CN113999850B

CN113999850B - Potato U6 RNA polymerase III type promoter, cloning and application thereof

Info

Publication number: CN113999850B
Application number: CN202111390729.0A
Authority: CN
Inventors: 李有涵; 郭华春; 王琼; 马艳颖
Original assignee: Yunnan Agricultural University
Current assignee: Yunnan Agricultural University
Priority date: 2021-11-23
Filing date: 2021-11-23
Publication date: 2023-06-23
Anticipated expiration: 2041-11-23
Also published as: CN117402874A; CN113999850A

Abstract

The invention belongs to the technical field of genetic engineering, in particular relates to a potato U6 RNA polymerase III type promoter, more particularly relates to StU64-1 and StU68-1 gene promoters, and further discloses a cloning method and application thereof. According to the invention, two potato RNA polymerase III type promoters StU64-1 and StU68-1 are cloned in potatoes, have high-efficiency transcriptional activity, can drive downstream sgRNA expression, respectively verify the activity of the two promoters and the feasibility of the two promoters applied to the CRISPR/Cas9 gene editing of the potatoes through a transient transformation system of Nicotiana benthamiana leaves and a stable potato transformation system, and realize CRISPR/Cas 9-guided potato genome editing. In the technical field of transgenosis, the promoters are not only applicable to potatoes, but also applicable to other solanaceous crops such as tobacco and the like.

Description

Potato U6 RNA polymerase III type promoter, cloning and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, relates to the technical field of plant transgenosis, and in particular relates to cloning and application of a potato U6 promoter.

Background

Potato (Solanum tuberosum) is the fourth largest food crop worldwide, next to rice, corn and wheat. Potato cultivars are mainly tetraploids (2n=4x=48), are self-bred crops through tubers, and have the characteristics of self-fading and self-incompatibility. The potato is mainly bred by traditional hybridization, namely, the hybrid combination is prepared by utilizing parents with better coordination force, and the obtained offspring of the actual seeds are identified in character, so that new varieties are bred. Therefore, the breeding period of the new potato variety is longer, the breeding characteristics have stronger randomness, and important characteristics such as yield, quality, stress resistance and the like are difficult to be considered. Efficient techniques for genetic modification of potatoes are urgently needed.

In the beginning of 2013, CRISPR/Cas9 technology (Clustered Regularly Interspaced Short Palindromic Repeat-associated protein 9) was developed and successfully applied to gene editing of animal cells (Cong et al, 2013; ran et al, 2013). Because of the advantages of high editing efficiency, simple operation, low off-target rate and the like, a plurality of CRISPR/Cas9 systems for plant gene editing have been developed and applied in 2013 (Miao et al, 2013; jiang et al, 2013; shan et al, 2013), and then the plant CRISPR/Cas9 systems have been rapidly developed and applied. Although CRISPR/Cas9 technology has been widely used for crop functional gene and genetic improvement studies, most of the related studies have focused mainly on diploid crops. The genomes of some important food and commercial crops are polyploid, which places higher demands on the efficiency of the CRISPR/Cas9 system. At present, CRISPR/Cas9 technology has been used for genetic improvement of polyploid crop traits like wheat, switchgrass, soybean and strawberry (Wang et al, 2014; cai et al, 2018; liu et al, 2018; mart i n-Pizarro et al, 2019). Therefore, developing the CRISPR/Cas9 technology of the tetraploid potato cultivar not only is beneficial to research on the gene functions of the potato, but also provides a new tool for genetic engineering improvement of the potato in the future.

In the CRISPR/Cas9 system, the U6 snRNA (Small nuclear RNA) promoter is a class of RNA polymerase type III promoters within the nucleus, often used to drive expression of sgrnas within the nucleus. The U6 promoter has certain species specificity, and the use of the endogenous U6 promoter of the plant species can have higher editing efficiency in the gene editing process. Currently, the endogenous U6 promoter available for potato gene editing is less studied and still lacks a suitable potato U6 promoter, which limits the application of potato gene editing technology. Therefore, the screening and research of the high-activity U6 promoter in the potato plays an important role in promoting genetic engineering and genetic improvement of the potato.

The invention comprises the following steps:

to this end, the object of the present invention is to provide two potato U6 promoters StU64-1 and StU68-1, and further disclose cloning methods and applications thereof.

