CN117402874A - Potato U6 gene promoter StU6 8-1 and cloning and application thereof - Google Patents
Potato U6 gene promoter StU6 8-1 and cloning and application thereof Download PDFInfo
- Publication number
- CN117402874A CN117402874A CN202310415113.7A CN202310415113A CN117402874A CN 117402874 A CN117402874 A CN 117402874A CN 202310415113 A CN202310415113 A CN 202310415113A CN 117402874 A CN117402874 A CN 117402874A
- Authority
- CN
- China
- Prior art keywords
- stu6
- potato
- promoter
- sgrna
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 244000061456 Solanum tuberosum Species 0.000 title claims abstract description 92
- 235000002595 Solanum tuberosum Nutrition 0.000 title claims abstract description 92
- 238000010367 cloning Methods 0.000 title claims abstract description 15
- 101150018082 U6 gene Proteins 0.000 title description 7
- 238000010362 genome editing Methods 0.000 claims abstract description 56
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 53
- 238000000034 method Methods 0.000 claims abstract description 22
- 108091027544 Subgenomic mRNA Proteins 0.000 claims abstract description 13
- 235000002637 Nicotiana tabacum Nutrition 0.000 claims abstract description 8
- 239000013598 vector Substances 0.000 claims description 52
- 239000013612 plasmid Substances 0.000 claims description 26
- 239000012634 fragment Substances 0.000 claims description 21
- 238000006243 chemical reaction Methods 0.000 claims description 18
- 238000012163 sequencing technique Methods 0.000 claims description 17
- 238000012408 PCR amplification Methods 0.000 claims description 15
- 241000208292 Solanaceae Species 0.000 claims description 12
- 238000010276 construction Methods 0.000 claims description 11
- 238000005516 engineering process Methods 0.000 claims description 10
- 238000004458 analytical method Methods 0.000 claims description 9
- 102000004190 Enzymes Human genes 0.000 claims description 8
- 108090000790 Enzymes Proteins 0.000 claims description 8
- 239000011543 agarose gel Substances 0.000 claims description 5
- 239000013599 cloning vector Substances 0.000 claims description 5
- 102000018120 Recombinases Human genes 0.000 claims description 4
- 108010091086 Recombinases Proteins 0.000 claims description 4
- 230000009261 transgenic effect Effects 0.000 claims description 4
- 108700001094 Plant Genes Proteins 0.000 claims description 3
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 244000061176 Nicotiana tabacum Species 0.000 claims 1
- 108091033409 CRISPR Proteins 0.000 abstract description 24
- 241000207746 Nicotiana benthamiana Species 0.000 abstract description 15
- 238000010354 CRISPR gene editing Methods 0.000 abstract description 12
- 230000009466 transformation Effects 0.000 abstract description 9
- 235000012015 potatoes Nutrition 0.000 abstract description 8
- 241000208125 Nicotiana Species 0.000 abstract description 7
- 238000010353 genetic engineering Methods 0.000 abstract description 4
- 230000001052 transient effect Effects 0.000 abstract description 4
- 230000000694 effects Effects 0.000 abstract description 3
- 230000002103 transcriptional effect Effects 0.000 abstract description 3
- 102000014450 RNA Polymerase III Human genes 0.000 abstract 2
- 108010078067 RNA Polymerase III Proteins 0.000 abstract 2
- 238000010453 CRISPR/Cas method Methods 0.000 abstract 1
- 239000007788 liquid Substances 0.000 description 11
- 230000001580 bacterial effect Effects 0.000 description 10
- 230000035772 mutation Effects 0.000 description 9
- 108020004414 DNA Proteins 0.000 description 7
- 206010020649 Hyperkeratosis Diseases 0.000 description 6
- 230000006801 homologous recombination Effects 0.000 description 6
- 238000002744 homologous recombination Methods 0.000 description 6
- 230000006872 improvement Effects 0.000 description 6
- 238000012217 deletion Methods 0.000 description 5
- 230000037430 deletion Effects 0.000 description 5
- 230000002068 genetic effect Effects 0.000 description 5
- 241000589158 Agrobacterium Species 0.000 description 4
- 241000219194 Arabidopsis Species 0.000 description 4
- 241000620209 Escherichia coli DH5[alpha] Species 0.000 description 4
- 238000003776 cleavage reaction Methods 0.000 description 4
- 238000010586 diagram Methods 0.000 description 4
- 230000000408 embryogenic effect Effects 0.000 description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 241000196324 Embryophyta Species 0.000 description 3
- 238000002347 injection Methods 0.000 description 3
- 239000007924 injection Substances 0.000 description 3
- 238000003780 insertion Methods 0.000 description 3
- 230000037431 insertion Effects 0.000 description 3
- 238000007480 sanger sequencing Methods 0.000 description 3
- 230000007017 scission Effects 0.000 description 3
- 229920000936 Agarose Polymers 0.000 description 2
- 102000012410 DNA Ligases Human genes 0.000 description 2
- 108010061982 DNA Ligases Proteins 0.000 description 2
- 240000000220 Panda oleosa Species 0.000 description 2
- 235000016496 Panda oleosa Nutrition 0.000 description 2
- 208000020584 Polyploidy Diseases 0.000 description 2
- 208000035199 Tetraploidy Diseases 0.000 description 2
- 241000209140 Triticum Species 0.000 description 2
- 235000021307 Triticum Nutrition 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 238000001816 cooling Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 230000029087 digestion Effects 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 230000006698 induction Effects 0.000 description 2
