W5 was aspirated, the lysate was added and the mixture was subjected to lysis on a vortex shaker for 5 minutes. After cleavage is completed, the LUC substrate is added to the microplate and then an equal amount of cleavage solution is added, and the LUC value is obtained by an microplate reader. Then adding equal amount of LUC stop solution containing REN substrate, and obtaining REN value by enzyme label instrument. After calculating the LUC/REN value, the silencing efficiency of the PDS gene can be obtained through comparing the pVSe with the pVS-PDS group.
As shown in table 7, fig. 3 and fig. 4, PDS gene was 29% silenced 12 hours after transformation. 20 hours after transformation, the PDS gene was 71% silenced. The results indicate successful silencing of the PDS gene, and also indicate that the VIGS silencing efficiency of endogenous gene fragments can be rapidly evaluated in protoplasts by the pVSr plasmid.
TABLE 7 PDS Gene silencing efficiency 12 hours/20 hours after transformation
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Claims (1)
- Use of a VIGS silencing efficiency reporter plasmid for evaluating VIGS fragment silencing efficiency;the reporter plasmid consists of a LUC/REN dual-luciferase reporter system, a promoter and multiple cloning sites;the sequence of the LUC/REN dual-luciferase report system, the promoter and the multiple cloning site in the report plasmid is 35s promoter, the REN gene, the terminator, the Ubi promoter, the multiple cloning site and the LUC gene and the terminator in the LUC/REN dual-luciferase report system;the vector skeleton of the reporter plasmid is as follows: pGreenII 0800-Luc;the multiple cloning sites are used for inserting target genes;the objective gene for the insertion of the multiple cloning site is as follows: full-length coding region sequences of genes or fragment sequences comprising genes of interest to be silenced in VIGS vectors;the target gene also comprises a treatment of deleting a termination codon;the target gene and the LUC gene in the LUC/REN dual-luciferase report system are placed in the same protein coding frame;the promoter of the protein coding frame is a Ubi promoter;the method for evaluating the silencing efficiency of the VIGS fragment by using the VIGS silencing efficiency reporting plasmid comprises the following steps of:carrying out cotransformation protoplast treatment on the reporter plasmid and a VIGS control plasmid and a plasmid of a VIGS silencing target gene respectively; and collecting the transformed protoplast at 12-24 h, mixing the transformed protoplast with a lysate, measuring the enzyme activities of LUC and REN, and comparing the LUC/REN ratio of the transformed protoplast of the VIGS control plasmid and the LUC/REN ratio of the transformed protoplast of the VIGS silencing target gene plasmid to confirm the silencing efficiency of the endogenous fragment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311671520.0A CN117363644B (en) | 2023-12-07 | 2023-12-07 | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311671520.0A CN117363644B (en) | 2023-12-07 | 2023-12-07 | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117363644A CN117363644A (en) | 2024-01-09 |
| CN117363644B true CN117363644B (en) | 2024-02-09 |
Family
ID=89404506
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311671520.0A Active CN117363644B (en) | 2023-12-07 | 2023-12-07 | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117363644B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102803496A (en) * | 2009-06-10 | 2012-11-28 | 淡马锡生命科学研究院有限公司 | Virus induced gene silencing (VIGS) for functional analysis of genes in cotton |
| CN105907781A (en) * | 2015-04-22 | 2016-08-31 | 湖南人文科技学院 | Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant |
| CN111154780A (en) * | 2020-01-13 | 2020-05-15 | 江西农业大学 | Method for detecting activity of Dnmt3 gene promoter of western bee by using dual-luciferase reporter gene |
| CN112126658A (en) * | 2020-09-30 | 2020-12-25 | 四川轻化工大学 | Plant over-expressed luciferase reporter gene recombinant vector, construction method and application |
| CN115960954A (en) * | 2022-09-09 | 2023-04-14 | 河南科技学院 | RNA interference vector and application thereof in induction of gene silencing of dicotyledonous plants |
| WO2023152723A1 (en) * | 2022-02-14 | 2023-08-17 | The New Zealand Institute For Plant And Food Research Limited | Regulation of gene expression |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014145968A2 (en) * | 2013-03-15 | 2014-09-18 | The Regents Of The University Of California | Rna interference functions as an antiviral immunity in mammals |