The potato U6 promoter provided by the invention comprises StU64-1 and/or StU6 8-1; stU64-1 promoter contains the DNA nucleotide sequence shown in SEQ ID No. 1; stU68-1 promoter contains the DNA nucleotide sequence shown in SEQ ID No. 2.

The StU64-1 promoter is derived from potato chromosome 4; the StU68-1 promoter is derived from the 8 th chromosome of potato.

The invention also discloses two sgRNA expression cassette vectors for constructing the potato gene editing vector, namely StU64-1 or/and StU68-1 containing a potato U6 promoter.

Specifically, the potato sgRNA expression cassette vector is recombinant plasmid StU6 4-1-sgRNA and/or StU6 8-1-sgRNA.

The invention also provides a specific primer for cloning the potato StU64-1 promoter or the StU68-1 promoter, which comprises the following steps:

specific primers for the promoter StU64-1 were as follows:

StU6 4-1pF：GGGCTTCACTGTGAATTTAG，

StU6 4-1pR：CAAACACATATGTTGTTGTTGA；

specific primers for the promoter StU68-1 were as follows:

StU6 8-1pF：AATTGACGGGTAGACATCA，

StU6 8-1pR：CAGACATATAGGTTAATGTTTTG。

a cloning method comprising the steps of:

(1) Taking the genomic DNA of the leaf of the potato cultivar 'green potato No. 9' as a template, adopting the idiosyncratic primer of StU64-1 or StU68-1 to carry out PCR amplification, using high-fidelity enzyme PhantaR Max to carry out PCR amplification in a 25 mu L reaction system, wherein the PCR reaction program is as follows: 3min at 95 ℃;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; purifying the PCR product by agarose gel cutting;

(2) Cloning the purified PCR product onto pEASYR-Blunt cloning vector, transferring into colibacillus DH5 alpha, and picking up monoclonal extracted plasmid for sequencing analysis to obtain 466 bp StU64-1 gene promoter segment shown in SEQ ID No. 1 and 511 bp StU68-1 gene promoter segment shown in SEQ ID No. 2.

The invention also provides a construction method of the sgRNA expression cassette vector for the potato gene editing vector, which comprises the following steps:

(1) PCR amplification was performed using the StU64-1 gene promoter sequence shown in SEQ ID No. 1 or the StU68-1 gene promoter sequence shown in SEQ ID No. 2 as a template, and using the following primer pair containing homology arms to StU64-1 gene promoter or StU68-1 gene promoter:

StU6 4-1gF：GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG；

StU6 4-1gR：TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA；

StU6 8-1gF：GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA；

StU6 8-1gR：TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG；

purifying the PCR product to obtain a StU64-1 gene promoter fragment containing a homology arm and a StU68-1 gene promoter fragment containing a homology arm;

(2) PCR was performed using the plasmid pYLsgRNA-AtU6-1 as a template and primers sgRNA-F and sgRNA-R to delete and linearize the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1, the primer sequences were as follows:

sgRNA-F：AGAGACCTCTGAAGATAACA；

sgRNA-R：TCCTTTGCTGCCGATTCCAC；

PCR amplification was performed in a 25. Mu.L reaction system using the high fidelity enzyme PhantaR Max, the PCR reaction procedure was: 3min at 95 ℃;95℃30s,52℃30s,72℃3:30s,30 cycles, then 72 ℃ for 5min; purifying the PCR product by agarose gel cutting to obtain linearized pYLsgRNA plasmid;

(3) Recombining the StU64-1 gene promoter fragment containing the homology arm or the StU68-1 gene promoter fragment containing the homology arm in the step (1) into the linearized pYLsgRNA plasmid in the step (2) by using ExnaseRII recombinase to obtain a sgRNA expression cassette vector StU6 4-1-sgRNA or StU6 8-1-sgRNA used for the potato gene editing vector.

The potato U6 promoter StU64-1 and/or StU68-1 are applied to the transgenic technology of the solanaceae plants or the construction of the solanaceae plant gene editing vector. The Solanaceae plant comprises tobacco and potato. The potato StU64-1 promoter and the StU68-1 promoter have transcriptional activity, can drive downstream sgRNA to express, realize the directional editing of the Nicotiana benthamiana and potato genes driven by the potato endogenous U6 promoter, and can carry out single-site or multi-site gene editing on the target genes.