- 239000002609 medium Substances 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 239000012452 mother liquor Substances 0.000 description 2
- 210000004940 nucleus Anatomy 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000010257 thawing Methods 0.000 description 2
- 238000009966 trimming Methods 0.000 description 2
- 108091062157 Cis-regulatory element Proteins 0.000 description 1
- 102000004163 DNA-directed RNA polymerases Human genes 0.000 description 1
- 108090000626 DNA-directed RNA polymerases Proteins 0.000 description 1
- 235000016623 Fragaria vesca Nutrition 0.000 description 1
- 240000009088 Fragaria x ananassa Species 0.000 description 1
- 235000011363 Fragaria x ananassa Nutrition 0.000 description 1
- 244000068988 Glycine max Species 0.000 description 1
- 235000010469 Glycine max Nutrition 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 240000007594 Oryza sativa Species 0.000 description 1
- 235000007164 Oryza sativa Nutrition 0.000 description 1
- 241001520808 Panicum virgatum Species 0.000 description 1
- 102000039471 Small Nuclear RNA Human genes 0.000 description 1
- 108700026226 TATA Box Proteins 0.000 description 1
- 108091026822 U6 spliceosomal RNA Proteins 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 210000004102 animal cell Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 210000002615 epidermis Anatomy 0.000 description 1
- 238000005562 fading Methods 0.000 description 1
- 238000012239 gene modification Methods 0.000 description 1
- 230000005017 genetic modification Effects 0.000 description 1
- 235000013617 genetically modified food Nutrition 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 238000009630 liquid culture Methods 0.000 description 1
- 150000007523 nucleic acids Chemical group 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 230000005849 recognition of pollen Effects 0.000 description 1
- 235000009566 rice Nutrition 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 108091029842 small nuclear ribonucleic acid Proteins 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1247—DNA-directed RNA polymerase (2.7.7.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07006—DNA-directed RNA polymerase (2.7.7.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, in particular relates to a potato U6 RNA polymerase III type promoter, in particular to a StU6 8-1 gene promoter, and further discloses a cloning method and application thereof. The potato RNA polymerase III type promoter StU6 8-1 is cloned in potatoes, has high-efficiency transcriptional activity, can drive downstream sgRNA to express, respectively verifies the activity of the two promoters and the feasibility of the two promoters applied to the CRISPR/Cas9 gene editing of the potatoes through a transient transformation system of the Nicotiana benthamiana leaf and a stable transformation system of the potatoes, and realizes CRISPR/Cas 9-guided genome editing of the potatoes. In the technical field of transgenosis, the promoters are not only applicable to potatoes, but also applicable to other solanaceous crops such as tobacco and the like.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, relates to the technical field of plant transgenosis, and in particular relates to cloning and application of a potato U6 promoter.
Background
Potato (Solanum tuberosum) is the fourth largest food crop worldwide, next to rice, corn and wheat. Potato cultivars are mainly tetraploids (2n=4x=48), are self-bred crops through tubers, and have the characteristics of self-fading and self-incompatibility. The potato is mainly bred by traditional hybridization, namely, the hybrid combination is prepared by utilizing parents with better coordination force, and the obtained offspring of the actual seeds are identified in character, so that new varieties are bred. Therefore, the breeding period of the new potato variety is longer, the breeding characteristics have stronger randomness, and important characteristics such as yield, quality, stress resistance and the like are difficult to be considered. Efficient techniques for genetic modification of potatoes are urgently needed.
In the beginning of 2013, CRISPR/Cas9 technology (Clustered Regularly Interspaced Short Palindromic Repeat-associated protein 9) was developed and successfully applied to gene editing of animal cells (Cong et al, 2013; ran et al, 2013). Because of the advantages of high editing efficiency, simple operation, low off-target rate and the like, a plurality of CRISPR/Cas9 systems for plant gene editing have been developed and applied in 2013 (Miao et al, 2013; jiang et al, 2013; shan et al, 2013), and then the plant CRISPR/Cas9 systems have been rapidly developed and applied. Although CRISPR/Cas9 technology has been widely used for crop functional gene and genetic improvement studies, most of the related studies have focused mainly on diploid crops. The genomes of some important food and commercial crops are polyploid, which places higher demands on the efficiency of the CRISPR/Cas9 system. At present, CRISPR/Cas9 technology has been used for genetic improvement of polyploid crop traits like wheat, switchgrass, soybean and strawberry (Wang et al, 2014; cai et al, 2018; liu et al, 2018; mart i n-Pizarro et al, 2019). Therefore, developing the CRISPR/Cas9 technology of the tetraploid potato cultivar not only is beneficial to research on the gene functions of the potato, but also provides a new tool for genetic engineering improvement of the potato in the future.
