CN105907781A - Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant - Google Patents
Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant Download PDFInfo
- Publication number
- CN105907781A CN105907781A CN201610257242.8A CN201610257242A CN105907781A CN 105907781 A CN105907781 A CN 105907781A CN 201610257242 A CN201610257242 A CN 201610257242A CN 105907781 A CN105907781 A CN 105907781A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- virus
- gene
- plant
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8203—Virus mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Abstract
The invention discloses an application of a cucumber mosaic virus (CMV) hypovirulence vector in enhancement of pest resistance of a plant. A construction method of the CMV hypovirulence vector comprises the following steps: 1), transforming a CMV into a hypovirulence expression vector having a deleted 2b gene sequence, particularly, transforming one of constructed CMV infectious cloning plasmids, namely pCB-CMVF209, by an enzyme digestion connection method, making the 2b gene deleted, and adding an enzyme digestion site, and constructing to obtain the hypovirulence virus expression vector-hypovirulence vector; and 2), inserting a pest-resistant gene encoding region (ORF) sequence into the hypovirulence vector obtained in the step 1), and constructing a recombinant hypovirulence expression vector; and applying the constructed recombinant hypovirulence expression vector containing the pest-resistant gene encoding region sequence in enhancement of the pest resistance of the plant.
Description
Technical field
The present invention relates to the purposes of viral vector, particularly cucumber mosaic virus (cucumber mosaic virus,
CMV) weak virulence carrier application in terms of strengthening plant anti-insect performance.
Background technology
The plant viral vector of existing research and development can be divided into three kinds of purposes: one is primarily used for expressing pharmaceutical protein, resisting
Body etc.；Two is for analyzing or utilizing exogenous gene function；Three is to be silenced gene for virus induced gene silencing analysis
Function.At viral vector in terms of the research of exogenous protein expression, the purpose of research and development viral vector is mainly used in early days
In exogenous protein expression.The method utilizing plant viral vector expression alien gene mainly has two kinds: one to be to transcribe in vitro to take
With the infectious cDNA clone of genes of interest, full-length cDNA is carried out gene replacement, inserts fusion etc.[14], external source base
Because of after being added into, just it is placed in prokaryotic promoter downstream, then directly infects plant or with the side of particle gun with its transcript RNA
Viral vector is proceeded to complete in plant to infect by method, and inoculation plant restrovirus autonomous proliferation in host cell carries out exogenous gene
Expression[15]；Two is that the Genomic cDNA clone of infectivity virus is inserted into the downstreams such as Act2, CaMV35S transcripting promoter
Build the infectivity recombinant virions carrying genes of interest, use Agrobacterium-mediated Transformation method infiltration inoculation plant, thus thin host
Intracellular completes a series of to transcribe, synthesize and assembling process, it is achieved the expression process of exogenous gene.Marillonnet etc. are forefathers
On the basis of establish agroinfiltration (Agro-infiltration) inoculation technique, just make viral vector for external source egg
Reach a gratifying level in vain, made the expression of foreign protein step on again and step on a new stage[16].So far it is used for
Express the main viral vector of pharmaceutical protein and the pharmaceutical protein of expression or antigen is as follows[17-18]: cowpea mosaic virus (cowpea
Mosaic virus, CPMV) express foot and mouth disease virus (FMDV) VP1 antigen, human immunodeficiency virus (HIV-1) gp41 resist
Former, ERC group virus (HRV-14) antigen, Canine Parvovirus (CPV) antigen, chronic pneumonia pathogenic bacteria (Pseudom aeruginosa)
Outer layer cured albumen F antigen, stahylococcus aureus D2domain peptide, malaria antigen, mink enteritis virus (MEV) are anti-
Former, to Transmissible Gastroenteritis virus (TGEV) there is specific small molecule immune protein (SIP), hepatitis B virus core antigen
(HBcAg).TMV vector expression have angiotensin-convertion enzyme inhibitor (ACEI), influenza virus hemagglutinin, people's immunodeficiency
Virus (HIV-1) antigen, malaria antigen, Mus zona shingles ZP3 glycoprotein, foot and mouth disease virus (FMDV) VP1 antigen, α-Radix Trichosanthis
Albumen, 38C13 Mus B cell lymphoma single-chain antibody, intestinal cancer virus monoclonal antibody, foot and mouth disease virus (FMDV) VP1, cattle spore exanthema virus I
Type (BHV-1) gDC, pig infectious diarrhea poison (PEDV) neutralizing epitope；Human immunodeficiency virus (HIV-1) V3 that TBSV expresses
Ring antigen, Canine Parvovirus (CPV) antigen；PVX vector expression have human immunodeficiency virus (HIV-1) gp 41 Antigens, colyliform
Virus VP6 antigen, human papillomavirus 16 (HPV-16) E7 proteantigen, human lactoferrin N leaf, human granulocyte-macrophage
Colony stimulating factor (GM-CSF), mycobacterial antigens ESAT-6；ALMV vector expression have respiratory syncytial virus (RSV) G egg
Bai Kangyuan；Rabbit hemorrhagic fever virus (RHDV) the VP60 antigen that PPV viral vector is expressed；Clover yellow vein virus Clover
Yellow vein virus (ClYVV) vector expression soluble methane monooxygenase C subunit (sMMO-C)；CMV vector expression
AFGF protein etc..Being used for analyzing or utilize exogenous gene function aspects at viral vector, plant viral vector is except for table
Reach outside vaccine antigen, antibody and pharmaceutical protein production, it may also be used for expression alien gene, analyze gene function, analyze external source egg
The interaction of protein in white and plant.Such as, the PVX recombinant expression carrier containing Fulvia fulva avr9 nontoxic gene leads to
Crossing the agroinfiltration inoculation tomato plant leaf with disease-resistant (R) gene cf-9, tomato plant can occur anaphylaxis, show R
The product of gene expression can there occurs directly interaction with avr9 gene outcome[18].Sunk for analyzing at viral vector
The function aspects of silent gene, virus-mediated gene silencing (VIGS) is to send out, according to plant, the defense mechanism that RNA viruses is unique
A kind of technology opened up and come, because it is easy and simple to handle, efficiency is high, the cycle is short, avoid Plant Transformation, overcome the features such as gene redundancy,
Can work under different genetic background, the analysis to gene becomes apparent from, and gradually becomes the one of research plant gene function
Plant effective ways.Important work is played in terms of forward genetics and reverse genetics find and identify the research of gene function
With, increasing plant virus is transformed into effective silent carrier, in merits such as growth and development of plants, degeneration-resistant, signal transductions
Aspect can be studied and achieve significantly progress[20].1997, Van Kammen etc.[21]The earliest VIGS is defined, initially
Meaning be used to describe plant and receive the symptom recovery produced after virus infection.Later, VIGS referred exclusively to utilize recombinant virus
After carrier foreign gene-carrying infects plant, along with duplication and the mobile specific induction plant silence own endogenous base of virus
A kind of phenomenon of cause[22 , 23].Nineteen ninety-five, Kumagai[24]Et al., with tobacco mosaic virus (TMV) (Tobacco mosaic virus,
TMV) being that carrier is transformed, he inserts one section from Nicotiana tabacum L. cDNA reverse transcription (phytoene out in TMV
Desaturase, PDS) sequence, after utilizing this viral vector carrying PDS sequence to infect Nicotiana tabacum L., plant occurs that systematicness takes off
Green photobleaching phenomenon, the mRNA level in-site of PDS also occurs that significance reduces simultaneously.Result explanation plant occur bleaching phenomenon be by
Decline in PDS expression and cause, and PDS is the key enzyme during carotenogenesis, has plant light protection to make
With.1998, Ruiz etc.[25]Use the method that PVX potato virus X (Potato X virus) carrier carries the sequence of PDS,
Also plant is caused to occur in that identical photobleaching phenomenon.Later, people utilized the VIGS carrier of transformation that plant is carried out purposiveness
Gene silencing, suppression endogenous gene expression, thus reach study plant gene function effect.1998, Kjemtrup
Deng[26]The Fructus Lycopersici esculenti golden mosaic virus (STMV) utilizing geminivirus infection section is that VIGS carrier inserts magnesium ion sequestration enzyme
The crucial base Su (Sulfur) of (magnesium chelatase) and turn fluorescence protein gene luc (luciferase), thus draw
Play plant yellowing leaf occurs and turns luc plant and no longer send the phenotype of fluorescence.Calendar year 2001, Ratcliff etc.[27], it was recently reported that
The VIGS carrier built with Tobacco rattle virus TRV, has many advantages compared to PVX, TMV, TGMV, and wherein the VIGS of TRV carries
The symptom of plant is affected relatively light compared to PVX by body, and at silence efficiency, infect in terms of scope, persistency all than PVX more
Perfect.2002, Liu etc.[28]Tobacco rattle virus (Tobacco rattle virus, TRV) is utilized to carry out in Fructus Lycopersici esculenti
VIGS tests, and the Fructus Lycopersici esculenti EST library announced can be carried out functional study analysis.At present, TRV is that range of application is the widest
VIGS viral vector, not only the silence efficiency of its induction plant is high, and is easier to the gene silencing of induced meristem tissue, at present
Substantial amounts of report is all had in the plant of Solanaceae such as Nicotiana tabacum L., Fructus Lycopersici esculenti.TRV carrier has 3 versions at present, initially by Ratcliff
Deng[27]The version built, Liu etc.[29]PYL156, pYL279 revision and Valentine etc.[30]The TRV-built
2b version.Wherein, Liu etc.[29]PYL156 and pYL279 version, in order to make virus substantial amounts of in plant expand, this virus
It is also added into 2 35S promoters, and is also added into ribozyme at C end.And containing TRV in the version viral vector of TRV-2b
2b sequence in RNA2.At present, the viral vector of TRV in Fructus Lycopersici esculenti, Nicotiana tabacum L., Cotton Gossypii (Gossypium spp.), lead a cow
Flower[31], arabidopsis and Semen Papaveris (opium poppy)[32]It is employed etc. in various plants.2002, Holzberg etc.[33]Utilize
Hordeivirus BSMV carries PDS fragment, successfully causes the albinism of Fructus Hordei Vulgaris, it is suppressed that Fructus Hordei Vulgaris PDS gene
Expressing, this is to utilize VIGS carrier to achieve gene silencing on monocotyledon first.2006, Ding etc.[34]Use Herba bromi japonici
Mosaic virus (Brome mosaic virus, BMV) is transformed, same successfully in the monocotyledon such as Oryza sativa L., Semen Maydis
Complete the research to gene silencing.At present, viral vector also begins to disturb the RNA of insecticide for research[35].But PI
Poisonous carrier owing to having pathogenic effects to host plant itself, thus cannot be used for expressing anti insect gene and strengthen the insect resistace of plant
Energy.
The list of references that foregoing relate to is specific as follows:
[14]Choltof H B,Scholtof K B,Jackson A O.Plant virus gene vectors for
transient expression of foreign proteins in plants[J].Annu Rev Phytopath,
(Choltof H B, Scholtof K B, Jackson A O. is for the wink of foreign protein in plant for 1994,34:299-323
Time the plant viral vector expressed. plant pathology academic year comments, 1994,34:299-323).
[15] Li Chengwei, Wang Lai, Pei Dongli, etc., plant viral vector systematic research and application [J]. modern agriculture section
Skill；2008,(15):131-134.
[16]Marillonnet S,Thoeringer C,Kandzia R.Systemic Argobacterium
tumefaciens-mediated transfection of viral replicons for efficient transient
expression in plants.[J].Nat Biotechnol,2005,23:718-723(Marillonnet S,
The systemic Agrobacterium infection of the virus replication that Thoeringer C, Kandzia R. expresses for significant instant in plant.
Nature-biotechnology, 2005,23:718-723).
[17]Matsuo K,Hong JS,Tabayashi N,Ito A,Masuta C,Matsumura
T.Development of Cucumber mosaic virus as a vector modifiable for different
host species to produce therapeutic proteins.Planta,2007,225:277–286(Matsuo
K1, Hong JS, Tabayashi N, Ito A, Masuta C, Matsumura T. cucumber mosaic virus can be used for as one
The carrier manufacture of therapeutic albumen of different host species. botany, 2007,225:277 286).
[18]Ammond-Kosack K E,Staskawicz B J,Jones J D,et al.Functional
expression of a fungal a virulence gene from a modified potato virus X genome
[J].Mol Plant Microbe Interact,1995,8:181-185(Ammond-Kosack K E,Staskawicz B
J, Jones J D, et al. use the potato virus X genome of the transformation menu to one virulence gene of fungus
Reach. molecule plant and molecule microbial interaction, 1995,8:181-185).
[19]Shen W H,Hohn B.Vectors based on maize streak virus can replicate
to high copy numbers in maize plants[J].J.Gen.Virol.,1995,76(4):965-978(Shen
W H, Hohn B. corn virus 2 carrier can replicate by high-load in corn plant. general virology magazine, and 1995,76
(4):965-978)。
[20] prosperous army, Qian Yajuan, Li Zhenghe, etc. virus induced gene silencing and at plant functional genomics research
In application [J]. Chinese science: life sciences, 2012,42 (1): 3-15.
[21]Van Kammen A.Virus-induced gene silencing in infected and
transgenic plants[J].Trends in Plant Science,1997,2(11):409-411(Van Kammen A.
Infecting and virus induced gene silencing in transgenic plant. plant science trend, 1997,2 (11): 409-411).
[22]Baulcombe D C.Fast forward genetics based on virus-induced gene
silencing[J].Current opinion in plant biology,1999,2(2):109-113(Baulcombe D
C. the quick forward genetics based on virus induced gene silencing. the up-to-date viewpoint of Plant Physiology, 1999,2 (2):
109-113)。
[23]Senthil-Kumar M,Mysore K S.New dimensions for VIGS in plant
functional genomics[J].Trends in plant science,2011,16(12):656-665(Senthil-
Kumar M, the Mysore K S.VIGS new feature in terms of Functional Plant Genomics. plant science trend, 2011,16
(12):656-665.)。
[24]Kumagai M,Donson J,Della-Cioppa G,et al.Cytoplasmic inhibition of
carotenoid biosynthesis with virus-derived RNA[J].Proceedings of the National
Academy of Sciences,1995,92(5):1679-1683(Kumagai M,Donson J,Della-Cioppa G,et
Al. limit with the Cytoplasm of virus-mediated RNA biosynthesis carotenoid. National Academy of Sciences, 1995,92 (5):
1679-1683)。
[25]Ruiz M T,Voinnet O,Baulcombe D C.Initiation and maintenance of
virus-induced gene silencing[J].The Plant Cell Online,1998,10(6):937-946(Ruiz
Initial and the maintenance of M T, Voinnet O, Baulcombe D C. virus induced gene silencing. plant cell is online, and 1998,
10(6):937-946)
[26]Kjemtrup S,Sampson K S,Peele C G,et al.Gene silencing from plant
DNA carried by a geminivirus[J].The Plant Journal,1998,14(1):91-100(Kjemtrup
The DNA of plants gene silencing that S, Sampson KS, Peele C G, et al. are induced by geminivirus infection. Plant J, 1998,
14(1):91-100.)。
[27]Ratcliff F,Martin-Hernandez A M,Baulcombe D C.Technical advance:
tobacco rattle virus as a vector for analysis of gene function by silencing
[J].The Plant Journal,2001,25(2): 237-245(Ratcliff F,Martin-Hernandez A M,
Baulcombe D C. technical progress: Tobacco rattle virus is by the reticent carrier as a gene function analysis. plant is miscellaneous
Will, 2001,25 (2): 237-245).