The sgRNA expression cassette vector is applied to the solanaceae plant transgenic technology or the construction of a solanaceae plant gene editing vector. The Solanaceae plant comprises tobacco and potato.

The beneficial effects are that:

according to the invention, two novel potato U6 promoters are cloned, stU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors used for editing potato genes are constructed, and Nicotiana benthamiana NbPDS and potato StPDS gene editing vectors are constructed through the two vectors. The transient transformation of the leaf blades of the Nicotiana benthamiana and the steady transformation of embryogenic callus of the stem segments of the potato verify the activity of two U6 promoters and the feasibility of the application of the two U6 promoters in the CRISPR/Cas9 technology of the tobacco and the potato, realize the single-target site CRISPR/Cas9 gene editing of target genes of the potato and the tobacco, and further realize the efficient and purposeful genetic improvement and germplasm innovation of the potato or other solanaceae crops. In the gene editing operation, stU64-1 and StU68-1 promoters can be used for driving expression of single-target-sgRNA (example 3) and driving expression of multiple-target-sgRNA (example 4), respectively, so that single-target site editing of genes or multi-gene (multi-target site) gene editing can be realized.

Description of the drawings:

fig. 1: stU64-1 promoter and StU68-1 promoter cloned from potato leaf genome.

Fig. 2: schematic representation of StU6 4-1-sgRNA vector and StU6 8-1-sgRNA vector constructed by homologous recombination method.

Fig. 3: bsa I cleavage of StU6 4-1-sgRNA vector and StU6 8-1-sgRNA vector.

Fig. 4: the vector diagram for NbPDS gene editing of Nicotiana benthamiana is shown, wherein the nucleic acid sequence of the vector diagram is a gene editing target of NbPDS.

Fig. 5: sequencing peak diagram and sequencing result of NbPDS gene editing sequence mutation of Nicotiana benthamiana; sequencing results showed that transformation of StU64-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 vectors was able to cause base deletion mutations in the NbPDS gene sequences.

Fig. 6: schematic of vectors for potato StPDS gene editing, where T1 and T2 represent gene editing target sequences driven by two potato U6 promoters, respectively.

Fig. 7: sequencing peak diagram and sequencing result of potato StPDS gene editing sequence mutation. Sequencing results show that after the StPDS-Cas9 vector is transferred into potato stem embryogenic callus, the sequence of a potato StPDS gene is changed, and base deletion or insertion mutation occurs in both gene editing target sites.

The specific embodiment is as follows:

for further understanding of the present invention, the two potato U6 promoters provided herein and cloning and application thereof will be described with reference to the examples, the scope of the present invention not being limited by the following examples.

Example 1:

the potato two U6 gene promoters StU64-1 and StU68-1 are obtained by the following steps:

1. a typical U6 gene sequence in potato was found by BlastN alignment using the Arabidopsis AtU-1 gene sequence in the potato genome database (http:// spuddb. Uga. Edu/dm_v6_1_download. Sht-ml). The typical potato U6 gene sequence differs from the Arabidopsis AtU-1 gene sequence by only 3 SNPs, indicating that the U6 gene sequence is more conserved between potato and Arabidopsis. Both the potato U6 gene promoter sequence and the Arabidopsis AtU-1 gene promoter sequence have typical cis-acting elements of TATA box and USE motif. StU64-1 and StU68-1 promoters were finally selected for cloning.

2. Primers were designed in StU64-1 and StU68-1 promoter reference sequences for sequence cloning.

The following primers were designed for StU64-1 promoter clones:

StU6 4-1pF：GGGCTTCACTGTGAATTTAG；

StU6 4-1pR：CAAACACATATGTTGTTGTTGA；

specific primers were designed for the promoter StU68-1 as follows:

StU6 8-1pF：AATTGACGGGTAGACATCA；

StU6 8-1pR：CAGACATATAGGTTAATGTTTTG；

3. the primers are used for PCR amplification by using the genomic DNA of the leaf of the potato cultivar 'green potato No. 9' as a template and using the high-fidelity enzyme PhantaR Max. The PCR reaction volume was 25. Mu.L. The PCR reaction procedure was 95℃for 3min;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; the resulting PCR product was purified by agarose gel-cutting (as shown in FIG. 1). And (3) connecting the purified PCR fragment with a pEASYR-Blunt cloning vector, transferring the PCR fragment into escherichia coli DH5 alpha, picking a monoclonal colony, and extracting plasmids in positive clone bacterial liquid for sequencing analysis. A466 bp StU64-1 gene promoter fragment shown in SEQ ID No. 1 and a 511 bp StU68-1 gene promoter fragment shown in SEQ ID No. 2 were obtained.

Example 2:

construction of potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors, which specifically comprises the following steps:

1. the 466 bp StU64-1 gene promoter fragment shown in SEQ ID No. 1 and the 511 bp StU68-1 gene promoter fragment shown in SEQ ID No. 2 are used as templates, and the following primers containing homology arms are designed to respectively carry out PCR amplification on the StU64-1 gene promoter and the StU68-1 gene promoter:

StU6 4-1gF：GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG；

StU6 4-1gR：TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA；

StU6 8-1gF：GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA；

StU6 8-1gR：TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG；

2. PCR amplification was performed with the high fidelity enzyme PhantaR Max. The PCR reaction volume was 25. Mu.L. The PCR reaction procedure was 95℃for 3min;95 ℃ for 30s,52 ℃ for 30s,72 ℃ for 30s,30 cycles, and then 72 ℃ for 5min; the PCR product was purified by agarose gel cutting.

3. The plasmid pYLsgRNA-AtU6-1 is used as a template, primers sgRNA-F and sgRNA-R are designed for PCR, and the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1 is deleted and subjected to plasmid linearization, wherein the primer sequences are as follows:

sgRNA-F：AGAGACCTCTGAAGATAACA；

sgRNA-R：TCCTTTGCTGCCGATTCCAC；

PCR amplification was performed with the high fidelity enzyme PhantaR Max. The PCR reaction volume was 50. Mu.L. The PCR reaction procedure was 95℃for 3min;95℃30s,55℃30s,72℃3:30min,30 cycles, then 5min at 72 ℃; the PCR product was purified by agarose gel-cutting to obtain linearized pYLsgRNA plasmid fragments.

4. And (3) respectively connecting the StU64-1 promoter fragment containing the homology arm sequence obtained in the step (2) and the StU68-1 promoter fragment into the linearized pYLsgRNA plasmid obtained in the step (3) through homologous recombination reaction. The homologous recombination reaction is carried out by using the ExnaseRII recombinase, the reaction volume is 20 mu L, the reaction system is 2 mu L of the ExnaseRII recombinase, 4 mu L of 5 XCE buffer, 2 mu L of linearized pYLsgRNA plasmid, 1 mu L of promoter fragment containing homology arm U6 and ddH ₂ O11. Mu.L. The homologous recombination reaction was performed at 37℃for 40min and on ice for 2min. Then 10 mu L of homologous recombination product is transferred into escherichia coli DH5 alpha, a monoclonal colony is picked up, and plasmids in positive clone bacterial liquid are extracted for sequencing analysis. Potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors were obtained.

5. The StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors constructed by homologous recombination should contain 3 Bsa I cleavage sites, respectively (as shown in FIG. 2), so that vector accuracy was identified by Bsa I cleavage of StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors. After Bsa I single cleavage reaction, stU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors can be digested into 3 bands, which are consistent with theoretical expectations (as shown in FIG. 3), and further illustrate the accuracy of the construction of the two potato U6 promoter expression cassette vectors.

Example 3:

construction of NbPDS gene editing vector of Nicotiana benthamiana and mutation of NbPDS gene sequence, and the specific steps are as follows:

1. NbPDS gene editing target site design and target joint preparation

According to the NbPDS gene sequence of Nicotiana benthamiana, TACGAGAACTGCAGTCCACG is selected as a target site sequence, and a target joint primer pair is designed according to the sequence:

the following primer pairs were designed for the target point linked to the StU64-1 promoter:

NbPDS-4-F：TTTGTACGAGAACTGCAGTCCACG；

NbPDS-4-R：AAACCGTGGACTGCAGTTCTCGTA；

the following primer pairs were designed for the target point linked to the StU68-1 promoter:

NbPDS-8-F：TCTGTACGAGAACTGCAGTCCACG；

NbPDS-8-R：AAACCGTGGACTGCAGTTCTCGTA；

the above adaptor primer was dissolved in 100. Mu.M mother liquor, and 1. Mu.L of each of the pair primers was added to 98. Mu.L of 0.5 XTE and mixed to 1. Mu.M. And (5) cooling at 90 ℃ at 30 and s at room temperature to finish annealing.

2. 1. Mu.g of StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmid were each digested with 10U Bsa I for 20min at 25. Mu.L, and the digested products were frozen at-20 ℃.

3. Construction of NbPDS single target gene editing carrier of Nicotiana benthamiana

And (3) respectively connecting the target joint obtained in the step (1) and the plasmid digestion products of the StU6 4-1-sgRNA and the StU6 8-1-sgRNA obtained in the step (2) by using T4 DNA ligase to respectively obtain fragments of the StU64-1 promoter-target-sgRNA and the StU68-1 promoter-target-sgRNA. Fragments of StU64-1 promoter-target-sgRNA and StU68-1 promoter-target-sgRNA are respectively connected into 35S-Cas9-Kana vectors by using a method of 'edge trimming and connecting' (Ma et al 2015), and finally two single-target NbPDS gene editing vectors of StU64-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 are obtained.

4. Transient transformation NbPDS gene editing carrier for Nicotiana benthamiana leaf

StU64-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vectors are respectively transferred into agrobacterium LBA4404 by a freeze thawing method. Shaking the LBA4404 bacterial liquid containing StU64-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vector, and adjusting the bacterial liquid concentration to OD by using bacterial liquid injection buffer solution ₆₀₀ An appropriate amount of agrobacterium liquid was aspirated with a syringe and injected into the leaf from the inferior epidermis of the leaf of nicotiana benthamiana. Leaf alignment was performed 5 days after injection of leaf of Nicotiana benthamianaThe NbPDS gene target sequence at the injection site was sequenced.

5. Sequencing analysis of NbPDS Gene target site sequence

Extracting the leaf DNA of Nicotiana benthamiana by using a CTAB method, and using the following primers:

NbPDS-F：GGAAGTGGCTGAACGATAT；

NbPDS-R：TCACCATGCTAAACTACGC；

and carrying out PCR amplification on NbPDS gene fragments in the transient transformed Nicotiana benthamiana leaves, and purifying PCR products. The PCR product was subjected to Sanger sequencing with the primer NbPDS-F, and if the sequencing result showed a nested peak near the target site, it was considered that gene editing occurred at the NbPDS gene target site (as shown in FIG. 5). The NbPDS gene fragment subjected to gene editing is connected into a pEASYR-Blunt cloning vector, then transferred into escherichia coli DH5 alpha, and monoclonal colonies are picked up, and plasmids in positive clone bacterial liquid are extracted for sequencing analysis. By comparison with the wild NbPDS gene sequence, specific mutation modes of NbPDS target sites in leaves of the StU64-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vectors are analyzed and transformed. As shown in FIG. 5, transformation of StU64-1/NbPDS-Cas9 and StU6 8-1/NbPDS-Cas9 gene editing vectors can lead to gene editing of NbPDS gene target sites, and the gene editing type is base deletion.

Example 4:

the construction of the potato StPDS double-target gene editing vector and the mutation of StPDS sequences comprise the following specific steps:

1. cloning of StPDS Gene sequences

Extracting the genome DNA of the leaf of the potato variety 'green potato No. 9' by a CTAB method. The following primers were designed based on the potato StPDS gene reference sequence:

StPDS-F：ATGCCTCAAATTGGACTTGT；

StPDS-R：TATGAAACAGACCCTACCCC；

using the primers, PCR amplification was performed in a 25. Mu.L system using the high fidelity enzyme PhantaR Max and potato leaf DNA as a template. The PCR reaction procedure was 95℃for 3min;95℃30s,54℃30s,72℃1:30min,30 cycles, then 5min at 72 ℃; the PCR products are detected by agarose gel electrophoresis and cut and purified. The PCR products were Sanger sequenced using the primers StPDS-seqF and StPDS-seqR, the primer sequences were as follows:

StPDS-seqF：GGCTTGCAAAATACTGTACT；

StPDS-seqR：GCTTCCTTCGAAATAAAGCA；

finally, stPDS gene sequence information is obtained.

2. StPDS gene editing target site design and target joint preparation

According to the StPDS gene sequence obtained in step 1, two gene editing target sites were selected, which are respectively the sequences T1 located in the first exon: CCATGCCACGACCAGAAGAT, sequence T2 at the third exon: AACCGATACTACTGGAGGCA. Designing target joint primers according to T1 and T2 sequences:

the following primer pairs were designed for the T1 target linked to the StU64-1 promoter:

StPDS-4-F：TTTGCCATGCCACGACCAGAAGAT；

StPDS-4-R：AAACATCTTCTGGTCGTGGCATGG；

the following primer pairs were designed for the T2 target linked to the StU68-1 promoter:

StPDS-8-F：TCTGAACCGATACTACTGGAGGCA；

StPDS-8-R：AAACTGCCTCCAGTAGTATCGGTT；

3. 1. Mu.g of StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmid were each digested with 10U Bsa I for 20min at 25. Mu.L, and the digested products were frozen at-20 ℃.

4. Construction of potato StPDS double-target gene editing vector

And (3) respectively connecting the target joint obtained in the step (2) with the StU6 4-1-sgRNA and the StU6 8-1-sgRNA plasmid digestion products obtained in the step (3) by using T4 DNA ligase to respectively obtain fragments of a StU64-1 promoter-target T1-sgRNA and a StU68-1 promoter-target T2-sgRNA. Fragments of StU64-1 promoter-target T1-sgRNA and StU68-1 promoter-target T2-sgRNA were sequentially ligated into a 35S-Cas9-Kana vector using the 'edge trimming ligation' method (Ma et al 2015), and finally a StPDS-Cas9 dual-target gene editing vector was obtained, in which T1 target site-sgRNA was driven by StU64-1 promoter and T2-target site-sgRNA was driven by StU68-1 promoter (as shown in FIG. 6).

5. Stable transformation of potato stem callus

The StPDS-Cas9 double-target gene editing vector is transferred into agrobacterium LBA4404 by a freeze thawing method. Shaking the LBA4404 bacterial liquid containing StPDS-Cas9 carrier, suspending the bacterial liquid with MS liquid culture medium to reach bacterial liquid concentration OD ₆₀₀ =0.5. And (3) taking the stem segment of the potato variety D187 tissue culture seedling as an explant, and carrying out agrobacterium infection. The stem explants were co-cultivated for 2d on resistant callus induction medium containing Kana for about 30d and then on cluster bud induction medium containing Kana for about 30d. Embryogenic resistant calli at the differentiation stage are finally obtained.

6. Sequencing analysis of StPDS Gene target site sequences

Extracting embryogenic resistant callus DNA of potato stem by using a CTAB method, carrying out PCR amplification by using StPDS-F and StPDS-R primers, and purifying a PCR product. Sanger sequencing was performed on StPDS target sites T1 and T2 with primers StPDS-seqF and StPDS-seqR, respectively, and if the sequencing result showed a nested peak near the target site, it was considered that gene editing occurred on the StPDS gene target site (as shown in FIG. 7). The StPDS gene fragment with the gene editing is connected into pEASYR-Blunt cloning vector, then transferred into escherichia coli DH5 alpha, and monoclonal colony is picked up, and plasmid in positive clone bacterial liquid is extracted for Sanger sequencing analysis. By comparison with a wild type StPDS gene sequence, a specific mutation mode of a StPDS target site in the resistant callus of the transformed StPDS-Cas9 gene editing vector is analyzed. As shown in FIG. 7, transformation of the StPDS-Cas9 gene editing vector can result in gene editing of two target sites of the StPDS genes T1 and T2 in potato-resistant calli, and the type of gene editing is base deletion or base insertion.

Therefore, the potato StU64-1 promoter and the StU68-1 promoter obtained by the invention have transcriptional activity, can drive downstream sgRNA to express, realize the directional editing of Nicotiana benthamiana and potato genes driven by the potato endogenous U6 promoter, and can carry out single-site or multi-site gene editing on the target genes; sequencing the target site clone sequence after gene editing finds that mutation types comprise base insertion and base deletion. Therefore, the two potato endogenous U6 promoters can be applied to not only potatoes but also tobacco CRISPR/Cas9 gene editing systems, so that efficient and accurate trait genetic improvement of solanaceous crops such as tobacco, potatoes and the like is realized.

The foregoing description of the preferred embodiments of the invention is merely exemplary and is not intended to limit the scope of the invention. It should be noted that modifications can be made by those skilled in the art without departing from the principles of the present invention, which modifications should also be considered as being within the scope of the present invention.

SEQUENCE LISTING

<110> university of agriculture in Yunnan

<120> Potato U6 RNA polymerase III type promoter, cloning and application thereof

<130> 2021-09-24

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 466

<212> DNA

<213> Solanum tuberosum

<400> 1

agttgcaggt agcatggcca atttgaaaaa acgagaaatg aacagtagat ataactcatc 60

aatagcagta ctctactcct attataaatt gcttttatta tgactgacta aattactcat 120

tttcgtgcta ccatataggc atatcaatta atttctgctc atccttaata aaaataagtg 180

acggccagta ggtaacttct taaaacctcc ttatgataat gattatttta gttgtgggca 240

taaggatatt agtttcgaaa taaaatgtaa aattattatt ttcggtttga ttatgaaaat 300

caatgcatag gatatgccta acttttcaaa ttgcaaaaat caaaccaaat aagaaggccc 360

ggcccattat gtttataagt ccaggcccat acgttatttc tccctcatcg tctgcagaga 420

gaagctttgc tgtgtttata taactcaaca acaacatatg tgtttg 466

<210> 2

<211> 511

<212> DNA

<213> Solanum tuberosum

<400> 2

cgaaagagaa aaaatacact atggacgaat atttttatag aattcaatat gtaaaactaa 60

taaacaagaa cttttattca aagtaatgaa gaagaagaat tgaagaaata tttacataat 120

caataaaaaa aaatcattca aaagaatcgt gtgtatgaga aagaagagaa aaaaactact 180

tcccaataaa aaaggacatc atgctgccac ctcctaaaat tatgtaattt aatttttaaa 240

aaaacttccc aatacgtggg ctactatttg caaaatttaa tttttaaaaa cctttttttg 300

tcaagaaaat aaaagatggc tatttgttgc caattagtaa aatgagatgt catgctgtgc 360

cattttttca aaatataaat accagcccat tacagttaat gggctttgct caggcccata 420

ccagcgaaaa cacccaagct agttctccct catcgtctgc agaaagcttc tttgttgtgt 480

ttataaagca aaacattaac ctatatgtct g 511

Claims

1. Potato U6 promoter sequence, characterized in that: the potato U6 promoter is StU64-1, and the DNA nucleotide sequence of the StU64-1 promoter is shown as SEQ ID No. 1.

2. The sgRNA expression cassette vector for constructing the potato gene editing vector is characterized in that: stU64-1 comprising the potato U6 promoter of claim 1.

3. The sgRNA expression cassette vector of claim 2, wherein: the sgRNA expression cassette vector is recombinant plasmid StU6 4-1-sgRNA, and the construction method comprises the following steps:

(1) PCR amplification was performed on the StU64-1 gene promoter using the StU64-1 gene promoter sequence shown in SEQ ID No. 1 as a template and the following homology arm-containing primers:

StU6 4-1gF：GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG；

StU6 4-1gR：TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA；

purifying the PCR product to obtain StU64-1 gene promoter fragments containing homology arms;

sgRNA-F：AGAGACCTCTGAAGATAACA；

sgRNA-R：TCCTTTGCTGCCGATTCCAC；

(3) And (3) recombining the StU64-1 gene promoter fragment containing the homology arm in the step (1) into the linearized pYLsgRNA plasmid in the step (2) by using ExnaseRII recombinase to obtain the sgRNA expression cassette vector StU6 4-1-sgRNA for the potato gene editing vector.

4. Use of the potato U6 promoter StU64-1 of claim 1 in solanaceae plant transgenic technology or in constructing a solanaceae plant gene editing vector.

5. Use of the sgRNA expression cassette vector of claim 2 or 3 in the transgenic technology of solanaceae plants or in the construction of a gene editing vector of solanaceae plants.

6. Use according to claim 4 or 5, characterized in that: the Solanaceae plant comprises tobacco and potato.