In the CRISPR/Cas9 system, the U6 snRNA (Small nuclear RNA) promoter is a class of RNA polymerase type III promoters within the nucleus, often used to drive expression of sgrnas within the nucleus. The U6 promoter has certain species specificity, and the use of the endogenous U6 promoter of the plant species can have higher editing efficiency in the gene editing process. Currently, the endogenous U6 promoter available for potato gene editing is less studied and still lacks a suitable potato U6 promoter, which limits the application of potato gene editing technology. Therefore, the screening and research of the high-activity U6 promoter in the potato plays an important role in promoting genetic engineering and genetic improvement of the potato.
To this end, the invention aims to provide a potato U6 promoter StU6 8-1, and further discloses a cloning method and application thereof.
The potato U6 promoter provided by the invention is StU6 8-1; the DNA nucleotide sequence of StU6 8-1 promoter is shown in SEQ ID No. 2. The StU6 8-1 promoter is derived from the 8 th chromosome of potato.
The invention also provides a cloning method for cloning the potato StU6 8-1 promoter, which comprises the following steps:
(1) Taking genomic DNA of a leaf of a potato cultivar 'green potato No. 9' as a template, carrying out PCR amplification by adopting a specific primer of StU6 8-1, and carrying out PCR amplification in a 25 mu L reaction system by using high-fidelity enzyme PhantaR Max, wherein the PCR reaction program is as follows: 3min at 95 ℃;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; purifying the PCR product by agarose gel cutting;
(2) Cloning the purified PCR product onto pEASYR-Blunt cloning vector, transferring into colibacillus DH5 alpha, and picking up monoclonal extracted plasmid for sequencing analysis to obtain 511 bp StU6 8-1 gene promoter segment as shown in SEQ ID No. 2.
Specific primers for StU6 8-1 are as follows:
StU6 8-1pF:AATTGACGGGTAGACATCA,
StU6 8-1pR:CAGACATATAGGTTAATGTTTTG。
the invention also discloses an sgRNA expression cassette vector for constructing the potato gene editing vector, namely StU6 8-1 containing the potato U6 promoter.
Specifically, the potato sgRNA expression cassette vector is recombinant plasmid StU6 8-1-sgRNA.
The invention also provides a construction method of the sgRNA expression cassette vector for the potato gene editing vector, which comprises the following steps:
(1) PCR amplification was performed on the StU6 8-1 gene promoter using the StU6 8-1 gene promoter sequence shown in SEQ ID No. 2 as a template and the following homology arm-containing primers:
StU6 8-1gF:GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA;
StU6 8-1gR:TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG;
purifying the PCR product to obtain StU6 8-1 gene promoter fragments containing homology arms;
(2) PCR was performed using the plasmid pYLsgRNA-AtU6-1 as a template and primers sgRNA-F and sgRNA-R to delete and linearize the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1, the primer sequences were as follows:
sgRNA-F:AGAGACCTCTGAAGATAACA;
sgRNA-R:TCCTTTGCTGCCGATTCCAC;
PCR amplification was performed in a 25. Mu.L reaction system using the high fidelity enzyme PhantaR Max, the PCR reaction procedure was: 3min at 95 ℃;95℃30s,52℃30s,72℃3:30s,30 cycles, then 72 ℃ for 5min; purifying the PCR product by agarose gel cutting to obtain linearized pYLsgRNA plasmid;
(3) And (3) recombining the StU6 8-1 gene promoter fragment containing the homology arm in the step (1) into the linearized pYLsgRNA plasmid in the step (2) by using ExnaseRII recombinase to obtain the sgRNA expression cassette vector StU6 8-1-sgRNA for the potato gene editing vector.
The potato U6 promoter StU6 8-1 is applied to the transgenic technology of the solanaceae plants or the construction of the gene editing vector of the solanaceae plants. The Solanaceae plant comprises tobacco and potato. The potato StU6 4-1 promoter and the StU6 8-1 promoter have transcriptional activity, can drive downstream sgRNA to express, realize the directional editing of the Nicotiana benthamiana and potato genes driven by the potato endogenous U6 promoter, and can carry out single-site or multi-site gene editing on the target genes.
The sgRNA expression cassette vector is applied to the solanaceae plant transgenic technology or the construction of a solanaceae plant gene editing vector. The Solanaceae plant comprises tobacco and potato.
