CN111979263A - Low-toxicity cucumber mosaic virus vector, construction method and application - Google Patents
Low-toxicity cucumber mosaic virus vector, construction method and application Download PDFInfo
- Publication number
- CN111979263A CN111979263A CN202010896645.3A CN202010896645A CN111979263A CN 111979263 A CN111979263 A CN 111979263A CN 202010896645 A CN202010896645 A CN 202010896645A CN 111979263 A CN111979263 A CN 111979263A
- Authority
- CN
- China
- Prior art keywords
- sequence
- mosaic virus
- cmvf209
- cucumber mosaic
- product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8203—Virus mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a low-toxicity cucumber mosaic virus vector, a construction method and application, wherein the low-toxicity cucumber mosaic virus vector comprises a pCB-CMVF209-no2b sequence with a deleted 2b gene sequence and an amino acid coding sequence 9-17aa connected to the pCB-CMVF209-no2b sequence, and the nucleotide sequence of the 9-17aa comprises at least 27 continuous basic groups in the sequence shown as SEQ ID NO. 1. The low-toxicity cucumber mosaic virus vector provided by the invention can infect host plants represented by common cultivated tobacco and does not show toxicity symptoms.
Description
Technical Field
The invention relates to the technical field of vector construction, in particular to a cucumber mosaic virus vector with low toxicity, a construction method and application.
Background
Cucumber Mosaic Virus (CMV) has a wide host range and is present in multiple strains, producing symptoms of varying severity on different plants. In the prior art, several viral expression vectors have been developed by cucumber mosaic virus. However, in the existing CMV virus expression vector, part of the virus vector can only be expressed on host plants of individual species, and the plants of part of the host species cannot be infected systemically. For example: matsuo K and the like develop a CMV vector with a completely deleted 2b gene sequence to Shidan and the like, and the CMV vector can only be used for systematically infecting a Nicotiana benthamiana plant and an Arabidopsis thaliana plant and does not show symptoms to the host plant, but the virus content of the systematically infected common cultivated tobacco (Nicotiana tabacum) plant is low and even the virus can not be detected. Other CMV expression vectors produce virulence symptoms in plants of the host species. By Chengdong et al, a CMV vector in which a 90-base 2b gene sequence was deleted was developed. WANG et al developed a CMV vector that retained the gene sequence of 2b protein 80 amino acids, but these two CMV vectors that retained the 2b gene sequence developed virulence symptoms after inoculation with plain-grown tobacco.
Therefore, there is a need to provide a novel cucumber mosaic virus vector with low toxicity to solve the above technical problems.
Disclosure of Invention
The invention mainly aims to provide a cucumber mosaic virus vector with low toxicity, a construction method and application, so as to solve the technical problems that the conventional cucumber mosaic virus vector can not infect common cultivated tobacco and can not express toxicity symptoms.
In order to achieve the purpose, the low-toxicity cucumber mosaic virus vector provided by the invention comprises a pCB-CMVF209-no2b sequence with a deleted 2b gene sequence and an amino acid coding sequence 9-17aa connected into the pCB-CMVF209-no2b sequence, wherein the nucleotide sequence of the 9-17aa comprises at least one continuous base in the sequence shown as SEQ ID NO. 1.
Preferably, the low virulence cucumber mosaic virus vector further comprises a plurality of polyclonal excision site sequences linked into the pCB-CMVF209-no2b sequence, the plurality of polyclonal excision site sequences comprising Stu I and at least one of Mlu I, Spe I, Apa I, Sma I, Ava I, BamH I and Sac II.
The invention also provides a construction method of the cucumber mosaic virus vector with low toxicity, which comprises the following steps:
taking an original pCB-CMVF209 plasmid, amplifying the original pCB-CMVF209 plasmid by using a primer containing an amino acid coding sequence of 9-17aa, and carrying out enzyme digestion on an amplification product to delete a 2b gene sequence so as to prepare an enzyme digestion product of a PCR product with the deletion of the 2b gene sequence and the amino acid coding sequence of 9-17 aa;
amplifying an original pCB-CMVF209 plasmid by using a primer containing a polyclonal enzyme cutting site sequence, and carrying out enzyme digestion on an amplification product by using an endonuclease corresponding to the polyclonal enzyme cutting site sequence to prepare an enzyme digestion product of a PCR product containing the polyclonal enzyme cutting site sequence;
step three, carrying out enzyme digestion on the original pCB-CMVF209 plasmid to obtain a large fragment product;
and step four, taking ligase to connect the enzyme digestion product prepared in the step one, the enzyme digestion product prepared in the step two and the large fragment product prepared in the step three, and preparing the low-toxicity cucumber mosaic virus vector.
Preferably, the first step includes:
taking an original pCB-CMVF209 plasmid, and amplifying by using an NcoIF primer and a 2aORF1R primer, wherein the NcoIF primer contains an Nco I enzyme cutting site sequence, and the 2aORF1R primer contains a Stu I enzyme cutting site sequence and amino acid coding sequences 9-17 aa;
and carrying out enzyme digestion and purification on the prepared amplification product through Nco I and Stu I enzymes to prepare an enzyme digestion product of a PCR product with 2b gene sequence deletion and amino acid coding sequence of 9-17 aa.