-
2023
- 2023-12-07 CN CN202311671520.0A patent/CN117363644B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102803496A (en) * | 2009-06-10 | 2012-11-28 | 淡马锡生命科学研究院有限公司 | Virus induced gene silencing (VIGS) for functional analysis of genes in cotton |
| CN105907781A (en) * | 2015-04-22 | 2016-08-31 | 湖南人文科技学院 | Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant |
| CN111154780A (en) * | 2020-01-13 | 2020-05-15 | 江西农业大学 | Method for detecting activity of Dnmt3 gene promoter of western bee by using dual-luciferase reporter gene |
| CN112126658A (en) * | 2020-09-30 | 2020-12-25 | 四川轻化工大学 | Plant over-expressed luciferase reporter gene recombinant vector, construction method and application |
| WO2023152723A1 (en) * | 2022-02-14 | 2023-08-17 | The New Zealand Institute For Plant And Food Research Limited | Regulation of gene expression |
| CN115960954A (en) * | 2022-09-09 | 2023-04-14 | 河南科技学院 | RNA interference vector and application thereof in induction of gene silencing of dicotyledonous plants |
Non-Patent Citations (4)
| Title |
|---|
| Establishment of virus‑induced gene silencing (VIGS) system in Luffa acutangula using Phytoene desaturase (PDS) and tendril synthesis related gene (TEN);Xiaoyu Qi等;Plant Methods;20230831;1-10 * |
| Histone acetyltransferase TaHAG1 interacts with TaPLATZ5 to activate TaPAD4 expression and positively contributes to powdery mildew resistance in wheat;Na Song等;New Phytologist;20221231;590-607 * |
| Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants;Roger P Hellens等;Plant Methods;20051218;1-14 * |
| 辣椒CaHsfA2 上游转录因子的筛选及耐热功能分析;刘瑞瑶 等;中国农业科学;20221231;第55卷(第16期);3200-3209 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117363644A (en) | 2024-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107937432B (en) | Genome editing method based on CRISPR system and application thereof | |
| CN105518135B (en) | Method for specifically knocking out pig CMAH gene by CRISPR-Cas9 and sgRNA for specifically targeting CMAH gene | |
| CN106222177B (en) | A kind of CRISPR-Cas9 systems for targeting people STAT6 and its application for treating anaphylactia | |
| CN105518138B (en) | Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene | |
| CN110607320B (en) | Plant genome directional base editing framework vector and application thereof | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| WO2019227640A1 (en) | Reagent and method for repairing fbn1t7498c mutation using base editing | |
| AU2005240741A1 (en) | Methods for assembling multiple expression constructs | |
| CN114729382A (en) | Regulatory nucleic acid molecules for enhancing gene expression in plants | |
| CN117363644B (en) | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application | |
| Venkatesh et al. | Heat stress induced potato virus X-mediated CRISPR/Cas9 genome editing in Nicotiana benthamiana | |
| CN113201555A (en) | Construction method of binary vector containing eGFP marker and hygromycin resistance | |
| CN110628799A (en) | Construction method and application of bacterial promoter report vector | |
| Sam et al. | DESIGN AND TRANSFER OF OsSWEET14-EDITING T-DNA CONSTRUCT TO BAC THOM 7 RICE CULTIVAR. | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| EP4148129A1 (en) | Directed evolution method based on primary and secondary replicon of gemini virus | |
| CN102533741B (en) | Swine pseudo attp site and use of swine pseudo attp site | |
| CN117286178B (en) | Simplified construction method of double-component viral vector and related application thereof | |
| CN114540308A (en) | Cell line for stably expressing orthogonal aminoacyl tRNA synthetase/tRNA and construction method | |
| CN116286905B (en) | Bovine-derived CRISPR/botAS 9 gene editing system, method and application | |
| CN116064537A (en) | Plant circRNA expression frame and application thereof | |
| WO2022078049A1 (en) | Modified plant endosperm specific promoter and use thereof | |
| CN117987460A (en) | LbCas12a plant genome editing system for coexpression TypeV-A anti-CRISPR protein | |
| CN115896158A (en) | Recombinant vector in plant gene editing, method for screening false positive callus by using recombinant vector and application of recombinant vector | |
| CN115851756A (en) | Plant gene editing recombinant vector capable of screening out false positive callus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |