CN115960948A - Application of ZmCP03 gene in corn - Google Patents

Abstract

The invention provides an application of a corn ZmCP03 gene, wherein the corn ZmCP03 gene is overexpressed in a corn plant and is used for improving the drought resistance of the corn; the nucleotide sequence of the ZmCP03 gene of the corn is shown as SEQIDNO 1, and the amino acid sequence of the ZmCP03 gene of the corn is shown as SEQIDNO 2. The ZmCP03 gene of the corn is overexpressed in corn plants and is used for improving the drought resistance of the corn.

Description

Application of ZmCP03 gene in corn

Technical Field

The invention belongs to the technical field of corn drought resistance, and particularly relates to an application of a corn ZmCP03 gene.

Background

Corn is an important crop of food, feed and energy, and the demand of corn is increasing with the increase of population and the development of industry. The safety problem of the corn yield is a big problem in China, and drought stress frequently and seriously occurs to cause yield reduction, so that a new drought-resistant variety needs to be cultivated to reduce or solve the problem. Drought stress has become one of the most important abiotic stresses affecting corn growth and development and yield. Good drought-resistant genes are excavated, and the drought-resistant genes are introduced into a backbone inbred line through transgene or molecular assisted breeding, so that the drought resistance of the corn is effectively improved.

Disclosure of Invention

The technical problem to be solved by the invention is to provide an application of a corn ZmCP03 gene aiming at the defects of the prior art, wherein the corn ZmCP03 gene is overexpressed in a corn plant and is used for improving the drought resistance of corn.

In order to solve the technical problems, the invention adopts the technical scheme that: the application of the corn ZmCP03 gene is characterized in that the corn ZmCP03 gene is overexpressed in a corn plant and is used for improving the drought resistance of the corn; the nucleotide sequence of the corn ZmCP03 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the corn ZmCP03 gene is shown as SEQ ID NO. 2.

Preferably, the method for overexpression of the maize ZmCP03 gene in maize plants comprises:

cloning of S1 and ZmCP03 genes:

s101, selecting a corn B73 self-bred system as an experimental material, extracting RNA of a leaf tissue of a corn in a three-leaf stage, and performing reverse transcription to obtain cDNA;

s102, carrying out PCR amplification by taking the cDNA obtained in S101 as a template and taking a primer ZmCP03-F and a primer ZmCP03-R as primers to obtain a PCR product;

the reaction system of the PCR amplification is as follows: 1 mu L of cDNA, 1 mu L of KOD high fidelity enzyme, 1 mu L of primer ZmCP03-F, 1 mu L of primer ZmCP03-R, 5 mu L of buffer, 10 mu L of dNTP mix and sterile water to make up to 50 mu L;

the reaction procedure of the PCR amplification is as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 45s, and extension at 72 ℃ for 64s, and after 30 cycles, adding 0.5 mu L of Taq enzyme and extension at 72 ℃ for 10min;

the nucleotide sequence of the primer ZmCP03-F is shown as SEQ ID NO. 3;

the nucleotide sequence of the primer ZmCP03-R is shown as SEQ ID NO. 4;

s103, performing gel cutting recovery on the PCR product obtained in the S102 by using a gel recovery kit, connecting the PCR product with a vector pCambia3300, then transforming the PCR product into escherichia coli Trans5 alpha competent cells, performing double enzyme digestion verification by using Xba I/BamH I, screening and selecting bacterial liquid corresponding to 1-3 positive bands, and sequencing;

bioinformatics analysis of S2 and ZmCP03 genes:

comparing the sequencing result in S103 with the nucleotide sequence of the ZmCP03 gene of the corn through Mega4.0 software, wherein if the nucleotide sequences are the same, the cloning is successful, and the PCR product in S102 with successful cloning is the ZmCP03 target gene fragment;

s3, construction of a corn ZmCP03 gene overexpression vector:

carrying out double enzyme digestion on the vector pCambia3300 by BsaI/Eco31I to obtain a large fragment of the pCambia3300 vector; carrying out double enzyme digestion on the ZmCP03 target gene fragment in S3 by BsaI/Eco31I to obtain a P-rDNao1 target fragment, carrying out electrophoresis to verify the size of the fragment, recovering an enzyme digestion electrophoresis product by using an agarose gel recovery kit, and carrying out ligation reaction on the pCambia3300 carrier large fragment and the P-rDNao1 target fragment for 1h under the action of T4 ligase at the temperature of 37 ℃ to obtain a ligation product;

the system of the connection reaction is as follows: 3 muL of pCambia3300 carrier large fragment, 5 muL of P-rDNao1 target fragment, 1 muL of T4DNA ligase, 1 muL of 10 XT 4DNA ligase buffer solution and 1 muL of sterile water;

transforming the obtained connected product into escherichia coli competent cells, coating a transformed bacterium solution on an LB solid culture medium containing kanamycin, culturing at 37 ℃ for 12 hours, selecting positive clones for culturing, and carrying out plaque PCR identification to obtain a corn ZmCP03 gene overexpression vector, namely pCambia3300-ZmCP03 plasmid;

s4, corn genetic transformation of ZmCP03 gene:

transforming agrobacterium with the pCambia3300-ZmCP03 plasmid obtained in S3, infecting immature embryos of maize inbred line B104 immature embryos, and obtaining ZmCP03 transgenic positive plants through induced culture, co-culture, screening culture, differentiation culture, rooting culture and transplanting seedling formation;

identification of positive plants of the S5, zmCP03 transgene: and carrying out ZmCP03 gene PCR detection on the ZmCP03 transgenic positive plant obtained in S4, amplifying a band with the size consistent with that of the pCambia3300-ZmCP03 plasmid in the positive control S3 at the position of 1059bp, and comparing the sequence after sequencing to be correct, thus obtaining the ZmCP03 gene over-expression plant of the corn.

Compared with the prior art, the invention has the following advantages:

the ZmCP03 gene of the corn is overexpressed in corn plants and is used for improving the drought resistance of the corn.

The present invention will be described in further detail with reference to the drawings and examples.

Drawings

FIG. 1 shows the detection of ZmCP03 expression level in ZmCP03-OE overexpression plants of example 3 of the present invention.

FIG. 2 is a drought resistance map of ZmCP03-OE overexpressing transgenic plants of example 3 of the present invention.

FIG. 3 survival rate under drought stress for ZmCP03-OE overexpressing transgenic plants of example 3 of the invention.

FIG. 4 analysis of ZmCP03 gene sequence in ZmCP03-KO, a gene editing knockout mutant of example 4 of the present invention.

FIG. 5 is a map of the drought resistance of the gene editing knockout mutant ZmCP03-KO of example 4 of the present invention.

FIG. 6 Gene editing knock-out mutant ZmCP03-KO of example 4 of the present invention shows survival rate under drought stress.

Detailed Description

Example 1

In the application of the maize ZmCP03 gene, the maize ZmCP03 gene is over-expressed in a maize plant and is used for improving the drought resistance of the maize; the nucleotide sequence of the corn ZmCP03 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the corn ZmCP03 gene is shown as SEQ ID NO. 2.

The over-expression method of the corn ZmCP03 gene in a corn plant comprises the following steps:

cloning of S1 and ZmCP03 genes: biological information of ZmCP03 is retrieved and obtained from a corn database, and the transcript ID is GRMZM2G072448;

s101, selecting a corn B73 self-bred line as an experimental material, extracting RNA of a leaf tissue of a corn in a three-leaf stage, and performing reverse transcription to obtain cDNA;

s102, carrying out PCR amplification by taking the cDNA obtained in the S101 as a template and taking a primer ZmCP03-F and a primer ZmCP03-R as primers to obtain a PCR product;

the reaction system of the PCR amplification is as follows: 1 mu L of cDNA, 1 mu L of KOD high fidelity enzyme, 1 mu L of primer ZmCP03-F, 1 mu L of primer ZmCP03-R, 5 mu L of buffer, 10 mu L of dNTP mix and sterile water to make up to 50 mu L;

the reaction procedure of the PCR amplification is as follows: pre-denaturation at 94 deg.C for 5min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 45s, and extension at 72 ℃ for 64s, and after 30 cycles, adding 0.5 mu L of Taq enzyme and extension at 72 ℃ for 10min;

the nucleotide sequence of the primer ZmCP03-F is shown as SEQ ID NO. 3;

the nucleotide sequence of the primer ZmCP03-R is shown as SEQ ID NO. 4;

s103, performing gel cutting recovery on the PCR product obtained in the S102 by using a gel recovery kit, connecting the PCR product with a vector pCambia3300, then converting the PCR product into escherichia coli Trans5 alpha competent cells, performing double enzyme digestion verification by using Xba I/BamH I, screening and selecting bacterial liquid corresponding to 1-3 positive bands, and sequencing;

bioinformatics analysis of S2 and ZmCP03 genes:

comparing the sequencing result in S103 with the nucleotide sequence (SEQ ID NO: 1) of the ZmCP03 gene of the corn through Mega4.0 software, wherein if the nucleotide sequences are the same, the cloning is successful, and the PCR product in S102 with the successful cloning is the ZmCP03 target gene fragment;

sequence analysis shows that the full length of the coding region of the ZmCP03 gene is 1059bp, the total length codes 352 amino acids, the pI is 8.02, and the Mw is 38.089kD;

s3, construction of a maize ZmCP03 gene overexpression vector:

carrying out double enzyme digestion on the vector pCambia3300 by BsaI/Eco31I to obtain a large fragment of the vector pCambia 3300; carrying out double enzyme digestion on the ZmCP03 target gene fragment in S3 by BsaI/Eco31I to obtain a P-rDNao1 target fragment, carrying out electrophoresis to verify the size of the fragment, recovering an enzyme digestion electrophoresis product by using an agarose gel recovery kit, and carrying out ligation reaction on the pCambia3300 carrier large fragment and the P-rDNao1 target fragment for 1h under the action of T4 ligase at the temperature of 37 ℃ to obtain a ligation product;

the system of the linking reaction is as follows: 3 muL of pCambia3300 carrier large fragment, 5 muL of P-rDNao1 target fragment, 1 muL of T4DNA ligase, 1 muL of 10 XT 4DNA ligase buffer solution and 1 muL of sterile water;

transforming the obtained connected product into escherichia coli competent cells, coating a transformed bacterium liquid on an LB solid culture medium containing kanamycin, culturing for 12 hours at 37 ℃, selecting positive clones for culturing, and performing plaque PCR identification to obtain a corn ZmCP03 gene overexpression vector, namely pCambia3300-ZmCP03 plasmid;

s4, corn genetic transformation of ZmCP03 gene:

transforming agrobacterium with the pCambia3300-ZmCP03 plasmid obtained in S3, infecting the immature embryo of maize inbred line B104 immature embryo, and obtaining ZmCP03 transgenic positive plant through induced culture, co-culture, screening culture, differentiation culture, rooting culture and transplanting seedling formation;

the specific method comprises the following steps: firstly, selecting maize inbred line B104 immature embryos with uniform size, stripping the immature embryos in an aseptic operation table, and carrying out high-temperature induction dark culture at 34 ℃ for 3d; then placing in an incubator at 25 ℃ for dark culture for 7d. Cutting off the endogenous buds of the induced callus, inoculating the callus to a subculture medium, and carrying out dark culture at 25 ℃ for 7d, and carrying out subculture twice for agrobacterium transformation. Placing the callus in a sterile infection culture medium, and washing twice; after the last washing, pouring out the liquid, adding a bacterial liquid (OD 600= 0.4), and infecting for 30min; after the agrobacterium infection, the embryo is blotted dry on sterile filter paper, transferred to the surface of a co-culture medium, the axis end of the embryo is contacted with the culture medium (the scutellum is upward), and dark culture is carried out for 3d at 23 ℃. Screening for 2 times, transferring into rooting culture medium after complete regeneration seedling grows out, irradiating at 28 deg.C for 16h, rooting and strengthening seedling until the root length reaches about 2cm, hardening seedling and transplanting;

identification of S5, zmCP03 transgenic positive plants: and carrying out ZmCP03 gene PCR detection on the ZmCP03 transgenic positive plant obtained in S4, amplifying a strip with the size consistent with that of the pCambia3300-ZmCP03 plasmid in the positive control S3 at the position of 1059bp, and comparing the sequence after sequencing to be correct, so that the ZmCP03 transgenic over-expression plant is named as a ZmCP03-OE-30 transgenic plant.

Example 2

This example is the method for obtaining negative control plants of example 1:

the construction method of the CRISPR/Cas9 knockout vector pOSCas9-ZmCP03 comprises the following steps:

firstly, origin-9 gene knockout vector construction:

(1) Three target sequence fragments for knockdown were found in the database at the national information technology center (NCBI) as follows:

target 1: the nucleotide sequence is ccgcaacattgagcacacatcgagg;

target 2: the nucleotide sequence is gtgctgcagcctcaataatgctggg;

target 3: the nucleotide sequence is cggtggtgacaggctgatggg;

and primers attached to the target sequence were designed as follows:

origin-9-T1+ (SEQ ID NO: 5);

origin-9-T1-, wherein the nucleotide sequence is shown as SEQ ID NO 6;

origin-9-T2+ (SEQ ID NO: 7);

origin-9-T2-, the nucleotide sequence is shown as SEQ ID NO. 8;

origin-9-T3+ (SEQ ID NO: 9);

origin-9-T3-, wherein the nucleotide sequence is shown as SEQ ID NO: 10;

(2) Firstly, the CRISPR-Cas9 site-directed mutagenesis technology of the maize mutant with gene function deletion is created, on-line analysis software CRISPR-P (http:// cruispr. Hzau.edu.cn/CRISPR /) is utilized to design sgRNA of ZmPCP, an intermediate vector is constructed, and then a method of joining with a tailing enzyme is adopted to join a plurality of intermediate vector segments containing target sites into a final vector at one time. The method comprises the following steps:

(1) firstly, synthesizing double-stranded DNA (deoxyribonucleic acid) by using primers of 3 pairs of carriers through PCR (polymerase chain reaction);

the PCR reaction system is as follows: a forward primer: 5 mu L of the solution; reverse primer: 5 mu L of the solution; h ₂ O：40μL；

PCR procedure: pre-denaturation at 95 deg.C for 10min, denaturation at 55 deg.C for 10min, annealing at 14 deg.C for 5min

origin-9-T1+ and origin-9-T1-synthetic gRNA-T1 fragments;

origin-9-T2+ and origin-9-T2-synthesize gRNA-T2 fragment;

origin-9-T3+ and origin-9-T3-synthesizing a gRNA-T3 fragment;

(2) carrying out enzyme digestion ligation reaction on origin-9-T1, origin-9-T2 and origin-9-T3 by using Eco31I at 37 ℃ for 2h to respectively obtain enzyme digestion ligation products, wherein the enzyme digestion ligation products are named as pSgA (pSgB) -T1 vector, pSgA (pSgB) -T2 vector and pSgA (pSgB) -T3 vector;

the enzyme digestion reaction system comprises the following steps:

TABLE 1 cleavage system for fragments of gRNA-T1 and origin-9-T1

Raw materials	Dosage of
		gRNA-T1 fragment	2μL
origin-9-T1	1.5μL
		Eco31I	0.5μL
T4-ligase	0.5μL
		T4-buffer	1μL
Sterile water	4.5μL
		Total volume	10μL

TABLE 2 restriction enzyme digestion System for gRNA-T2 fragments and origin-9-T2

TABLE 3 cleavage system for gRNA-T3 fragments and origin-9-T3

Raw materials	Dosage of
		gRNA-T3 fragment	2μL
origin-9-T3	1.5μL
		Eco31I	0.5μL
T4-ligase	0.5μL
		T4-buffer	1μL
Sterile water	4.5μL
		Total volume	10μL

(3) After the enzyme digestion and ligation reaction, recombinant plasmids are transformed into escherichia coli competent cells, positive clone colonies are screened, and plasmid DNA is extracted for later use.

Mixing a tube of 200. Mu.L of Escherichia coli competent cell DH5a with 5. Mu.L of enzyme digestion ligation product, and carrying out ice bath for 30min; then quickly placing the mixture into a constant-temperature water bath kettle at 42 ℃, thermally shocking for 90s, and carrying out ice bath for 2min; then adding 500 mu L of LB liquid culture medium and mixing evenly; culturing at 37 deg.C and 200rpm for 45min to restore normal growth state of cells; finally, uniformly coating the bacterial liquid on an LB solid culture medium plate with kanamycin resistance; after 30min, the cells were incubated overnight in a 37 ℃ incubator. Then screening positive clones, and sending the clones to a company for sequencing;

(4) final vector ligation:

adopting a method of isocaudarner connection, connecting three intermediate vectors containing target sites into a final vector at one time, and firstly linearizing a pOSCas9 expression vector and the intermediate vectors;

sequentially digesting the pOSCas9 vector by using AscI and EcoRI;

then, three intermediate vectors are respectively digested by different enzymes, namely:

the pSgA (pSgB) -T1 vector was digested with AscI and XbaI;

the pSgA (pSgB) -T2 vector was digested with Nhe I + Xho I;

the pSgA (pSgB) -T3 vector was digested with SalI + EcoRI;

the intermediate vector and the pOSCas9 expression vector are connected by using T4DNA ligase to construct a CRISPR/Cas9 knockout vector OsCas9-ZmCP03, and the connection reaction system is as follows:

TABLE 4 ligation reaction system constructed by CRISPR/Cas9 knockout vector OsCas9-ZmCP03

Raw materials	Dosage of
		pOSCas9 expression vector	50ng
pSgA (pSgB) -T1 vector	8ng
		pSgA (pSgB) -T2 vector	8ng
pSgA (pSgB) -T3 vector	8ng
		T4 ligase Buffer	1μL
T4 ligase	0.5μL
		Sterile water	Make up to 10. Mu.L

(5) Screening of transformation and recombinant vectors and Agrobacterium transformation

2-4 mu L of the ligation product is taken to transform escherichia coli DH5 alpha competent cells, and plasmid DNA is extracted after PCR and plasmid DNA double enzyme digestion identification. Agrobacterium is transformed, colony PCR verification is carried out, then bacteria are preserved, the bacteria are preserved at the temperature of minus 20 ℃, a CRISPR/Cas9 knockout vector pOSCas9-ZmCP03 is used for transforming the immature embryo of B104, the transformation method is the same as the method for transforming the immature embryo of B104 by the pCambia3300-ZmCP03 plasmid in the embodiment 1, and finally, a gene editing knockout mutant ZmCP03-KO-3 is obtained.

Example 3

This example is a drought tolerance analysis of maize ZmCP03 gene over-expressed plants (ZmCP 03-OE-30 transgenic plants) in example 1:

the expression level of the ZmCP03 gene in the ZmCP03-OE-30 transgenic plant is found to be remarkably higher than that of a control B104 (figure 1) through qRT-PCR experimental detection. To confirm whether over-expressing ZmCP03-OE-30 corn is more drought resistant than B104 corn, two corn plants were drought stress treated. During normal growth, the soil moisture is kept at 90-100%, and watering is stopped when the corn grows to the trefoil stage. Before drought stress, the growth vigor difference between the B104 and over-expressed ZmCP03-OE-30 corns is small, after 14 days of drought stress, the B104 and over-expressed ZmCP03-OE-30 corns have obvious difference in phenotype, and the phenomena of leaf rolling wilting and gradual yellowing of the B104 are severe compared with the over-expressed ZmCP03-OE-30 corns. After rehydration, the over-expressed ZmCP03-OE-30 corn can be restored to the original growth state, the survival rate is obviously higher than that of B104, and the over-expressed ZmCP03-OE-30 corn has stronger drought resistance than that of B104 (figure 2 and figure 3), which shows that the over-expressed ZmCP03 gene enhances the drought resistance of the corn.

Example 4

This example is a drought resistance test of the gene editing knockout mutant ZmCP03-KO-3 of example 2:

to further confirm the function of the ZmCP03 gene in drought resistance, we knocked out the ZmCP03 gene by gene editing techniques. Through sequencing analysis, 2 sites in the ZmCP03 gene are knocked out successfully. Deletion of one large fragment at one site and one base at the other site results in loss of function of the gene (FIG. 4). To confirm whether B104 is more drought resistant than the gene editing knockout mutant ZmCP03-KO-3 maize, drought stress treatment was performed on both maize. During normal growth, the soil moisture is kept at 90-100%, and watering is stopped when the corn grows to a trefoil stage. Before drought stress, the growth vigor difference between the B104 and the gene editing knockout mutant ZmCP03-KO-3 corn is small, after 10 days of drought stress, the phenotype of the B104 and the gene editing knockout mutant ZmCP03-KO-3 corn is remarkably different, and the gene editing knockout mutant ZmCP03-KO-3 corn has serious leaf rolling wilting and gradual yellowing phenomena compared with the B104. After rehydration, B104 can be restored to the original growth state, the survival rate of the B104 is obviously higher than that of the gene editing knockout mutant ZmCP03-KO-3, and the B104 has stronger drought resistance (shown in figures 5 and 6) than that of the gene editing knockout mutant ZmCP03-KO-3, which indicates that the maize drought resistance is reduced due to the loss of the function of ZmCP 03.

The above description is only for the preferred embodiment of the present invention, and is not intended to limit the present invention in any way. Any simple modification, change and equivalent changes of the above embodiments according to the technical essence of the invention are still within the protection scope of the technical solution of the invention.

Claims (2)

1. The application of the corn ZmCP03 gene is characterized in that the corn ZmCP03 gene is overexpressed in a corn plant and is used for improving the drought resistance of the corn; the nucleotide sequence of the corn ZmCP03 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the corn ZmCP03 gene is shown as SEQ ID NO. 2.

2. The use of the maize ZmCP03 gene of claim 1, wherein the maize ZmCP03 gene is overexpressed in a maize plant by the method comprising:

cloning of S1 and ZmCP03 genes:

s101, selecting a corn B73 self-bred system as an experimental material, extracting RNA of a leaf tissue of a corn in a three-leaf stage, and performing reverse transcription to obtain cDNA;

s102, carrying out PCR amplification by taking the cDNA obtained in S101 as a template and taking a primer ZmCP03-F and a primer ZmCP03-R as primers to obtain a PCR product;

the reaction system for PCR amplification is as follows: 1 mu L of cDNA, 1 mu L of KOD high fidelity enzyme, 1 mu L of primer ZmCP03-F, 1 mu L of primer ZmCP03-R, 5 mu L of buffer, 10 mu L of dNTP mix and sterile water to make up to 50 mu L;

the reaction procedure of the PCR amplification is as follows: pre-denaturation at 94 deg.C for 5min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 45s, and extension at 72 ℃ for 64s, and after 30 cycles, adding 0.5 mu L of Taq enzyme and extension at 72 ℃ for 10min;

the nucleotide sequence of the primer ZmCP03-F is shown as SEQ ID NO. 3;

the nucleotide sequence of the primer ZmCP03-R is shown as SEQ ID NO. 4;

s103, performing gel cutting recovery on the PCR product obtained in the S102 by using a gel recovery kit, connecting the PCR product with a vector pCambia3300, then transforming the PCR product into escherichia coli Trans5 alpha competent cells, performing double enzyme digestion verification by using XbaI/BamH I, screening and selecting bacterial liquid corresponding to 1-3 positive bands, and sequencing;

bioinformatics analysis of S2, zmCP03 gene:

comparing the sequencing result in S103 with the nucleotide sequence of the ZmCP03 gene of the corn through Mega4.0 software, wherein if the nucleotide sequences are the same, the cloning is successful, and the PCR product in S102 with successful cloning is the ZmCP03 target gene fragment;

s3, construction of a maize ZmCP03 gene overexpression vector:

carrying out double enzyme digestion on the vector pCambia3300 by BsaI/Eco31I to obtain a large fragment of the pCambia3300 vector; carrying out double enzyme digestion on the ZmCP03 target gene fragment in S3 by BsaI/Eco31I to obtain a P-rDNao1 target fragment, recovering an enzyme digestion electrophoresis product by using an agarose gel recovery kit after verifying the size of the fragment by electrophoresis, and carrying out ligation reaction on the pCambia3300 carrier large fragment and the P-rDNao1 target fragment for 1h under the action of T4 ligase at the temperature of 37 ℃ to obtain a ligation product;

the system of the linking reaction is as follows: 3 mu L of pCambia3300 carrier large fragment, 5 mu L of P-rDNAO1 target fragment, 1 mu L of T4DNA ligase and 1 mu L of 10 XT 4DNA ligase buffer solution;

transforming the obtained connected product into escherichia coli competent cells, coating a transformed bacterium solution on an LB solid culture medium containing kanamycin, culturing at 37 ℃ for 12 hours, selecting positive clones for culturing, and carrying out plaque PCR identification to obtain a corn ZmCP03 gene overexpression vector, namely pCambia3300-ZmCP03 plasmid;

s4, corn genetic transformation of ZmCP03 gene:

transforming agrobacterium with the pCambia3300-ZmCP03 plasmid obtained in S3, infecting the immature embryo of maize inbred line B104 immature embryo, and obtaining ZmCP03 transgenic positive plant through induced culture, co-culture, screening culture, differentiation culture, rooting culture and transplanting seedling formation;

identification of S5, zmCP03 transgenic positive plants: and performing ZmCP03 gene PCR detection on the ZmCP03 transgenic positive plant obtained in S4, amplifying a strip with the same size as that in the pCambia3300-ZmCP03 plasmid in the positive control S3 at the position of 1059bp, and comparing the sequence after sequencing to be correct, thus obtaining the ZmCP03 gene over-expression plant of the corn.

Images