Preferably, the NcoIF primer is shown as SEQ ID NO.2, and the 2aORF1R primer is shown as SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO. 5.
Preferably, the second step includes:
amplifying the original pCB-CMVF209 plasmid by using a forward primer containing at least one of Mlu I, Spe I, Apa I, Sma I, Ava I, BamH I and Sac II and a sequence of Stu I polyclonal restriction site and a reverse primer containing a sequence of Avr II restriction site;
and carrying out enzyme digestion on the amplified product by using Stu I enzyme and Avr II enzyme to prepare an enzyme digestion product of the PCR product containing the polyclonal enzyme cutting site sequence.
Preferably, the forward primer in the second step contains Stu I, Mlu I and BamH I polyclonal excision site sequences, the forward primer in the second step is shown as SEQ ID NO.6, and the reverse primer is shown as SEQ ID NO. 7.
Preferably, the forward primer in the second step contains Stu I, Spe I, Apa I and BamH I polyclonal site sequences, the forward primer in the second step is shown as SEQ ID NO.8, and the reverse primer is shown as SEQ ID NO. 9.
Preferably, the third step includes:
carrying out enzyme digestion on the original pCB-CMVF209 plasmid by adopting enzymes Nco I and Avr II to obtain a large fragment product;
the fourth step comprises:
and (3) connecting the enzyme digestion product prepared in the step one, the enzyme digestion product prepared in the step two and the large fragment product prepared in the step three by using ligase, converting the enzyme digestion product into an escherichia coli competent cell, culturing and converting successfully-transformed escherichia coli, and extracting plasmids to prepare the low-toxicity cucumber mosaic virus vector.
The invention also provides an application of the low-toxicity cucumber mosaic virus vector on a cucumber mosaic virus host plant.
In the invention, the original pCB-CMVF209 plasmid is processed to delete the 2b gene sequence, and the nucleotide sequence of the amino acid coding sequence 9-17aa is added, so that the formed low-toxicity cucumber mosaic virus vector can not generate toxicity symptoms after infecting host plants, and can successfully and systematically infect the host plants represented by common cultivated tobacco.
Drawings
FIG. 1 is a map of the original pCB-CMVF209 plasmid sequence;
FIG. 2 is a sequence map of a cucumber mosaic virus vector with low virulence;
FIG. 3 is a graph showing the growth conditions of comparative example 1 in which tobacco of the common culture was inoculated for 30 days;
FIG. 4 is a graph showing the growth conditions of example 1, example 2 and example 3 for 30 days after inoculation of plain tobacco;
FIG. 5 is a graph showing the growth conditions of comparative example 1, example 2 and comparative example 2 after inoculation of tobacco for general cultivation of 45 days;
FIG. 6 is a graph showing the growth of comparative example 3 after incubation with CMVFny for 45 days;
FIG. 7 is an electrophoresis diagram of RT-PCR detection, which is shown from left to right: examples 1, 2, 3, Marker;
FIG. 8 is an electrophoresis diagram of RT-PCR detection, which is shown from left to right: marker, comparative example 3, comparative example 2, comparative example 1.
Detailed Description
The technical solutions in the embodiments of the present invention will be described clearly and completely below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In addition, the technical solutions in the embodiments of the present invention may be combined with each other, but it must be based on the realization of those skilled in the art, and when the technical solutions are contradictory or cannot be realized, such a combination of technical solutions should not be considered to exist, and is not within the protection scope of the present invention.
Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.
The invention provides a low-toxicity cucumber mosaic virus vector, which comprises a pCB-CMVF209-no2b sequence with a deleted 2b gene sequence and an amino acid coding sequence 9-17aa connected into the pCB-CMVF209-no2b sequence, wherein the nucleotide sequence of the 9-17aa is shown as SEQ ID NO. 1.
Referring to fig. 1, a sequence map of an original pCB-CMVF209 plasmid is shown in fig. 2, and the original pCB-CMVF209 plasmid is modified by digestion, ligation and transformation to form a low-virulence cucumber mosaic virus vector pCB-CMVF209-no2 b-AA-MCS. For convenience, the low-virulence cucumber mosaic virus vector provided by the invention is referred to as pCB-CMVF209-no2b-AA-MCS in the following.
Specifically, the original pCB-CMVF209 plasmid is a clone plasmid with infectivity constructed based on CMVF209, and the specific construction method of the original pCB-CMVF209 plasmid in the embodiment can be prepared by referring to Chinese agricultural science 2011,44(14): 3060-3068. Wherein, the original pCB-CMVF209 plasmid is processed to obtain pCB-CMVF209-no2b with the deleted 2b gene sequence. The 2b gene sequence is a gene sequence in CMV for coding 2b protein, mediates RNA silencing inhibition in the virus infection process and participates in long-distance movement and pathogenic action. The original pCB-CMVF209 plasmid was processed to add the amino acid coding sequence 9-17aa, which was likely to be used for long distance movement with low or no pathogenic effects. At least 27 consecutive bases in the sequence shown in SEQ ID NO.1 are used in the present invention to achieve the above-described functions. The influence on the long-distance moving ability is reduced by deleting the 2b gene sequence and adding the amino acid coding sequence 9-17aa, thereby reducing the pathogenic effect of the virus.
In the invention, the original pCB-CMVF209 plasmid is processed to delete the 2b gene sequence, so that the cucumber mosaic virus vector with low toxicity can not generate toxicity symptoms after infecting host plants; by adding the nucleotide sequence of the amino acid coding sequence 9-17aa, the cucumber mosaic virus vector with low toxicity can successfully and systematically infect the common cultivated tobacco plants.
Further, when the low-virulence cucumber mosaic virus vector construction process requires multiple cloning enzyme cleavage sites for ligation, the low-virulence cucumber mosaic virus vector also comprises multiple cloning enzyme cleavage sites, and a person skilled in the art can select a proper cloning enzyme cleavage site for realizing expression of an exogenous gene or gene silencing according to specific needs. In this embodiment, the low virulence cucumber mosaic virus vector further comprises a plurality of multiple cloning sites sequences linked to the pCB-CMVF209-no2b sequence, the plurality of multiple cloning sites sequences comprising Stu I and at least one of Spe I, Apa I, Sma I, Ava I, BamH I, and Sac II.
The invention also provides a construction method of the cucumber mosaic virus vector with low toxicity, which comprises the following steps:
s1, taking an original pCB-CMVF209 plasmid, amplifying the original pCB-CMVF209 plasmid by using a primer containing an amino acid coding sequence of 9-17aa, and carrying out enzyme digestion on an amplification product to delete the 2b gene sequence, thus preparing an enzyme digestion product of a PCR product with the deleted 2b gene sequence;
specifically, an upstream and downstream primer NcoIF primer and a 2aORF1R primer are designed by taking CMVF209 as a template, wherein the NcoIF primer contains a sequence of a Nco I polyclonal enzyme cutting site, the 2aORF1R primer contains a Stu I polyclonal enzyme cutting site, the NcoIF primer is shown as SEQ ID NO.2, and the 2aORF1R primer is shown as SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO. 5;
SEQ ID NO.2NcoIF：CATGccatggctgagtttgcctg。
SEQ ID NO.32aORF1R:
gaAGGCCTaatgatctcgtgtagagggatctcgatgcttgccaTtctaattctttcgctgtttgttg；
SEQ ID NO.42aORF1R:
gaAGGCCTccgttccaactttcgaatgatctcgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg；
SEQ ID NO.52aORF1R:
cgacgcgttcaAGGCCTgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg。
the original pCB-CMVF209 plasmid is taken, amplified by NcoIF primer and 2aORF1R primer, and the prepared amplification product is digested by Nco I and Stu I enzyme and purified to prepare the digestion product of PCR product with 2b gene sequence deletion and amino acid coding sequence of 9-17 aa.
S2, amplifying an original pCB-CMVF209 plasmid by using a primer containing a polyclonal enzyme cutting site sequence, and carrying out enzyme digestion on an amplification product by using an endonuclease corresponding to the polyclonal enzyme cutting site sequence to prepare an enzyme digestion product of a PCR product containing the polyclonal enzyme cutting site sequence;
specifically, a forward primer containing Stu I and at least one of the sequences of polyclonal cleavage sites of Mlu I, Spe I, Apa I, Sma I, Ava I, BamH I and Sac II and a reverse primer containing the sequence of the cleavage site of avrII are used for amplifying the original pCB-CMVF209 plasmid;
and carrying out enzyme digestion on the amplification product by using the Stu I enzyme and the Avr II enzyme to prepare an enzyme digestion product of the PCR product containing the polyclonal enzyme cutting site sequence.
In one embodiment, the forward primer comprises a Stu I, Mlu I, BamH I polyclonal cleavage site sequence, wherein the forward primer is shown as SEQ ID No.6 and the reverse primer is shown as SEQ ID No.7 in step S2.
In another embodiment, the forward primer comprises a Stu I, Spe I, Apa I, BamH I polyclonal excision site sequence, wherein in step S2 the forward primer is shown as SEQ ID NO.8 and the reverse primer is shown as SEQ ID NO. 9.
S3, carrying out enzyme digestion on the original pCB-CMVF209 plasmid to obtain an enzyme-digested large fragment product;
in one example, the original pCB-CMVF209 plasmid was digested with Nco I and Avr II enzymes to obtain a large fragment product. In other embodiments, other restriction enzymes may be used, which correspond to the sequence of the cleavage site added by the primer in step S1 and the sequence of the cleavage site added by the primer in step S2. Those skilled in the art can understand that the sequence of the enzyme cutting site entered in step S2 also only needs to correspond to the sequence of the enzyme cutting site added through the primer in step S1, that is, step S1 and step S2 need to introduce the same sequence of the enzyme cutting site, so that the enzyme cutting products obtained in step S1 and step S2 can be linked by ligase, and step S3 needs to adopt restriction enzymes corresponding to both ends of the product after the enzyme cutting products obtained in step S1 and step S2 are linked, so that both ends of the large fragment product prepared in step S3 can be linked with the enzyme cutting products obtained in step S1 and step S2, respectively.
And S4, taking ligase to connect the enzyme digestion product prepared in the step S1, the enzyme digestion product prepared in the step S2 and the large fragment product prepared in the step S3 to prepare the low-toxicity cucumber mosaic virus vector.
And (3) connecting the enzyme digestion product prepared in the step S1 and the enzyme digestion product prepared in the step S2 with the large fragment product subjected to enzyme digestion in the step S3 by using ligase, converting the enzyme digestion product into escherichia coli competent cells DH5a, carrying out plate screening, then carrying out bacterial liquid culture on the escherichia coli successfully converted, extracting plasmids, and preparing the pCB-CMVF209-no2 b-AA-MCS.
Referring to FIG. 2, in one embodiment, the digestion product prepared in step S1 is a fragment between Nco I and Stu I, the digestion product prepared in step S2 is a fragment between Stu I and Avr II, and the large fragment product prepared in step S3 is a fragment between avrII and Nco I.
The invention also provides an application of the low-toxicity cucumber mosaic virus vector in a cucumber mosaic virus host plant. Specifically, the cucumber mosaic virus host plant is common cultivated solanaceae plant such as tobacco, tomato, potato, etc., brassicaceae plant such as cabbage, arabidopsis thaliana, rape, etc., melon plant such as cucumber, watermelon, melon, etc., strawberry, banana, corn, etc.
Specifically, the application of the invention after the pCB-CMVF209-no2b-AA-MCS is transformed into agrobacterium to infect the common cultivated tobacco, tomato, cucumber, rape or corn, so that the pCB-CMVF209-no2b-AA-MCS can be used to carry a target gene to enable the common cultivated tobacco to express the target gene, or to silence the target gene by carrying the target gene, and the like, and the common cultivated tobacco is infected by the pCB-CMVF209-no2b-AA-MCS is not limited. The common cultivated tobacco can be K326, Yunyan 87, Yunyan 89, etc.
To further illustrate the effect of the pCB-CMVF209-no2b-AA-MCS provided by the present invention, the following examples and comparative examples are also provided.
Example 1
1. Designing upstream and downstream primers by taking a CMVF209 sequence as a template, and respectively adding an Nco I polyclonal enzyme cutting site sequence and a Stu I polyclonal enzyme cutting site sequence;
primer NcoIF added with the sequence of the Nco I polyclonal excision site:
catgccatggctgagtttgcctg；
primer 2a orf1R with Stu I polyclonal enzyme cut site sequence:
gaaggcctaatgatctcgtgtagagggatctcgatgcttgccaTtctaattctttcgctgtttgttg。
2. and (3) taking the original pCB-CMVF209 plasmid as a template, adopting the following PCR amplification system to amplify and synthesize a PCR product, and carrying out enzyme digestion on the PCR product by using Nco I and Stu I, purifying and preparing an enzyme digestion product of the PCR product with the deleted 2b gene sequence for later use.
The PCR amplification system is as follows:
the PCR amplification procedure is as follows:
pre-denaturation: 3min at 94 ℃; denaturation: 35 cycles of 94 ℃ for 30sec, 56 ℃ for 30sec, and 72 ℃ for 60 sec; extension: preserving at 72 deg.C for 8min and 4 deg.C.
3. Designing a forward primer 2bORF333F with polyclonal restriction enzyme cutting sites Stu I, Mlu I and BamH I:
aaggccttgaacgcgtgactagggatccaacctccccttccgcatct；
adding a reverse primer 2bAvrIIR of a polyclonal enzyme cutting site AvrII:
cttccgaagaaacctaggag。
and (3) taking the original pCB-CMVF209 plasmid as a template, carrying out PCR amplification to synthesize a PCR product, carrying out enzyme digestion on the PCR product by Stu I and Avr II, and purifying for later use. The PCR amplification can be carried out by those skilled in the art directly according to the above-mentioned amplification system or after adjustment based on the above-mentioned amplification system.
4. The original pCB-CMVF209 plasmid was digested with Nco I and avrII endonucleases for use.
5. Connecting the PCR products of the enzyme digestion in the step 1 and the step 2 with the product of the enzyme digestion plasmid obtained in the step 3 by adopting a T4-DNA ligase kit;
6. and transforming the ligation product into escherichia coli competent DH5a, culturing, selecting colonies in a plate on which colonies grow out by the transformation culture, performing liquid culture, extracting plasmids, performing enzyme digestion identification by Nco I and Avr II, performing PCR identification, finally sending to a sequencing company for sequencing identification, and analyzing to obtain the correct plasmid pCB-CMVF209-no2 b-AA-MCS.
Example 2
1. Designing upstream and downstream primers by taking CMVF209 as a template, and respectively adding an Nco I polyclonal enzyme cutting site sequence and a Stu I polyclonal enzyme cutting site sequence;
primer NcoIF added with the sequence of the Nco I polyclonal excision site:
catgccatggctgagtttgcctg；
primer 2a orf1R with Stu I polyclonal enzyme cut site sequence:
gaaggcctccgttccaactttcgaatgatctcgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg；
2. the original pCB-CMVF209 plasmid is used as a template, a PCR product is amplified and synthesized, the PCR product is digested by Nco I and Stu I, the digested product is purified, and the digested product of the PCR product with the 2b gene sequence deleted is prepared, and the amplification system can refer to example 1.
3. Designing a forward primer 2bORF333F with polyclonal enzyme cutting sites Stu I, Spe I, Apa I and BamH I:
aaggcctggactagtgggcccgggatccaacctccccttccgcatct；
adding a reverse primer 2bAvrIIR of a polyclonal enzyme cutting site AvrII:
cttccgaagaaacctaggag。
and (3) taking the original pCB-CMVF209 plasmid as a template, carrying out PCR amplification to synthesize a PCR product, carrying out enzyme digestion on the PCR product by Stu I and Avr II, and purifying for later use. The PCR amplification can be carried out by those skilled in the art directly according to the above-mentioned amplification system or after adjustment based on the above-mentioned amplification system.
4. The original pCB-CMVF209 plasmid was digested with Nco I and avrII endonucleases for use.
5. Connecting the enzyme digestion products of the PCR products of the step 1 and the step 2 with the product of the enzyme digestion plasmid obtained in the step 3 by adopting a T4-DNA ligase kit;
6. and transforming the ligation product into escherichia coli competent DH5a, culturing, selecting colonies in a plate on which colonies grow out by the transformation culture, performing liquid culture, extracting plasmids, performing enzyme digestion identification by Nco I and Avr II, performing PCR identification, finally sending to a sequencing company for sequencing identification, and analyzing to obtain the correct plasmid pCB-CMVF209-no2 b-AA-MCS.
Example 3
1. Designing upstream and downstream primers by taking a CMVF209 sequence as a template, and respectively adding an Nco I polyclonal enzyme cutting site sequence and a Stu I polyclonal enzyme cutting site sequence;
primer NcoIF added with the sequence of the Nco I polyclonal excision site:
catgccatggctgagtttgcctg；
primer 2a orf1R with Stu I polyclonal enzyme cut site sequence:
cgacgcgttcaaggcctgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg。
2. the original pCB-CMVF209 plasmid is used as a template, a PCR product is amplified and synthesized, the PCR product is digested by Nco I and Stu I, the digested product is purified, and the digested product of the PCR product with the 2b gene sequence deleted is prepared, and the amplification system can refer to example 1.
3. Designing a forward primer 2bORF333F with polyclonal enzyme cutting sites Stu I, Spe I, Apa I and BamH I:
tagaaggcctggactagtgggcccgggatccaacctccccttccgcatct；
adding a reverse primer 2bAvrIIR of a polyclonal enzyme cutting site AvrII:
cttccgaagaaacctaggag。
and (3) taking the original pCB-CMVF209 plasmid as a template, carrying out PCR amplification to synthesize a PCR product, carrying out enzyme digestion on the PCR product by Stu I and Avr II, and purifying for later use. The PCR amplification can be carried out by those skilled in the art directly according to the above-mentioned amplification system or after adjustment based on the above-mentioned amplification system.
4. The original pCB-CMVF209 plasmid was digested with Nco I and avrII endonucleases for use.
5. Connecting the enzyme digestion products of the PCR products of the step 1 and the step 2 with the product of the enzyme digestion plasmid obtained in the step 3 by adopting a T4-DNA ligase kit;
6. and transforming the ligation product into escherichia coli competent DH5a and culturing, selecting colonies in a plate on which colonies grow out by the transformation culture, performing liquid culture, extracting plasmids, performing enzyme digestion identification and PCR identification by adopting Nco I and Avr II, finally sending the plasmids to a sequencing company for sequencing identification, and analyzing to obtain the correct plasmid pCB-CMVF209-no2 b-AA-MCS.
Infection verification experiment
Agrobacterium was transformed with pCB-CMVF209-no2b-AA-MCS prepared in examples 1, 2 and 3; mixing the transformed plasmid agrobacterium with plasmid agrobacterium of another 2 original infectious clone plasmids pCB-CMVF109 and pCB-CMV309 of CMVFny, respectively, and inoculating to common cultivated tobacco of 4-6 leaf ages by an agrobacterium infiltration method; culturing at room temperature, inoculating for 10 days, and detecting whether the virus is expressed in the inoculated plant by RT-PCR.
Comparative example 1:
the same treatment method as the infection experiment is carried out, except that the ordinary cultivated tobacco is not inoculated with any liquid or clear water.
Comparative example 2:
the infection experiment treatment mode is the same as that of the infection experiment except that the original infectious clone plasmids pCB-CMVF209, pCB-CMVF109 and pCB-CMV309 of CMVFny are mixed and infiltrated by plasmid agrobacterium infiltration method to inoculate 4-6 leaf age plant seedling leaves.
Comparative example 3:
the infection experiment treatment method is the same as the infection experiment treatment method, except that the agrobacterium tumefaciens of the infectious clone plasmids pCB-CMVF209-2b81aa-MCS, pCB-CMVF109 and pCB-CMV309 of the modified CMVFny are mixed, infiltrated and inoculated to the seedling leaves of the 4-6-leaf-old plants by a plasmid agrobacterium infiltration method, wherein the construction method for constructing the pCB-CMVF209-2b81aa-MCS is please refer to the dawn east et al, 2015, 23(12) 1550-; wang et al 2016, 86(1): 102-115.
Referring to fig. 3 and 4, fig. 3 is a comparative example 1, and fig. 4a, 4b and 4c are 30-day growth conditions of example 1, example 2 and example 3 inoculated with common cultivated tobacco. It was found that the plant growth was similar to that of comparative example 1 without symptoms and that there was no difference in the plant height of the plant growth.
Referring to fig. 5, the growth conditions of the ordinary cultivated tobacco inoculated in the comparative examples 1, 2 and 2 are shown from left to right for 45 days, and it is obvious that the CMVFny inoculated plant in the comparative example 2 has obvious flowers and leaves and green islands, and the plant height is also very short. Referring to fig. 6, significant viral symptoms are seen for the growth status of comparative example 3 after inoculation with CMVFny45 days: the whole plant has a rat tail, a long and thin leaf stalk, and the leaves are narrowed and dwarfed.
Please refer to fig. 7, which is an electrophoresis diagram of RT-PCR detection, from left to right: examples 1, 2, 3, Marker. Referring to fig. 8, the electrophoresis diagram of RT-PCR detection, from left to right, is: marker, comparative example 3, comparative example 2, comparative example 1. It is evident from FIG. 7 that there is a bright band between 250bp and 500bp, corresponding to the predetermined length of the target sequence, where the forward primer F: atggcaagcatcgagatccct, respectively; reverse primer 2bAvrIIR: cttccgaagaaacctaggag, respectively; the amplified target sequence is from 9-17aa sequence to 3' UTR sequence avrII enzyme cutting site, the size is about 270bp, a bright band near 500bp and the preset target sequence length can be obviously seen in FIG. 8, wherein a forward primer F is atggaattgaacgtaggtgc; reverse primer 2bAvrIIR: cttccgaagaaacctaggag, the amplified target sequence is from the start segment of the 2b gene coding sequence to the 3' UTR sequence AvrII restriction enzyme cutting site, the size is consistent around 500bp, which indicates that except for comparative example 3, the virus formed by the respective inoculated infectious clone plasmid has been normally expressed in the plant system leaf (i.e. non-inoculated leaf).
Since common cultivated tobacco is a representative crop species, low virulence cucumber mosaic virus vectors capable of systemically infecting common cultivated tobacco plants can generally infect plants of other host species as well. Further, the pCB-CMVF209-no2b-AA-MCS prepared in example 1, example 2 and example 3 was transformed into Agrobacterium and inoculated into potato leaves, Arabidopsis thaliana and tomato leaves, respectively, and after 30 days, the growth status was observed, which showed no symptoms of cucumber mosaic virus and showed no difference in plant height for plant growth.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and all modifications and equivalents of the present invention, which are made by the present specification and directly/indirectly applied to other related technical fields within the spirit of the present invention are included in the scope of the present invention.
Sequence listing
<110> Hunan institute of human science and technology
<120> low-toxicity cucumber mosaic virus vector, construction method and application
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 51
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccgttccaac tttcgaatga tctcgtgtag agggatctcg atgcttgcca t 51
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
catgccatgg ctgagtttgc ctg 23
<210> 3
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gaaggcctaa tgatctcgtg tagagggatc tcgatgcttg ccattctaat tctttcgctg 60
tttgttg 67
<210> 4
<211> 82
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gaaggcctcc gttccaactt tcgaatgatc tcgtgtagag ggatctcgat gcttgccatt 60
ctaattcttt cgctgtttgt tg 82
<210> 5
<211> 67
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgacgcgttc aaggcctgtg tagagggatc tcgatgcttg ccattctaat tctttcgctg 60
tttgttg 67
<210> 6
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aaggcctgga ctagtgggcc cgggatccaa cctccccttc cgcatct 47
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cttccgaaga aacctaggag 20
<210> 8
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tagaaggcct ggactagtgg gcccgggatc caacctcccc ttccgcatct 50
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cttccgaaga aacctaggag 20
Claims (10)
1. A low-virulence cucumber mosaic virus vector, which comprises a pCB-CMVF209-no2b sequence with a deleted 2b gene sequence and an amino acid coding sequence 9-17aa connected into the pCB-CMVF209-no2b sequence, wherein the nucleotide sequence of the 9-17aa comprises at least 27 continuous bases in the sequence shown as SEQ ID NO. 1.
2. The low virulence cucumber mosaic virus vector of claim 1, further comprising a plurality of polyclonal excision site sequences linked into the pCB-CMVF209-no2b sequence, the plurality of polyclonal excision site sequences comprising Stu I and at least one of Mlu I, Spe I, Apa I, Sma I, Ava I, BamH I, and Sac II.
3. A method for constructing a cucumber mosaic virus vector with low toxicity is characterized by comprising the following steps:
taking an original pCB-CMVF209 plasmid, amplifying the original pCB-CMVF209 plasmid by using a primer containing an amino acid coding sequence of 9-17aa, and carrying out enzyme digestion on an amplification product to delete a 2b gene sequence so as to prepare an enzyme digestion product of a PCR product with the deletion of the 2b gene sequence and the amino acid coding sequence of 9-17 aa;
amplifying an original pCB-CMVF209 plasmid by using a primer containing a polyclonal enzyme cutting site sequence, and carrying out enzyme digestion on an amplification product by using an endonuclease corresponding to the polyclonal enzyme cutting site sequence to prepare an enzyme digestion product of a PCR product containing the polyclonal enzyme cutting site sequence;
step three, carrying out enzyme digestion on the original pCB-CMVF209 plasmid to obtain a large fragment product;
step four, taking ligase to connect the enzyme digestion product prepared in the step one, the enzyme digestion product prepared in the step two and the large fragment product prepared in the step three, and preparing the cucumber mosaic virus vector with low toxicity as claimed in claim 1 or 2.
4. The method for constructing a cucumber mosaic virus vector with low virulence of claim 3, wherein the first step comprises:
taking an original pCB-CMVF209 plasmid, and amplifying by using an NcoIF primer and a 2aORF1R primer, wherein the NcoIF primer contains an Nco I enzyme cutting site sequence, and the 2aORF1R primer contains a Stu I enzyme cutting site sequence and amino acid coding sequences 9-17 aa;
and carrying out enzyme digestion and purification on the prepared amplification product through Nco I and Stu I enzymes to prepare an enzyme digestion product of a PCR product with 2b gene sequence deletion and amino acid coding sequence of 9-17 aa.
5. The method for constructing a cucumber mosaic virus vector with low virulence as claimed in claim 4, wherein the NcoIF primer is shown in SEQ ID No.2, and the 2aORF1R primer is shown in SEQ ID No.3 or SEQ ID No.4 or SEQ ID No. 5.
6. The method for constructing a cucumber mosaic virus vector with low virulence of claim 3, wherein the second step comprises:
amplifying the original pCB-CMVF209 plasmid by using a forward primer containing at least one of Mlu I, Spe I, Apa I, Sma I, Ava I, BamH I and Sac II and a StuI polyclonal restriction site sequence and a reverse primer containing an AvrII restriction site sequence;
and carrying out enzyme digestion on the amplified product by using Stu I enzyme and Avr II enzyme to prepare an enzyme digestion product of the PCR product containing the polyclonal enzyme cutting site sequence.
7. The method for constructing a cucumber mosaic virus vector with low virulence as claimed in claim 6, wherein the forward primer in the second step contains Stu I, Mlu I, BamH I polyclonal restriction site sequence, the forward primer in the second step is shown as SEQ ID No.6, and the reverse primer is shown as SEQ ID No. 7.
8. The method for constructing a cucumber mosaic virus vector with low virulence as claimed in claim 6, wherein the forward primer in step two comprises StuI, SpeI, ApaI, BamH I polyclonal excision site sequence, the forward primer in step two is shown as SEQ ID No.8, and the reverse primer is shown as SEQ ID No. 9.
9. The method for constructing a cucumber mosaic virus vector with low virulence of claim 6, wherein said step three comprises:
carrying out enzyme digestion on the original pCB-CMVF209 plasmid by adopting enzymes Nco I and Avr II to obtain a large fragment product;
the fourth step comprises:
and (3) connecting the enzyme digestion product prepared in the step one, the enzyme digestion product prepared in the step two and the large fragment product prepared in the step three by using ligase, converting the enzyme digestion product into an escherichia coli competent cell, culturing and converting successfully-transformed escherichia coli, extracting plasmids, and preparing the low-toxicity cucumber mosaic virus vector as claimed in claim 1 or 2.
10. Use of a cucumber mosaic virus vector of low virulence as claimed in claim 1 or 2 on a cucumber mosaic virus host plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010896645.3A CN111979263A (en) | 2020-08-31 | 2020-08-31 | Low-toxicity cucumber mosaic virus vector, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010896645.3A CN111979263A (en) | 2020-08-31 | 2020-08-31 | Low-toxicity cucumber mosaic virus vector, construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111979263A true CN111979263A (en) | 2020-11-24 |
Family
ID=73440512
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010896645.3A Pending CN111979263A (en) | 2020-08-31 | 2020-08-31 | Low-toxicity cucumber mosaic virus vector, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111979263A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6369296B1 (en) * | 2000-02-01 | 2002-04-09 | Plant Bioscience Limited | Recombinant plant viral vectors |
| CN1654638A (en) * | 2005-01-12 | 2005-08-17 | 浙江理工大学 | Method for constructing weak strain of plant virus |
| CN105907781A (en) * | 2015-04-22 | 2016-08-31 | 湖南人文科技学院 | Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant |
| CN105925603A (en) * | 2015-04-22 | 2016-09-07 | 湖南人文科技学院 | Application of attenuated CMV (cucumber mosaic virus) vector expression resistance gene in enhancing plant herbicide resistance |
| CN106191108A (en) * | 2016-08-08 | 2016-12-07 | 湖南人文科技学院 | Weak virulence CMV vector expression resistant gene strengthens the application of Genes For Plant Tolerance heavy metal performance |
| CN108486148A (en) * | 2018-03-29 | 2018-09-04 | 山东农业大学 | The weak malicious mutant plasmids carriers of cucumber mosaic virus RNA2 of the genetic fragments of PDS containing tobacco and its application |
-
2020
- 2020-08-31 CN CN202010896645.3A patent/CN111979263A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6369296B1 (en) * | 2000-02-01 | 2002-04-09 | Plant Bioscience Limited | Recombinant plant viral vectors |
| CN1654638A (en) * | 2005-01-12 | 2005-08-17 | 浙江理工大学 | Method for constructing weak strain of plant virus |
| CN105907781A (en) * | 2015-04-22 | 2016-08-31 | 湖南人文科技学院 | Application of hypovirulence CMV vector in expression of pest-resistant gene and enhancement of pest resistance of plant |
| CN105925603A (en) * | 2015-04-22 | 2016-09-07 | 湖南人文科技学院 | Application of attenuated CMV (cucumber mosaic virus) vector expression resistance gene in enhancing plant herbicide resistance |
| CN106191108A (en) * | 2016-08-08 | 2016-12-07 | 湖南人文科技学院 | Weak virulence CMV vector expression resistant gene strengthens the application of Genes For Plant Tolerance heavy metal performance |
| CN108486148A (en) * | 2018-03-29 | 2018-09-04 | 山东农业大学 | The weak malicious mutant plasmids carriers of cucumber mosaic virus RNA2 of the genetic fragments of PDS containing tobacco and its application |
Non-Patent Citations (4)
| Title |
|---|
| 严明明: "病毒CMVno2b增强烟草对除草剂耐性的研究", 《万方学位论文》 * |
| 彭日民: "利用弱病毒载体表达Bar基因增强烟草植株对草丁膦抗性的研究", 《万方学位论文》 * |
| 无: "Accession MN841292.1，Dendranthema indicum cucumovirus strain pt058-lat-6-s2-plant 58, complete genome", 《GENEBANK》 * |
| 王强: "利用弱病毒载体表达PvSR2基因降低烟草植株重金属镉含量的研究", 《万方学位论文》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108486148B (en) | Cucumber mosaic virus RNA2 attenuated mutant plasmid vector containing tobacco PDS gene segment and application thereof | |
| CN112522300A (en) | Method for cultivating broad-spectrum bacterial leaf streak resistant rice, primer and expression cassette | |
| CN115927757A (en) | Method for efficiently screening antiviral germplasm resources based on PEMV-1 and PEMV-2 infectious clones | |
| CN113025616B (en) | Rubber tree ubiquitin gene promoter proHbUBI2 and cloning and application thereof | |
| CN116640770B (en) | Application of OsBRY1 gene in improving rice yield traits | |
| CN116622648A (en) | Wisteria mosaic virus (WiMV) and infectious cloning vector and application thereof | |
| CN114854766B (en) | NtAIDP1 gene mutant for reducing nicotine content in tobacco leaves and application thereof | |
| CN115925848A (en) | Dendrobium ERF transcription factor gene DoERF5 and application thereof | |
| CN111979263A (en) | Low-toxicity cucumber mosaic virus vector, construction method and application | |
| CN114045304B (en) | Carrier for editing Benshi tobacco gene based on CRISPR/Cas9 system, construction method and application | |
| CN115960948A (en) | Application of ZmCP03 gene in corn | |
| CN112322635B (en) | Coding sequence of larch growth and development regulation gene and application thereof | |
| CN112375765B (en) | Disease-susceptible gene OsHXK5 of rice bacterial leaf streak and application thereof | |
| CN111235181B (en) | Virus vector for efficiently screening gene editing crops without exogenous DNA (deoxyribonucleic acid), and construction method and application thereof | |
| WO2011000220A1 (en) | Promoter of cotton brassinolide synthetase ghdwf4 gene and applications thereof | |
| CN114561387B (en) | Peanut promoter and application thereof | |
| CN117126879B (en) | Application of tomato SlSUVH1 gene in regulation and control of plant virus resistance and transgenic plant cultivation method | |
| CN114181951B (en) | Corn sheath blight disease resistance related gene Zmbzip45 and application thereof | |
| CN110295192B (en) | Bivalent RNAi expression vector for constructing TYLCV and ToCV by Gateway technology and application thereof | |
| CN112481259B (en) | Cloning and application of two sweet potato U6 gene promoters IbU6 | |
| CN118406698B (en) | Application of ZmWIND gene in improving corn genetic transformation efficiency | |
| CN115976047B (en) | Root development related gene IbSAUR and application thereof | |
| CN115595330B (en) | CRISPR-Cas3 system and application thereof in aspect of resisting plant viruses | |
| CN110229824B (en) | Salt mustard TsHKT1; cloning and application of 3 promoter | |
| CN115873828A (en) | Gene editing system and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201124 |
|
| RJ01 | Rejection of invention patent application after publication |