[28]Liu Y,Schiff M,DineshKum-ar S.Virus-induced gene silencing in
tomato[J].The Plant Journal,2002,31(6):777-786(Liu Y,Schiff M,DineshKum-ar S.
Virus induced gene silencing in Fructus Lycopersici esculenti. Plant J, Journal, 2002,31 (6): 777-786).
[29]Liu H,Reavy B,Swanson M,et al.Functional Replacement of the
Tobacco rattle virus Cysteine-rich Protein by Pathogenicity Proteins from
Unrelated Plant Viruses[J].Virology,2002,298(2):232-239(Liu H,Reavy B,Swanson
M, et al. Tobacco rattle virus rich in cysteine albumen by from corresponding plants virus pathogenicity proteins function replacement.
Virusology, 2002,298 (2): 232-239).
[30]Valentine T,Shaw J,Blok V C,et al.Efficient virus-induced gene
silencing in roots using a modified tobacco rattle virus vector[J].Plant
Physiology, 2004,136 (4): 3999-4009 (Valentine T, Shaw J, Blok V C, et al. use one change
The tobacco virus carrier made is effective virus induced gene silencing in root. plant physiology, and 2004,136 (4): 3999-
4009)。
[31]Peele C,Jordan C V,Muangsan N,et al.Silencing of a meristematic
gene using Geminivirus-derived vectors[J].The Plant Journal,2001,27(4):357-
366 (Peele C, Jordan C V, Muangsan N, et al. use the reticent separate living tissue gene of geminivirus infection carrier.
Plant J, 2001,27 (4): 357-366).
[32]Hileman L C,Drea S,Martino G,et al.Virus-induced gene silencing
is an effective tool for assaying gene function in the basal eudicot species
Papaver somniferum(opium poppy)[J].The Plant Journal,2005,44(2):334-341
(Hileman L C, Drea S, Martino G, et al. virus induced gene silencing is the dicotyledonous of an analysis foundation
The effective tool of the gene function of species Papaver somniferum. Plant J, 2005,44 (2): 334-341).
[33]Holzberg S,Brosio P,Gross C,et al.Barley stripe mosaic virus-
induced gene silencing in a monocot plant[J].The Plant Journal,2002,30(3):
(Holzberg S, Brosio P, Gross C, et al. is barley stripe mosaic virus induction in monocotyledon for 315-327
Gene silencing. Plant J, 2002,30 (3): 315-327).
[34]Ding X S,Schneider W L,Chaluvadi S R,et al.Characterization of a
Brome mosaic virus strain and its use as a vector for gene silencing in
monocotyledonous hosts[J].Molecular Plant-Microbe Interactions,2006,19(11):
1229-1239 (feature of Ding X S, Schneider W L, Chaluvadi S R, et al. bromovirus strain and
It is as a gene silencing vector monocotyledon host. molecule plant and molecule microbial interaction, and 2006,19
(11):1229-1239.)
[35]Khan AM1,Ashfaq M,Kiss Z,Khan AA,Mansoor S,Falk BW.Use of
recombinant tobacco mosaic virus to achieve RNA interference in plants
against the citrus mealybug,Planococcus citri(Hemiptera:Pseudococcidae).PLoS
One.2013,9；8 (9): e73657) (Khan AM1, Ashfaq M, Kiss Z, Khan AA, Mansoor S, Falk BW. makes
Obtain the RNA to citrus mealy bug with restructuring tobacco mosaic virus (TMV) and disturb .PLoS One.2013,9；8(9):e73657).
In sum, it has been found that plant viral vector is for the application in terms of strengthening plant anti-insect performance only
Being that the RNA to insecticide disturbs, cucumber mosaic virus poisonous carrier is not reported in terms of strengthening plant anti-insect performance, cucumber mosaic virus
Poison weak virulence carrier is not by reporting in terms of expressing anti insect gene to strengthen plant anti-insect performance.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of cucumber mosaic virus weak virulence carrier and is strengthening plant anti-insect
The application of aspect of performance.
In order to solve above-mentioned technical problem, the present invention provides a kind of cucumber mosaic virus (CMV) weak virulence carrier strengthening
Application in terms of plant anti-insect performance.
As the cucumber mosaic virus weak virulence carrier of the present invention in the improvement of the application strengthened in terms of plant anti-insect performance:
The construction method of described cucumber mosaic virus weak virulence carrier comprises the steps:
1), transformation virus CMV becomes the low virus expression vector of disappearance 2b gene order；Particularly as follows:
The method that one of the viral CMV infectious clone plasmid built pCB-CMVF209 uses enzyme action to connect is changed
Make, make 2b gene delection, and add restriction enzyme site, be configured to the virus expression carrier of weak virulence---low virus carrier；
2), by anti insect gene coding region (ORF) sequence inserting step 1) the low virus vector construction of gained restructuring low virus
Expression vector；
The restructuring low virus expression vector containing anti insect gene coding region sequence building gained is used for strengthening plant to insect
Resistance.
Cucumber mosaic virus weak virulence carrier as the present invention enters one strengthen the application in terms of plant anti-insect performance
Step is improved:
Described step 1) in restriction enzyme site be: Stu I, Mlu I, Spe I, Apa I, BamH I, Sac II.
Cucumber mosaic virus weak virulence carrier as the present invention enters one strengthen the application in terms of plant anti-insect performance
Step is improved:
Described step 1) specifically include following steps:
1., with CMV sequence as template, restriction enzyme site forward and reverse primer be:
Add the NcoIF2:CATGCcatggctgagtttgcctg of restriction enzyme site Nco I；
Add the 2aORF1R:gaAGGCCTTCTAaattctttcgctgtttgttgg of restriction enzyme site Stu I；
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Nco I, Stu I enzyme action PCR primer,
Purification；
2. at least 1 restriction enzyme site in Stu I and Mlu I, Spe I, Apa I, BamH I, is selected to add forward primer
5 ', design 5 ' add Avr II restriction enzyme sites reverse primers；
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Stu I, Avr II enzyme action PCR primer,
Purification；
3., with Nco I, Avr II digested plasmid pCB-CMVF209；
4., use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a；
5. the bacterium colony liquid culture again, to above-mentioned conversion obtained, extract plasmid, use Nco I, Avr II enzyme action identify and
(or) PCR qualification (finally giving the order-checking of order-checking company to identify), obtain building correct plasmid pCB-CMVF209-no2b, preserve standby
With.
Cucumber mosaic virus weak virulence carrier as the present invention enters one strengthen the application in terms of plant anti-insect performance
Step is improved:
Described step 2. in forward primer: GAAGGCCTGACGCGTGACTAGTgggcccGGGATCCccgcggAA
Cctccccttccgcatct (for 2bORF333F)；Or by GAAGGCCTWith sequence
GACGCGTGACTAGTgggcccGThe sequence of at least 1 restriction enzyme site in GGATCCccgcgg and sequence AA
Cctccccttccgcatct forms；
Described step 2. in reverse primer be AvrIIR:Cttccgaagaaacctaggag.
Specifically, above-mentioned forward primer is following arbitrary:
Forward primer: GAAGGCCTGGGATCCAACctccccttccgcatct；
Forward primer: GAAGGCCTGGACTAGTgggcccGGGATCCAACctccccttccgcatct
Forward primer:
GAAGGCCTGACGCGTGACTAGTgggcccGGGATCCccgcggAACctccccttccgcatct。
Cucumber mosaic virus weak virulence carrier as the present invention enters one strengthen the application in terms of plant anti-insect performance
Step is improved:
Described step 2) specifically include following steps:
1., based on anti insect gene coding region (ORF) sequence, design adds restriction enzyme site Stu I or Mlu I or Spe I
Or Apa I or the forward primer of BamH I, add the reverse of restriction enzyme site Mlu I or Spe I or Apa I or BamH I or Sac II
Primer (but restriction enzyme site added by reverse primer must be the later restriction enzyme site at the restriction enzyme site added by forward primer)；With
Plasmid containing genes of interest is template, PCR amplifying target genes, purification, with the enzyme enzyme action of restriction enzyme site added by forward and reverse primer
PCR primer, purification；
2., with the step of above-mentioned steps 1. (that is, step 2) 1.) identical enzyme digested plasmid pCB-CMVF209-no2b；
3., use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a；
3. the bacterium colony liquid culture obtained above-mentioned conversion, extracts plasmid, uses identical with above-mentioned 1. (that is, 2. (1))
Enzyme enzyme action is identified, and (or) carries out PCR qualification (finally sending the order-checking of order-checking company to identify), obtains building correct plasmid pCB-
CMVF209no2b-gene.Save backup.
Plasmid pCB-CMVF209no2b-gene, particularly as follows: pCB-CMVF209no2b-ASMLL, pCB-
CMVF209no2b-RccI、pCB-CMVF209no2b-MaARSEF。
Invent and utilized cucumber mosaic virus cucumber mosaic virus (CMV) to be transformed into plant is not caused a disease
Property low virus expression vector, be applied to express anti insect gene, strengthen plant anti-insect performance.
The total concrete scheme of the present invention is as follows:
1, one of the viral CMV infectious clone plasmid built pCB-CMVF209 is used the method that enzyme action connects
(specific) transforms, and makes 2b gene delection, and adds restriction enzyme site, is configured to the virus expression carrier pCB-of weak virulence
CMVF209no2b。
Specifically:
(1) with CMV sequence as template, design adds forward and reverse primer.NcoIF2:CATGCcatggctgagtttgcctg；
2aORF1R:gaAGGCCTTCTAaattctttcgctgtttgttgg.With plasmid pCB-CMVF209 as template, PCR expands synthesis
PCR primer, with Nco I, Stu I enzyme action PCR primer, purification, standby.
(2) select at least 1 restriction enzyme site in Stu I and Mlu I, Spe I, Apa I, BamH I, Sac II to add forward to draw
5 ' ends of thing, shape such as 2bORF333F:GAAGGCCTGACGCGTGACTAGTgggcccGGGATCCccgcggAACctccccttcc
gcatct；Design at 5 ' the reverse primer AvrIIR:Cttccgaagaaacctaggag adding Avr II restriction enzyme site.With plasmid
PCB-CMVF209 is template, PCR amplification synthesis PCR primer, with Stu I, Avr II enzyme action PCR primer, and purification, standby.
(3) with Nco I, Avr II digested plasmid pCB-CMVF209, standby.
(4) use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a.
(5), choosing colony liquid culture again, extraction plasmid, employing Nco in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, Avr II enzyme action is identified and (or) PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid pCB-
CMVF209-no2b saves backup.
2, anti insect gene coding region (ORF, less than 700bp) sequence is inserted low virus vector construction expression of recombinant virus to carry
Body.Specifically:
(1), based on anti insect gene coding region (ORF) sequence, design adds restriction enzyme site Stu I or Mlu I or Spe I
Or Apa I or the forward primer of BamH I, 5 ' end about the 20bp sequences of shape such as GeneMluF:cgAcgcgt-gene ORF, example
As:cgAcgcgtatgagcccagaacgacgcc；Add restriction enzyme site Mlu I or Spe I or Apa I or BamH I or Sac
The reverse primer of II (but restriction enzyme site added by reverse primer must be the later enzyme action at the restriction enzyme site added by forward primer
Site), 3 ' end about the 20bp sequences of shape such as GeneBamR:CGggatcc-gene ORF, such as:
CGggatcctcagatctcggtgacgggca.(can be looked into by NCBI storehouse with the such as pMD18-gene of the plasmid containing genes of interest
Obtaining genes of interest sequence, by gene chemical synthesis, company synthesizes, and is built into plasmid pMD18-gene；Or genes of interest is by this gene
Originating species or microorganism use Trizol method to extract total serum IgE, by RT-PCR kit description, draw with the forward of genes of interest
Thing and reverse primer are RT-PCR and obtain, and are then built into plasmid pMD18-ASMLL by the operation of pMD18 carrier operation instructions)
For template, PCR amplifying target genes, with the enzyme enzyme action PCR primer of restriction enzyme site added by forward and reverse primer, purification, standby.
(2) with the enzyme digested plasmid pCB-CMVF209-no2b identical with 2. (1), standby.
(3) use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a.
(4), in above-mentioned conversion cultivate and grow choosing colony liquid culture again in the flat board of bacterium colony, extract plasmid, use with
2. the enzyme enzyme action that (1) is identical is identified and (or) PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid
PCB-CMVF209no2b-gene saves backup.
3, the restructuring low virus expression vector pCB-CMVF209no2b-gene containing anti insect gene is converted Agrobacterium, specifically
Method is known method.
4, plasmid Agro-Bacterium soaking method is by pCB-CMVF209no2b-gene, pCB-CMVF109, pCB-CMV309 plasmid agriculture
Bacillus mixing infiltration inoculation 4-6 leaf age plantling leaf, concrete grammar is known method.
5, inoculation Seedling incubated at room temperature is after 8 days, can Seedling management routinely.
6, by plant leaf feeding target pest more than inoculation leaf, the growth promoter speed of insect is significantly reduced.
In the present invention, plasmid pMD18-ASMLL can be public by gene chemical synthesis by checking in ASMLL gene order in NCBI storehouse
Department's synthesis, is built into plasmid pMD18-ASMLL；Or ASMLL gene is extracted total serum IgE by Bulbus Allii, illustrates by RT-PCR kit
Book, is RT-PCR with primer ASMLLBamR and ASMLLMluF and obtains, and is then built into by the operation of pMD18 carrier operation instructions
Plasmid pMD18-ASMLL.
Remaining is similar.
Attached: by containing the RNA of genes of interest from source plant extract, to build the scheme of pMD18-ASMLL.ASMLL gene
Extracted total serum IgE by Bulbus Allii, by RT-PCR kit description, be RT-PCR with primer ASMLLBamR and ASMLLMluF and obtain,
Then being built into plasmid pMD18-ASMLL by the operation of pMD18 carrier operation instructions, scheme is specific as follows:
One, plant Total RNAs extraction
Take the tobacco plant non-seeded blade after inoculating 10 days (leaf above inoculation leaf) and extract total serum IgE, specifically side
Method is with reference to invitrogen company's T rizol reagent description, and operating procedure is with reference to Zhang Si.
1) weigh 0.2g inoculation blade to be placed in the mortar of cleaning, add appropriate liquid nitrogen grinding fully to powder.
2) powder after grinding is transferred in the 2ml centrifuge tube of cleaning, adds 1ml Trizol reagent and turns upside down mixed
Even, place 10min on ice.
3) adding 300 μ l chloroforms in extracting solution again, shaken well is placed in 10min on ice.
4) 4 DEG C, 14 000rpm are centrifuged 15min.
5) the careful supernatant 500 μ l that draws is placed in new centrifuge tube, adds isopyknic chloroform, and vortex vibrates, and puts on ice
Put 10min.
6) 4 DEG C, 14 000rpm are centrifuged 15min.
7) the careful supernatant 300 μ l that draws is placed in new centrifuge tube, adds the isopropanol of equal-volume pre-cooling, overturns mixing ,-
Place 30min for 20 DEG C.
8) 4 DEG C, 14 000rpm are centrifuged 15min, remove supernatant.
9) the ethanol wash precipitation of the 75% of the water configuration that addition DEPC processes, places 5min on ice.
10) 4 DEG C, 14 000rpm are centrifuged 15min.(this step repeatable is once)
11) ethanol (can be evaporated) is removed in room temperature placement volatilization with vacuum desiccator, adds what 30 μ l DEPC processed
Water dissolution precipitates, and-80 DEG C of storages are stand-by.
The synthetic system of Step1:cDNA is as follows:
RNA template 2 μ l
R reverse primer (ASMLLBamR) 1 μ l
DEPC Treated water 2.5μl
Mix rear 65 DEG C of degeneration 10min, place 5min on ice, the centrifugal several seconds, be sequentially added into:
Mix homogeneously is centrifuged the several seconds and carries out reverse transcription reaction, arranges parameter as follows:
42℃ 60min
70℃ 15min
Reaction end be placed on-20 DEG C stand-by.
Step2: reverse transcription product PCR is expanded
PCR system is provided that
Being provided that of PCR condition
After reaction terminates, PCR primer is carried out agargel electrophoresis, use kits to reclaim.
The PCR primer of recovered purification is connected with pMD18-T carrier, is i.e. sequentially added into following in the centrifuge tube of 0.2mL
Reagent: in 0.5mL centrifuge tube, is sequentially added into following reagent:
Centrifugal 3sec after mixing gently, 4 DEG C connect overnight.
Two, recombinant plasmid transformed
1) 100 μ L competent cell HB101 (TaKaRa company) add the connection product of 10 μ L, gently after mixing, ice
Upper standing 30min；
2) above-mentioned centrifuge tube is transferred to thermal shock 60s in 42 DEG C of waters bath with thermostatic control, puts 5min on ice immediately；
3) the LB fluid medium (37 DEG C of preheatings) of 600 μ L is added；
4) 37 DEG C, 150rpm, 1hr cultivated by shaking table；
5) take the bacterium solution after 200 μ L convert in super-clean bench, be spread evenly across the LB solid plate containing Amp (100 μ g/mL)
On；Flat board is inverted after just putting 30min in 37 DEG C of incubators and is cultivated 12-16hr.
Three, alkaline process prepares recombinant plasmid dna
1) picking positive list colony inoculation is in 1mL contains the LB culture medium of Amp (100 μ g/mL) (1.5mL centrifuge tube), and 37
DEG C, 200rpm shaken cultivation 8-16h；
2) low-speed centrifugal collects thalline (5000rpm, 2min)；
3) during thalline is suspended in 150 μ L solution I, abundant vortex；
4) add 150 μ L solution II, overturn 3 times the most gently；
5) add 200 μ L solution III, overturn the most gently 3 times, fully spread；
6) 500 μ L chloroform, abundant vortex mixing 1min are added；
7) 4 DEG C, 12000rpm is centrifuged 10min, carefully draws supernatant, is placed in new 1.5mL centrifuge tube；
8) 400 μ L isopropanols are added, reverse mixing ,-20 DEG C of precipitation 30min；
9) 4 DEG C, 12000rpm is centrifuged 10min, abandons supernatant；
10) precipitation washed by 200 μ L 75% ethanol, and 12000rpm is centrifuged 3min, abandons supernatant, precipitation vacuum drying 3min；
11) precipitation is dissolved in 50 μ L RTE (RNase A 10 μ g/mL), is placed in 37 DEG C of incubator 30min；
Take 3 μ L 1.0% agarose gel electrophoresis detections.
Choosing colony liquid culture again in above-mentioned conversion cultivation grows the flat board of bacterium colony, extracts plasmid, uses pMD18 to carry
Restriction enzyme site enzyme action on body, uses sequencing primer to be PCR and identifies, finally send the order-checking of order-checking company to identify, obtains building correct
Plasmid pMD18-ASMLL.
In the present invention, plasmid pMD18-Rcc I is by checking in RccI gene order in NCBI storehouse, by gene chemical synthesis, company closes
Become, be built into plasmid pMD18-RccI；Or RccI gene can be extracted total serum IgE by Folium Ricini, by RT-PCR kit description,
It is RT-PCR with primer Rcc IBamR and Rcc ISpeF to obtain, is then built into matter by the operation of pMD18 carrier operation instructions
Grain pMD18-RccI, concrete scheme can refer to the constructing plan of plasmid pMD18-ASMLL.
In the present invention, plasmid pMD18-MaARSEF is by checking in MaARSEF gene order in NCBI storehouse, by gene chemical synthesis
Company synthesizes, and is built into plasmid pMD18-MaARSEF；Or MaARSEF gene is extracted total serum IgE by green muscardine fungus, try by RT-PCR
Agent box description, is RT-PCR with primer MaARSEFMluR and MaARSEFStuF and obtains, then press pMD18 carrier operation instruction
Book operation is built into plasmid pMD18-MaARSEF.Concrete scheme can refer to the constructing plan of plasmid pMD18-ASMLL.
The present invention has a following technical advantage:
1, constructing a carrier pCB-CMVF209no2b-gene containing anti insect gene, it has plant weak pathogenic
The performance of power, can be used in crop production.
2, after this carrier pCB-CMVF209no2b-gene being imported plant, plant can be obviously enhanced target pest is resisted
Property.
3, the present invention constructs a CMV containing anti insect gene and recombinates weak strain, to plant without Disease symptom and can
Move at Nicotiana plant middle and long distance.
Detailed description of the invention
Embodiment 1,
1, transformation virus CMV becomes the low virus expression vector of disappearance 2b gene order；Specifically include following steps:
(1) with CMV sequence for the forward and reverse primer of stencil design.
Add the primer NcoIF2:CATG of Nco I restriction enzyme siteCcatggctgagtttgcctg；
Add the primer 2 aORF1R:ga of Stu I restriction enzyme siteAGGCCTTCTAaattctttcgctgtttgttgg。
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Nco I, Stu I enzyme action PCR primer,
Purification, standby.
Described PCR amplification system is:
Described PCR amplification program is:
Note: 1, plasmid pCB-CMVF209, is the infectious clone of CMVF209 sequence, and concrete construction method is shown in Chinese agriculture
Science 2011,44 (14): 3060-3068).
(2) design adds the forward primer 2bORF333F of restriction enzyme site Stu I, Mlu I, BamH I:
GAAGGCCTGGGATCCAACctccccttccgcatct；Add restriction enzyme site 2bAvrII reverse primer 2bAvrIIR:
Cttccgaagaaacctaggag.With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Stu I, Avr
II enzyme action PCR primer, purification, standby.
Remarks illustrate:
GAAGGCCTGACGCGTGACTAGTgggcccGGGATCCccgcggAA Cctccccttccgcatct。
StuI MluI SpeI ApaI BamHI SacII；
Described PCR amplification system is:
Described PCR amplification program is:
(3) with Nco I, Avr II digested plasmid pCB-CMVF209, standby.
(4) use T4-DNA ligase test kit by step (1), step (2) enzyme action PCR primer simultaneously with step (3)
The plasmid product of the enzyme action of gained connects, and converts E. coli competent DH5a.
(5), choosing colony liquid culture again, extraction plasmid, employing Nco in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, Avr II enzyme action is identified and PCR identifies, finally send the order-checking of order-checking company to identify, obtains building correct plasmid pCB-
CMVF209-no2b saves backup.
2, anti insect gene Bulbus Allii agglutinin gene ASMLL (NCBI ID:EU 252577) coding region (ORF) sequence is inserted
Low virus vector construction recombinant virus expression vector.Specifically:
(1), design adds the forward primer ASMLLMluF of restriction enzyme site Mlu I:cgAcgcgt tgctgtacgaatacagc acc；Add the reverse primer ASMLL BamR:CGggatccttacagttccaggttgaatatc of restriction enzyme site BamH I.With matter
(by checking in ASMLL gene order in NCBI storehouse, by gene chemical synthesis, company synthesizes grain pMD18-ASMLL, is built into plasmid pMD18-
ASMLL；Or ASMLL gene is extracted total serum IgE by Bulbus Allii, by RT-PCR kit description, with primer ASMLLBamR and
ASMLLMluF is RT-PCR and obtains, and is then built into plasmid pMD18-ASMLL by the operation of pMD18 carrier operation instructions) it is mould
Plate, PCR amplification synthesis PCR primer, with Mlu I, BamH I enzyme action PCR primer, purification, standby.
Described PCR amplification system is:
Described PCR amplification program is identical with step 1 (1).
(2) with Mlu I, BamH I digested plasmid pCB-CMVF209-no2b, standby.
(3) use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a.
(4), choosing colony liquid culture again, extraction plasmid, employing Mlu in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, BamH I enzyme action is identified and PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid pCB-
CMVF209no2b-ASMLL saves backup.
3, conventional method is used, by the restructuring low virus expression vector pCB-CMVF209no2b-ASMLL containing anti insect gene
Convert Agrobacterium.
4, plasmid Agro-Bacterium soaking method is by pCB-CMVF209no2b-gene, pCB-CMVF109, pCB-CMVF309 (pCB-
The concrete construction method of CMVF109, pCB-CMVF309 is shown in Scientia Agricultura Sinica 2011,44 (14): 3060-3068) plasmid Agro-Bacterium
Mixing infiltration inoculation (known technology) 4-6 leaf age plantling leaf.
5, after inoculation Seedling incubated at room temperature 5-8 days, can Seedling management routinely.
6, with being grown in the blade feeding beet exigua larvae of more than inoculation leaf, Spodoptera litura larvae.Concrete outcome is as follows
Described in Tables 1 and 2.
Embodiment 2,
1, transformation virus CMV becomes the low virus expression vector of disappearance 2b gene order.
(1) with CMV sequence for the forward and reverse primer of stencil design.
Add the forward primer NcoIF2:CATGCcatggctgagtttgcctg of restriction enzyme site Nco I；
Add the reverse primer 2aORF1R:gaAGGCCTT of restriction enzyme site Stu ICTAaattctttcgctgtttgttg。
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Nco I, Stu I enzyme action PCR primer,
Purification, standby.
(2) design adds the forward primer 2bORF333F of restriction enzyme site Stu I, Spe I, Apa I, BamH I:
GAAGGCCTGGACTAGTgggcccGGGATCCAACctccccttccgcatct；Reverse primer 2bAvrIIR:
Cttccgaagaaacctaggag.With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Stu I, Avr
II enzyme action PCR primer, purification, standby.
(3) with Nco I, Avr II digested plasmid pCB-CMVF209, standby.
(4) use T4-DNA ligase test kit by step (1), PCR primer and step (3) gained of step (2) enzyme action
The PCR primer of enzyme action be connected with the plasmid product of enzyme action, convert E. coli competent DH5a.
(5), choosing colony liquid culture again, extraction plasmid, employing Nco in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, Avr II enzyme action is identified and PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid pCB-CMVF209-
No2b saves backup.
2, Semen Ricini chitinase gene Rcc I (NCBI ID:XM002525695) coding region (ORF) sequence is inserted weak disease
Poisonous carrier construction of recombinant virus expression vector.Specifically:
(1), design adds the forward primer Rcc ISpeF of restriction enzyme site Spe I:gactagtatgtctaggaaaaaaggga
gag；Add the reverse primer Rcc IBamR:CG of restriction enzyme site BamH Iggatcc CGggatccttacagttccaggttgaata
tc.With plasmid pMD18-Rcc I, (by checking in RccI gene order in NCBI storehouse, by gene chemical synthesis, company synthesizes, and is built into matter
Grain pMD18-RccI；Or RccI gene can be extracted total serum IgE by Folium Ricini, by RT-PCR kit description, with primer Rcc
IBamR and Rcc ISpeF is RT-PCR and obtains, and is then built into plasmid pMD18-by the operation of pMD18 carrier operation instructions
RccI, concrete scheme is similar to example 1.) it is template, PCR amplification synthesis PCR primer, produce with Spe I, BamH I enzyme action PCR
Thing, purification, standby.
Described PCR amplification system is:
Described PCR amplification program is equal to the 2 (1) of embodiment 1.
(2) with Spe I, BamH I digested plasmid pCB-CMVF209-no2b, standby.
(3) use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a.
(4), choosing colony liquid culture again, extraction plasmid, employing Spe in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, BamH I enzyme action is identified and PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid pCB-
CMVF209no2b-RccI saves backup.
3, use conventional method, the restructuring low virus expression vector pCB-CMVF209no2b-RccI containing anti insect gene is turned
Change Agrobacterium.
4, plasmid Agro-Bacterium soaking method is by pCB-CMVF209no2b-RccI, pCB-CMVF109, pCB-CMVF309 plasmid
Agrobacterium mixes, infiltration inoculation 4-6 leaf age plantling leaf.
5, after inoculation Seedling incubated at room temperature 5-8 days, can Seedling management routinely.
6, with being grown in the blade feeding beet exigua larvae of more than inoculation leaf, Spodoptera litura larvae.Concrete outcome is as follows
Described in Tables 1 and 2.
Embodiment 3,
1, transformation virus CMV becomes the low virus expression vector of disappearance 2b gene order.
(1) with CMV sequence for the forward and reverse primer of stencil design.
Add the forward primer NcoIF2:CATGCcatggctgagtttgcctg of restriction enzyme site Nco I；
Add the 2aORF1R:gaAGGCCTT of restriction enzyme site Stu ICTAaattctttcgctgtttgttg。
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Nco I, Stu I enzyme action PCR primer,
Purification, standby.
(2) design adds the forward primer of restriction enzyme site Stu I, Mlu I, Spe I, Apa I, BamH I, Sac II
2bORF333F:GAAGGCCTGACGCGTGACTAGTgggcccGGGATCCccgcggAACctccccttccgcatct；Reversely draw
Thing 2bAvrIIR:Cttccgaagaaacctaggag.With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with
Stu I, Avr II enzyme action PCR primer, purification, standby.
(3) with Nco I, Avr II digested plasmid pCB-CMVF209, standby.
(4) use T4-DNA ligase test kit by step (1), PCR primer and step (3) gained of step (2) enzyme action
Enzyme action plasmid product connect, convert E. coli competent DH5a.
(5), choosing colony liquid culture again, extraction plasmid, employing Nco in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, Avr II enzyme action is identified and PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid pCB-CMVF209-
No2b saves backup.
2, by anti insect gene green muscardine fungus chitinase gene M aARSEF (NCBI ID:XM 007827732) coding region
(ORF) sequence inserts low virus vector construction recombinant virus expression vector.Specifically:
(1), design adds the forward primer MaARSEFStuF of restriction enzyme site Stu I:
aaggcctatgaagctctcccttctcttc；Add the reverse primer MaARSEFMluR of restriction enzyme site Mlu I:cgAcgcgtctaccacgtcttgaaatgg。
With plasmid pMD18-MaARSEF as template, PCR amplification synthesis PCR primer, produce with Stu I, Mlu I enzyme action PCR
Thing, purification, standby.
(2) with Stu I, Mlu I digested plasmid pCB-CMVF209-no2b, standby.
(3) use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert large intestine
Bacillus competence DH5a.
(4), choosing colony liquid culture again, extraction plasmid, employing Stu in above-mentioned conversion cultivation grows the flat board of bacterium colony
I, Mlu I enzyme action is identified and PCR identifies, finally send the order-checking of order-checking company to identify, will build correct plasmid pCB-
CMVF209no2b-MaARSEF saves backup.
3, conventional method is used, by the restructuring low virus expression vector pCB-CMVF209no2b-containing anti insect gene
MaARSEF converts Agrobacterium.
4, plasmid Agro-Bacterium soaking method is by pCB-CMVF209no2b-MaARSEF, pCB-CMVF109, pCB-CMVF309
Plasmid Agro-Bacterium mixes, infiltration inoculation 4-6 leaf age plantling leaf.
5, after inoculation Seedling incubated at room temperature 5-8 days, can Seedling management routinely.
6, with being grown in the blade feeding beet exigua larvae of more than inoculation leaf, Spodoptera litura larvae.Concrete outcome is as follows
Described in Tables 1 and 2.
Reference examples, 4-6 leaf age tobacco plant, do not inoculate any liquid or inoculation clear water, and same cultivation 5-8 days, as right
According to.
Experimental result:
Embodiment 1 gained tobacco leaf, embodiment 2 gained tobacco leaf, embodiment 3 gained tobacco leaf, compare Nicotiana tabacum L.
Blade, Prodenia litura, beet armyworm take food above-mentioned blade respectively, often process and set 3 wares (repeating for 3 times), put 4 sizes one in every ware
The 1-2 instar larvae caused, weighs before and after test, and 25 DEG C of indoor are raised with each process leaf respectively.
Table 1, Spodoptera litura larvae take food 72 hours after Gain weight (g/ head)
Table 2, beet exigua larvae take food 72 hours after Gain weight (g/ head)
Contrast according to above-mentioned data:
During feeding Spodoptera litura larvae, the growth rate of the Spodoptera litura larvae of embodiment 1,2,3 is than the twill of reference examples
Exigua larvae growth rate reduces 51.6%, 34.1%, 28.7% respectively.
During feeding beet exigua larvae, the growth rate of the beet exigua larvae of embodiment 1,2,3 is than the Radix Betae of reference examples
Exigua larvae growth rate reduces 34.5%, 22.5%, 20% respectively.
It should be noted that these genes are not the genes of typical anti-lepidoptera pest, but it is anti-also to find that it has
The effect of lepidoptera pest.
Finally, in addition it is also necessary to be only several specific embodiments of the present invention it is noted that listed above.Obviously, this
Bright it is not limited to above example, it is also possible to have many deformation.Those of ordinary skill in the art can be from present disclosure
The all deformation directly derived or associate, are all considered as protection scope of the present invention.
Claims (6)
1. cucumber mosaic virus weak virulence carrier application in terms of strengthening plant anti-insect performance.
The cucumber mosaic virus weak virulence carrier the most according to claim 1 application in terms of strengthening plant anti-insect performance,
It is characterized in that:
The construction method of described cucumber mosaic virus weak virulence carrier comprises the steps:
1), transformation virus CMV becomes to lack the low virus expression vector of 2b gene order:
The method transformation that one of the viral CMV infectious clone plasmid built pCB-CMVF209 uses enzyme action connect, makes
2b gene delection, and add restriction enzyme site, it is configured to the virus expression carrier of weak virulence---low virus carrier；
2), by anti insect gene coding region (ORF) sequence inserting step 1) the low virus vector construction of gained restructuring low virus expresses
Carrier；
Insect is resisted by the restructuring low virus expression vector containing anti insect gene coding region sequence building gained for strengthening plant
Property.
The cucumber mosaic virus weak virulence carrier the most according to claim 2 application in terms of strengthening plant anti-insect performance,
It is characterized in that:
Described step 1) in restriction enzyme site be: Stu I, Mlu I, Spe I, Apa I, BamH I, Sac II.
4. according to the answering in terms of strengthening plant anti-insect performance of the cucumber mosaic virus weak virulence carrier described in Claims 2 or 3
With, it is characterized in that:
Described step 1) specifically include following steps:
1., with CMV sequence as template, design adds the forward and reverse primer of restriction enzyme site:
Add the forward primer NcoIF2:CATGCcatggctgagtttgcctg of restriction enzyme site Nco I；
The reverse primer adding restriction enzyme site Stu I is following arbitrary:
gaAGGCCTTCTAaattctttcgctgtttgttgg；
gaAGGCCTTCTAaattctttcgctgtttgttg；
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Nco I, Stu I enzyme action PCR primer, purification；
2. at least 1 restriction enzyme site in Stu I and Mlu I, Spe I, Apa I, BamH I, is selected to add forward primer
5 ', design at the 5 ' reverse primers adding Avr II restriction enzyme site；
With plasmid pCB-CMVF209 as template, PCR amplification synthesis PCR primer, with Stu I, Avr II enzyme action PCR primer, pure
Change；
3., with Nco I, Avr II digested plasmid pCB-CMVF209；
4., use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert escherichia coli
Competence DH5a；
5. the bacterium colony liquid culture again, to above-mentioned conversion obtained, extract plasmid, use Nco I, Avr II enzyme action identify and/or
PCR identifies, obtains building correct plasmid pCB-CMVF209-no2b.
The cucumber mosaic virus weak virulence carrier the most according to claim 4 application in terms of strengthening plant anti-insect performance,
It is characterized in that:
Described step 2. in forward primer: GAAGGCCTGACGCGTGACTAGTgggcccGGGATCCccgcggAA
Cctccccttccgcatct (for 2bORF333F)；Or by GAAGGCCTWith sequence
GACGCGTGACTAGTgggcccGThe sequence of at least 1 restriction enzyme site in GGATCCccgcgg and sequence AA
Cctccccttccgcatct forms；
Described step 2. in reverse primer be AvrIIR:Cttccgaagaaacctaggag.
6. according to the answering in terms of strengthening plant anti-insect performance of the cucumber mosaic virus weak virulence carrier described in Claims 2 or 3
With, it is characterized in that:
Described step 2) specifically include following steps:
1., based on anti insect gene coding region (ORF) sequence, design adds restriction enzyme site Stu I or Mlu I or Spe I or Apa
The forward primer of I or BamH I, adds restriction enzyme site Mlu I or Spe I or Apa I or BamH I or the reverse primer of Sac II；
With the plasmid containing genes of interest as template, PCR amplifying target genes, purification, with the enzyme enzyme of restriction enzyme site added by forward and reverse primer
Cut PCR primer, purification；
2., with the enzyme digested plasmid pCB-CMVF209-no2b the most identical with above-mentioned steps；
3., use T4-DNA ligase test kit the PCR primer of enzyme action to be connected with the plasmid product of enzyme action, convert escherichia coli
Competence DH5a；
4., from the bacterium colony that above-mentioned conversion obtains, select some bacterium colonies and carry out liquid culture, extraction plasmid, employing and above-mentioned 1. phase
Same enzyme enzyme action is identified, performing PCR of going forward side by side is identified and order-checking is identified, obtains building correct plasmid pCB-CMVF209no2b-
gene。
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510194134 | 2015-04-22 | ||
| CN2015101941346 | 2015-04-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105907781A true CN105907781A (en) | 2016-08-31 |
Family
ID=56751732
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610257242.8A Pending CN105907781A (en) | 2015-04-22 | 2016-04-22 | Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105907781A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486148A (en) * | 2018-03-29 | 2018-09-04 | 山东农业大学 | The weak malicious mutant plasmids carriers of cucumber mosaic virus RNA2 of the genetic fragments of PDS containing tobacco and its application |
| CN111334528A (en) * | 2020-03-20 | 2020-06-26 | 山东农业大学 | Mink enteritis parvovirus whole genome infectious clone and construction method and application thereof |
| CN111979263A (en) * | 2020-08-31 | 2020-11-24 | 湖南人文科技学院 | Low-toxicity cucumber mosaic virus vector, construction method and application |
| CN112424344A (en) * | 2018-07-03 | 2021-02-26 | 株式会社微生物化学研究所 | Attenuated cucumber mosaic virus strain |
| CN117363644A (en) * | 2023-12-07 | 2024-01-09 | 三亚中国农业科学院国家南繁研究院 | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182532A (en) * | 2007-11-13 | 2008-05-21 | 重庆医科大学 | Bifidobacteria-bacillus coli shuttle expression carrier pBES, bifidobacteria-ETEC CFA/I recombinant vector and uses thereof |
| CN103555749A (en) * | 2012-12-29 | 2014-02-05 | 湖北大学 | Method for in vitro efficient construction of multi-copy Pichia expression vector |
-
2016
- 2016-04-22 CN CN201610257242.8A patent/CN105907781A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182532A (en) * | 2007-11-13 | 2008-05-21 | 重庆医科大学 | Bifidobacteria-bacillus coli shuttle expression carrier pBES, bifidobacteria-ETEC CFA/I recombinant vector and uses thereof |
| CN103555749A (en) * | 2012-12-29 | 2014-02-05 | 湖北大学 | Method for in vitro efficient construction of multi-copy Pichia expression vector |
Non-Patent Citations (1)
| Title |
|---|
| KOUKI MATSUO ET AL: "Development of Cucumber mosaic virus as a vector modifiable for different host species to produce therapeutic proteins", 《PLANTA》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486148A (en) * | 2018-03-29 | 2018-09-04 | 山东农业大学 | The weak malicious mutant plasmids carriers of cucumber mosaic virus RNA2 of the genetic fragments of PDS containing tobacco and its application |
| CN108486148B (en) * | 2018-03-29 | 2021-07-13 | 山东农业大学 | Cucumber mosaic virus RNA2 attenuated mutant plasmid vector containing tobacco PDS gene segment and application thereof |
| CN112424344A (en) * | 2018-07-03 | 2021-02-26 | 株式会社微生物化学研究所 | Attenuated cucumber mosaic virus strain |
| CN111334528A (en) * | 2020-03-20 | 2020-06-26 | 山东农业大学 | Mink enteritis parvovirus whole genome infectious clone and construction method and application thereof |
| CN111334528B (en) * | 2020-03-20 | 2022-02-18 | 山东农业大学 | Mink enteritis parvovirus whole genome infectious clone and construction method and application thereof |
| CN111979263A (en) * | 2020-08-31 | 2020-11-24 | 湖南人文科技学院 | Low-toxicity cucumber mosaic virus vector, construction method and application |
| CN117363644A (en) * | 2023-12-07 | 2024-01-09 | 三亚中国农业科学院国家南繁研究院 | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application |
| CN117363644B (en) * | 2023-12-07 | 2024-02-09 | 三亚中国农业科学院国家南繁研究院 | VIGS silencing efficiency reporting plasmid, method for evaluating silencing efficiency and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2044204B1 (en) | Plant expression constructs and methods of utilizing same | |
| Lange et al. | Virus-induced gene silencing (VIGS) in plants: an overview of target species and the virus-derived vector systems | |
| Peyret et al. | When plant virology met Agrobacterium: the rise of the deconstructed clones | |
| CN105907781A (en) | Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant | |
| US8519113B2 (en) | Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants | |
| JP6850041B2 (en) | Protein expression system in plant cells and its use | |
| Liu et al. | A tobamovirus expression vector for agroinfection of legumes and Nicotiana | |
| Nagyová et al. | Infectious full-length clones of plant viruses and their use for construction of viral vectors | |
| Morilla et al. | A versatile transreplication-based system to identify cellular proteins involved in geminivirus replication | |
| Yoon et al. | Agrobacterium-mediated infection of whole plants by yellow dwarf viruses | |
| CN107338264B (en) | VIGS vectors for virus-mediated gene silencing | |
| AU2009269575B2 (en) | Plant expression constructs comprising and uses thereof | |
| CN105925603A (en) | Application of attenuated CMV (cucumber mosaic virus) vector expression resistance gene in enhancing plant herbicide resistance | |
| Bhattacharjee et al. | Geminivirus-derived vectors as tools for functional genomics | |
| CN105624170A (en) | Application of OsAGO18 protein or encoding gene of OsAGO18 protein to regulation and control on resistance of plants on RDV (Rice Dwarf Virus) or virus in same family as RDV | |
| CN106191108A (en) | Weak virulence CMV vector expression resistant gene strengthens the application of Genes For Plant Tolerance heavy metal performance | |
| JP6350995B2 (en) | Nucleic acid molecules and methods for expressing foreign genes in plants | |
| Yang et al. | A simple and effective system for foreign gene expression in plants via root absorption of agrobacterial suspension | |
| Elayabalan et al. | Genetic engineering in banana and plantain | |
| Habibi-Pirkoohi et al. | Transient Gene Expression: an Approach for Recombinant Vaccine Production | |
| Zaulda | Development of Virus Vectors and CRISPR Tools for Soybean Functional Genomics | |
| Qiao et al. | Efficient Protein Expression and Virus-Induced Gene Silencing in Plants Using a Crinivirus | |
| Donmez et al. | Transferring of rolABCD genes in some citrus rootstock through Agrobacterium rhizogenes | |
| Fan et al. | Transient expression of acidic fibroblast growth factor in pea (Pisum sativum L.) plants | |
| Wang et al. | Virus-induced gene silencing (VIGS) as a tool for functional genetic analysis in passion fruit plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160831 |