According to the invention, two novel potato U6 promoters are cloned, stU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors used for editing potato genes are constructed, and Nicotiana benthamiana NbPDS and potato StPDS gene editing vectors are constructed through the two vectors. The transient transformation of the leaf blades of the Nicotiana benthamiana and the steady transformation of embryogenic callus of the stem segments of the potato verify the activity of two U6 promoters and the feasibility of the application of the two U6 promoters in the CRISPR/Cas9 technology of the tobacco and the potato, realize the single-target site CRISPR/Cas9 gene editing of target genes of the potato and the tobacco, and further realize the efficient and purposeful genetic improvement and germplasm innovation of the potato or other solanaceae crops. In the gene editing operation, stU6 4-1 and StU6 8-1 promoters can be used for driving expression of single-target-sgRNA (example 3) and driving expression of multiple-target-sgRNA (example 4), respectively, so that single-target site editing of genes or multi-gene (multi-target site) gene editing can be realized.
Fig. 1: stU6 4-1 promoter and StU6 8-1 promoter cloned from potato leaf genome.
Fig. 2: schematic representation of StU6 4-1-sgRNA vector and StU6 8-1-sgRNA vector constructed by homologous recombination method.
Fig. 3: bsa I cleavage of StU6 4-1-sgRNA vector and StU6 8-1-sgRNA vector.
Fig. 4: the vector diagram for NbPDS gene editing of Nicotiana benthamiana is shown, wherein the nucleic acid sequence of the vector diagram is a gene editing target of NbPDS.
Fig. 5: sequencing peak diagram and sequencing result of NbPDS gene editing sequence mutation of Nicotiana benthamiana; sequencing results showed that transformation of StU6 4-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 vectors was able to cause base deletion mutations in the NbPDS gene sequences.
Fig. 6: schematic of vectors for potato StPDS gene editing, where T1 and T2 represent gene editing target sequences driven by two potato U6 promoters, respectively.
Fig. 7: sequencing peak diagram and sequencing result of potato StPDS gene editing sequence mutation. Sequencing results show that after the StPDS-Cas9 vector is transferred into potato stem embryogenic callus, the sequence of a potato StPDS gene is changed, and base deletion or insertion mutation occurs in both gene editing target sites.
For further understanding of the present invention, the two potato U6 promoters provided herein and cloning and application thereof will be described with reference to the examples, the scope of the present invention not being limited by the following examples.
The potato two U6 gene promoters StU6 4-1 and StU6 8-1 are obtained by the following steps:
1. a typical U6 gene sequence in potato was found by BlastN alignment using the Arabidopsis AtU-1 gene sequence in the potato genome database (http:// spuddb. Uga. Edu/dm_v6_1_download. Sht-ml). The typical potato U6 gene sequence differs from the Arabidopsis AtU-1 gene sequence by only 3 SNPs, indicating that the U6 gene sequence is more conserved between potato and Arabidopsis. Both the potato U6 gene promoter sequence and the Arabidopsis AtU-1 gene promoter sequence have typical cis-acting elements of TATA box and USE motif. StU6 4-1 and StU6 8-1 promoters were finally selected for cloning.
2. Primers were designed in StU6 4-1 and StU6 8-1 promoter reference sequences for sequence cloning.
The following primers were designed for StU6 4-1 promoter clones:
StU6 4-1pF:GGGCTTCACTGTGAATTTAG;
StU6 4-1pR:CAAACACATATGTTGTTGTTGA;
specific primers were designed for the promoter StU6 8-1 as follows:
StU6 8-1pF:AATTGACGGGTAGACATCA;
StU6 8-1pR:CAGACATATAGGTTAATGTTTTG;
3. the primers are used for PCR amplification by using the genomic DNA of the leaf of the potato cultivar 'green potato No. 9' as a template and using the high-fidelity enzyme PhantaR Max. The PCR reaction volume was 25. Mu.L. The PCR reaction procedure was 95℃for 3min;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; the resulting PCR product was purified by agarose gel-cutting (as shown in FIG. 1). And (3) connecting the purified PCR fragment with a pEASYR-Blunt cloning vector, transferring the PCR fragment into escherichia coli DH5 alpha, picking a monoclonal colony, and extracting plasmids in positive clone bacterial liquid for sequencing analysis. A466 bp StU6 4-1 gene promoter fragment shown in the sequence SEQ ID No. 1 and a 511 bp StU6 8-1 gene promoter fragment shown in the sequence SEQ ID No. 2 are obtained.
Construction of potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors, which specifically comprises the following steps:
1. the 466 bp StU6 4-1 gene promoter fragment shown in SEQ ID No. 1 and the 511 bp StU6 8-1 gene promoter fragment shown in SEQ ID No. 2 are used as templates, and the following primers containing homology arms are designed to respectively carry out PCR amplification on the StU6 4-1 gene promoter and the StU6 8-1 gene promoter:
StU6 4-1gF:GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG;
StU6 4-1gR:TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA;
StU6 8-1gF:GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA;
StU6 8-1gR:TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG;
2. PCR amplification was performed with the high fidelity enzyme PhantaR Max. The PCR reaction volume was 25. Mu.L. The PCR reaction procedure was 95℃for 3min;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; the PCR product was purified by agarose gel cutting.
3. The plasmid pYLsgRNA-AtU6-1 is used as a template, primers sgRNA-F and sgRNA-R are designed for PCR, and the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1 is deleted and subjected to plasmid linearization, wherein the primer sequences are as follows:
sgRNA-F:AGAGACCTCTGAAGATAACA;
sgRNA-R:TCCTTTGCTGCCGATTCCAC;
PCR amplification was performed with the high fidelity enzyme PhantaR Max. The PCR reaction volume was 50. Mu.L. The PCR reaction procedure was 95℃for 3min;95℃30s,55℃30s,72℃3:30min,30 cycles, then 5min at 72 ℃; the PCR product was purified by agarose gel-cutting to obtain linearized pYLsgRNA plasmid fragments.
4. And (3) respectively connecting the StU6 4-1 promoter fragment containing the homology arm sequence obtained in the step (2) and the StU6 8-1 promoter fragment into the linearized pYLsgRNA plasmid obtained in the step (3) through homologous recombination reaction. The homologous recombination reaction is carried out by using the ExnaseRII recombinase, the reaction volume is 20 mu L, the reaction system is 2 mu L of the ExnaseRII recombinase, 4 mu L of 5 XCE buffer, 2 mu L of linearized pYLsgRNA plasmid, 1 mu L of promoter fragment containing homology arm U6 and ddH 2 O11. Mu.L. The homologous recombination reaction was performed at 37℃for 40min and on ice for 2min. Then 10 mu L of homologous recombination product is transferred into escherichia coli DH5 alpha, a monoclonal colony is picked up, and plasmids in positive clone bacterial liquid are extracted for sequencing analysis. Potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors were obtained.
5. The StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors constructed by homologous recombination should contain 3 Bsa I cleavage sites, respectively (as shown in FIG. 2), so that vector accuracy was identified by Bsa I cleavage of StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors. After Bsa I single cleavage reaction, stU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors can be digested into 3 bands, which are consistent with theoretical expectations (as shown in FIG. 3), and further illustrate the accuracy of the construction of the two potato U6 promoter expression cassette vectors.
Construction of NbPDS gene editing vector of Nicotiana benthamiana and mutation of NbPDS gene sequence, and the specific steps are as follows:
1. NbPDS gene editing target site design and target joint preparation
According to the NbPDS gene sequence of Nicotiana benthamiana, TACGAGAACTGCAGTCCACG is selected as a target site sequence, and a target joint primer pair is designed according to the sequence:
the following primer pairs were designed for the target point linked to the StU6 4-1 promoter:
NbPDS-4-F:TTTGTACGAGAACTGCAGTCCACG;
NbPDS-4-R:AAACCGTGGACTGCAGTTCTCGTA;
the following primer pairs were designed for the target point linked to the StU6 8-1 promoter:
NbPDS-8-F:TCTGTACGAGAACTGCAGTCCACG;
NbPDS-8-R:AAACCGTGGACTGCAGTTCTCGTA;
the above adaptor primer was dissolved in 100. Mu.M mother liquor, and 1. Mu.L of each of the pair primers was added to 98. Mu.L of 0.5 XTE and mixed to 1. Mu.M. And (5) cooling at 90 ℃ at 30 and s at room temperature to finish annealing.
2. 1. Mu.g of StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmid were each digested with 10U Bsa I for 20min at 25. Mu.L, and the digested products were frozen at-20 ℃.
3. Construction of NbPDS single target gene editing carrier of Nicotiana benthamiana
And (3) respectively connecting the target joint obtained in the step (1) and the plasmid digestion products of the StU6 4-1-sgRNA and the StU6 8-1-sgRNA obtained in the step (2) by using T4 DNA ligase to respectively obtain fragments of the StU6 4-1 promoter-target-sgRNA and the StU6 8-1 promoter-target-sgRNA. Fragments of StU6 4-1 promoter-target-sgRNA and StU6 8-1 promoter-target-sgRNA are respectively connected into 35S-Cas9-Kana vectors by using a method of 'edge trimming and connecting' (Ma et al 2015), and finally two single-target NbPDS gene editing vectors of StU6 4-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 are obtained.
4. Transient transformation NbPDS gene editing carrier for Nicotiana benthamiana leaf
StU6 4-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vectors are respectively transferred into agrobacterium LBA4404 by a freeze thawing method. Shaking the LBA4404 bacterial liquid containing StU6 4-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vector, and adjusting the bacterial liquid concentration to OD by using bacterial liquid injection buffer solution 600 An appropriate amount of agrobacterium liquid was aspirated with a syringe and injected into the leaf from the inferior epidermis of the leaf of nicotiana benthamiana. 5 days after injection of Nicotiana benthamiana leaves, sequencing analysis was performed on NbPDS gene target sequences at the leaf injection site.
5. Sequencing analysis of NbPDS Gene target site sequence
Extracting the leaf DNA of Nicotiana benthamiana by using a CTAB method, and using the following primers:
NbPDS-F:GGAAGTGGCTGAACGATAT;
NbPDS-R:TCACCATGCTAAACTACGC;
and carrying out PCR amplification on NbPDS gene fragments in the transient transformed Nicotiana benthamiana leaves, and purifying PCR products. The PCR product was subjected to Sanger sequencing with the primer NbPDS-F, and if the sequencing result showed a nested peak near the target site, it was considered that gene editing occurred at the NbPDS gene target site (as shown in FIG. 5). The NbPDS gene fragment subjected to gene editing is connected into a pEASYR-Blunt cloning vector, then transferred into escherichia coli DH5 alpha, and monoclonal colonies are picked up, and plasmids in positive clone bacterial liquid are extracted for sequencing analysis. By comparison with the wild NbPDS gene sequence, specific mutation modes of NbPDS target sites in leaves of the StU6 4-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vectors are analyzed and transformed. As shown in FIG. 5, transformation of StU6 4-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vectors can lead to gene editing of NbPDS gene target sites, and the gene editing type is base deletion.
The construction of the potato StPDS double-target gene editing vector and the mutation of StPDS sequences comprise the following specific steps:
1. cloning of StPDS Gene sequences
Extracting the genome DNA of the leaf of the potato variety 'green potato No. 9' by a CTAB method. The following primers were designed based on the potato StPDS gene reference sequence:
StPDS-F:ATGCCTCAAATTGGACTTGT;
StPDS-R:TATGAAACAGACCCTACCCC;
using the primers, PCR amplification was performed in a 25. Mu.L system using the high fidelity enzyme PhantaR Max and potato leaf DNA as a template. The PCR reaction procedure was 95℃for 3min;95℃30s,54℃30s,72℃1:30min,30 cycles, then 5min at 72 ℃; the PCR products are detected by agarose gel electrophoresis and cut and purified. The PCR products were Sanger sequenced using the primers StPDS-seqF and StPDS-seqR, the primer sequences were as follows:
StPDS-seqF:GGCTTGCAAAATACTGTACT;
StPDS-seqR:GCTTCCTTCGAAATAAAGCA;
finally, stPDS gene sequence information is obtained.
2. StPDS gene editing target site design and target joint preparation
According to the StPDS gene sequence obtained in step 1, two gene editing target sites were selected, which are respectively the sequences T1 located in the first exon: CCATGCCACGACCAGAAGAT, sequence T2 at the third exon: AACCGATACTACTGGAGGCA. Designing target joint primers according to T1 and T2 sequences:
the following primer pairs were designed for the T1 target linked to the StU6 4-1 promoter:
StPDS-4-F:TTTGCCATGCCACGACCAGAAGAT;
StPDS-4-R:AAACATCTTCTGGTCGTGGCATGG;
the following primer pairs were designed for the T2 target linked to the StU6 8-1 promoter:
StPDS-8-F:TCTGAACCGATACTACTGGAGGCA;
StPDS-8-R:AAACTGCCTCCAGTAGTATCGGTT;
the above adaptor primer was dissolved in 100. Mu.M mother liquor, and 1. Mu.L of each of the pair primers was added to 98. Mu.L of 0.5 XTE and mixed to 1. Mu.M. And (5) cooling at 90 ℃ at 30 and s at room temperature to finish annealing.
3. 1. Mu.g of StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmid were each digested with 10U Bsa I for 20min at 25. Mu.L, and the digested products were frozen at-20 ℃.
4. Construction of potato StPDS double-target gene editing vector
And (3) respectively connecting the target joint obtained in the step (2) with the StU6 4-1-sgRNA and the StU6 8-1-sgRNA plasmid digestion products obtained in the step (3) by using T4 DNA ligase to respectively obtain fragments of a StU6 4-1 promoter-target T1-sgRNA and a StU6 8-1 promoter-target T2-sgRNA. Fragments of StU6 4-1 promoter-target T1-sgRNA and StU6 8-1 promoter-target T2-sgRNA were sequentially ligated into a 35S-Cas9-Kana vector using the 'edge trimming ligation' method (Ma et al 2015), and finally a StPDS-Cas9 dual-target gene editing vector was obtained, in which T1 target site-sgRNA was driven by StU6 4-1 promoter and T2-target site-sgRNA was driven by StU6 8-1 promoter (as shown in FIG. 6).
5. Stable transformation of potato stem callus
The StPDS-Cas9 double-target gene editing vector is transferred into agrobacterium LBA4404 by a freeze thawing method. Shaking the LBA4404 bacterial liquid containing StPDS-Cas9 carrier, suspending the bacterial liquid with MS liquid culture medium to reach bacterial liquid concentration OD 600 =0.5. And (3) taking the stem segment of the potato variety D187 tissue culture seedling as an explant, and carrying out agrobacterium infection. The stem explants were co-cultivated for 2d on resistant callus induction medium containing Kana for about 30d and then on cluster bud induction medium containing Kana for about 30d. Embryogenic resistant calli at the differentiation stage are finally obtained.
6. Sequencing analysis of StPDS Gene target site sequences
Extracting embryogenic resistant callus DNA of potato stem by using a CTAB method, carrying out PCR amplification by using StPDS-F and StPDS-R primers, and purifying a PCR product. Sanger sequencing was performed on StPDS target sites T1 and T2 with primers StPDS-seqF and StPDS-seqR, respectively, and if the sequencing result showed a nested peak near the target site, it was considered that gene editing occurred on the StPDS gene target site (as shown in FIG. 7). The StPDS gene fragment with the gene editing is connected into pEASYR-Blunt cloning vector, then transferred into escherichia coli DH5 alpha, and monoclonal colony is picked up, and plasmid in positive clone bacterial liquid is extracted for Sanger sequencing analysis. By comparison with a wild type StPDS gene sequence, a specific mutation mode of a StPDS target site in the resistant callus of the transformed StPDS-Cas9 gene editing vector is analyzed. As shown in FIG. 7, transformation of the StPDS-Cas9 gene editing vector can result in gene editing of two target sites of the StPDS genes T1 and T2 in potato-resistant calli, and the type of gene editing is base deletion or base insertion.
Therefore, the potato StU6 4-1 promoter and the StU6 8-1 promoter obtained by the invention have transcriptional activity, can drive downstream sgRNA to express, realize the directional editing of Nicotiana benthamiana and potato genes driven by the potato endogenous U6 promoter, and can carry out single-site or multi-site gene editing on the target genes; sequencing the target site clone sequence after gene editing finds that mutation types comprise base insertion and base deletion. Therefore, the two potato endogenous U6 promoters can be applied to not only potatoes but also tobacco CRISPR/Cas9 gene editing systems, so that efficient and accurate trait genetic improvement of solanaceous crops such as tobacco, potatoes and the like is realized.
The foregoing description of the preferred embodiments of the invention is merely exemplary and is not intended to limit the scope of the invention. It should be noted that modifications can be made by those skilled in the art without departing from the principles of the present invention, which modifications should also be considered as being within the scope of the present invention.
Claims (8)
1. Potato U6 promoter sequence, characterized in that: the potato U6 promoter is StU6 8-1; the DNA nucleotide sequence of StU6 8-1 promoter is shown in SEQ ID No. 2.
2. The sgRNA expression cassette vector for constructing the potato gene editing vector is characterized in that: stU6 8-1 comprising the potato U6 promoter of claim 1.
3. The cloning method of the potato U6 promoter according to claim 1, wherein: the method comprises the following steps:
(1) Taking genomic DNA of a leaf of a potato cultivar 'green potato No. 9' as a template, carrying out PCR amplification by adopting a specific primer of StU6 8-1, and carrying out PCR amplification in a 25 mu L reaction system by using high-fidelity enzyme PhantaR Max, wherein the PCR reaction program is as follows: 3min at 95 ℃;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; purifying the PCR product by agarose gel cutting;
(2) Cloning the purified PCR product onto pEASYR-Blunt cloning vector, transferring into colibacillus DH5 alpha, and picking up monoclonal extracted plasmid for sequencing analysis to obtain 511 bp StU6 8-1 gene promoter segment.
4. A cloning method according to claim 3, wherein: specific primers for StU6 8-1 were as follows:
StU6 8-1pF:AATTGACGGGTAGACATCA;
StU6 8-1pR:CAGACATATAGGTTAATGTTTTG。
5. the sgRNA expression cassette vector of claim 2, wherein: the sgRNA expression cassette vector is recombinant plasmid StU6 8-1-sgRNA, and the construction method comprises the following steps:
(1) PCR amplification was performed on the StU6 8-1 gene promoter using the StU6 8-1 gene promoter sequence shown in SEQ ID No. 2 as a template and the following homology arm-containing primers:
StU6 8-1gF:GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA;
StU6 8-1gR:TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG;
purifying the PCR product to obtain StU6 8-1 gene promoter fragments containing homology arms;
(2) PCR was performed using the plasmid pYLsgRNA-AtU6-1 as a template and primers sgRNA-F and sgRNA-R to delete and linearize the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1, the primer sequences were as follows:
sgRNA-F:AGAGACCTCTGAAGATAACA;
sgRNA-R:TCCTTTGCTGCCGATTCCAC;
PCR amplification was performed in a 25. Mu.L reaction system using the high fidelity enzyme PhantaR Max, the PCR reaction procedure was: 3min at 95 ℃;95℃30s,52℃30s,72℃3:30s,30 cycles, then 72 ℃ for 5min; purifying the PCR product by agarose gel cutting to obtain linearized pYLsgRNA plasmid;
(3) And (3) recombining the StU6 8-1 gene promoter fragment containing the homology arm in the step (1) into the linearized pYLsgRNA plasmid in the step (2) by using ExnaseRII recombinase to obtain the sgRNA expression cassette vector StU6 8-1-sgRNA for the potato gene editing vector.
6. Use of the potato U6 promoter StU6 8-1 of claim 1 in solanaceae plant transgenic technology or in constructing a solanaceae plant gene editing vector.
7. Use of the sgRNA expression cassette vector of claim 2 or 5 in the transgenic technology of solanaceae plants or in the construction of a gene editing vector of solanaceae plants.
8. Use according to claim 6 or 7, characterized in that: the Solanaceae plant comprises tobacco and potato.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202310415113.7A CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111390729.0A CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
CN202310415113.7A CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111390729.0A Division CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN117402874A true CN117402874A (en) | 2024-01-16 |
Family
ID=79929881
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111390729.0A Active CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
CN202310415113.7A Pending CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111390729.0A Active CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (2) | CN113999850B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112481259B (en) * | 2020-11-24 | 2022-09-16 | 南昌大学 | Cloning and application of two sweet potato U6 gene promoters IbU6 |
CN114703189B (en) * | 2022-03-31 | 2023-05-23 | 东北林业大学 | Fraxinus mandshurica U6 gene promoter proFMU6.3, cloning and application thereof |
CN117844863B (en) * | 2024-03-06 | 2024-05-17 | 云南师范大学 | Potato mitochondria targeted expression vector, construction method and application |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
SE1650598A1 (en) * | 2016-05-03 | 2017-11-04 | Lyckeby Starch Ab | Amylopectin potato starch with improved stability against retrogradation and improved freeze and thaw stability |
-
2021
- 2021-11-23 CN CN202111390729.0A patent/CN113999850B/en active Active
- 2021-11-23 CN CN202310415113.7A patent/CN117402874A/en active Pending
Also Published As
Publication number | Publication date |
---|---|
CN113999850B (en) | 2023-06-23 |
CN113999850A (en) | 2022-02-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113999850B (en) | Potato U6 RNA polymerase III type promoter, cloning and application thereof | |
CN107988229B (en) | Method for obtaining tillering-changed rice by modifying OsTAC1 gene through CRISPR-Cas | |
CN112852813B (en) | Asparagus U6 gene promoter AspU6p3 and cloning and application thereof | |
CN111187778A (en) | Wheat salt-tolerant gene TaFLZ2 and application thereof | |
CN116640770B (en) | Application of OsBRY1 gene in improving rice yield traits | |
CN107460195A (en) | Cabbage type rape als gene promoter and application | |
CN109852634B (en) | Method for cultivating high-nodulation nitrogen-fixing transgenic plant | |
CN116410986A (en) | Gene involved in regulating and controlling plant height, fruit shape and yield of tomatoes and application thereof | |
CN108165578B (en) | Efficient preparation method for mutant aiming at multiple members of same gene family of cabbage mustard simultaneously | |
CN107988225B (en) | Corn grain development related gene miR169o and application thereof | |
CN113024645B (en) | Application of wheat transcription factor WRKY70 gene in regulation and control of plant growth and development | |
CN112175990B (en) | Method for blocking or weakening expression of rice circRNA coding site to improve rice seedling growth traits | |
CN112481259B (en) | Cloning and application of two sweet potato U6 gene promoters IbU6 | |
CN109182350B (en) | Application of corn Zm675 gene in plant quality improvement | |
CN112522299A (en) | Method for obtaining rice with increased tillering by using OsTNC1 gene mutation | |
BR112021014917A2 (en) | METHODS AND COMPOSITIONS TO GENERATE DOMINANT SHORT STATURE ALLELES USING GENOME EDITING | |
CN111909956A (en) | Method for improving drought resistance of rice by blocking or weakening gene expression of OsNAC092 of rice | |
CN110862994A (en) | Gene ZKM76 for controlling plant height and ear position height of corn and application thereof | |
CN117866966B (en) | Betel nut U6 promoter and application thereof | |
CN116004622B (en) | Promoter of cotton APR gene, acquisition method and application thereof, fusion vector, preparation method and application | |
CN114181951B (en) | Corn sheath blight disease resistance related gene Zmbzip45 and application thereof | |
CN116064653B (en) | Application of tomato SlBBX gene in promotion of low-temperature resistance of tomatoes | |
CN115960899A (en) | Tea tree CsU6 gene promoter and cloning and application thereof | |
CN116240236A (en) | Method for regulating rice plant type by editing promoter of OsD gene of rice | |
CN115960948A (en) | Application of ZmCP03 gene in corn |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |