CN116410986A - Gene involved in regulating and controlling plant height, fruit shape and yield of tomatoes and application thereof - Google Patents

Abstract

The invention relates to the field of biotechnology, in particular to application of tomato SlBZR1 and SlBES1 genes in regulating plant height, fruit shape and yield. The invention discloses genes involved in regulating and controlling tomato plant height, fruit shape and yield, namely a SlBZR1 gene and a SlBES1 gene respectively. Double gene knockout of SlBZR1 and SlBES1 can dwarf tomato plants, reduce fruits, lengthen shapes, and reduce fruit yield.

Description

Gene involved in regulating and controlling plant height, fruit shape and yield of tomatoes and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to application of tomato SlBZR1 and SlBES1 genes in regulating plant height, fruit shape and yield.

Background

Tomato (Solanum lycopersicum) is native to the andes mountain in south america and is now one of the most widely cultivated vegetable crops worldwide, and the tomato planting area and yield in our country are in the forefront of the world. According to the data of the grain and agriculture organization of the united nations, the global tomato yield of 2020 reaches 1.86 hundred million tons, the total yield value is about 1 hundred billion dollars, and fruits and vegetables are arranged at the first place, wherein the total tomato yield in China accounts for about 34.72% of the total world yield, and is the largest tomato production country in the world.

Tomato plant type, fruit shape and fruit number are all important factors affecting tomato yield. The plant height is one of important agronomic characters of tomatoes, and plays an important role in close planting, space illumination utilization and yield. Fruit shape is an important component of the sensory quality of tomato fruit, mainly comprising fruit shape and volume size, wherein fruit shape is mainly quantitatively described by a fruit type index, e.g. an increase in fruit type index indicates longitudinal elongation of the fruit and a decrease in fruit type index indicates lateral growth of the fruit. The fruit size is an important factor affecting the sensory quality and the fruit yield of tomatoes, and the factors determining the fruit size in tomatoes mainly comprise the number of layers of pericarp cells, the size of pericarp cells, the number of ventricles and the like, so that the genetic regulation of the fruit size still needs extensive and intensive research. The fruit setting rate of tomatoes refers to the percentage of the number of fruits to the total flowering number, and is an important factor affecting the yield of tomato fruits.

The growth and development of tomatoes are a complex process and are regulated and controlled by various factors. Research shows that brassinosteroids can be used for independently or synergistically regulating the growth and development of tomatoes with various plant hormones such as auxin, cytokinin, gibberellin, abscisic acid, ethylene and the like. SlBZR1 (Solyc 12g 089040) and SlBES1 (Solyc 04g 079980) are core transcription factors of the tomato brassinosteroid signal transduction pathway and can be involved in regulating growth of tomato lateral buds, leaf morphogenesis, heat and cold resistance of plants and softening of fruits (Xia et al, 2021; su et al, 2022; yin et al, 2018; fang et al, 2019; liu et al, 2021).

Disclosure of Invention

The invention aims to provide a gene, a protein and corresponding application which are involved in regulating and controlling the plant height, the fruit shape and the yield of tomatoes.

In order to solve the technical problems, the invention provides genes involved in regulating and controlling tomato plant height, fruit shape and yield, which are a SlBZR1 gene and a SlBES1 gene respectively, wherein the nucleotide sequence of the SlBZR1 gene is shown as SEQ ID No:1 is shown in the specification; the nucleotide sequence of the SlBES1 gene is shown as SEQ ID No: 3.

The invention also provides a protein encoded by a gene involved in regulating tomato plant height, fruit shape and yield: the amino acid sequence of the protein coded by the SlBZR1 gene is shown as SEQ ID No:2 is shown in the figure; the amino acid sequence of the protein coded by the SlBES1 gene is shown as SEQ ID No: 4.

The invention also provides application of the genes and the proteins in regulating and controlling the plant height and the fruit shape of the tomatoes and improving the yield of the tomatoes.

As an improvement of the application of the invention: double gene knockout of SlBZR1 and SlBES1 can dwarf tomato plants, reduce fruits, lengthen shapes, and reduce fruit yield.

As a further improvement of the application of the invention: double gene knockout of SlBZR1 and SlBES1 results in reduced tomato plant height, reduced tomato fruit size, increased tomato aspect ratio, reduced tomato yield (including reduced tomato single plant fruit number, reduced tomato single fruit weight).

The invention also provides a double gene knockout strain of the SlBZR1 and the SlBES1 genes at the same time: bzr1bes1-1 and bzr1bes1-2;

nucleotide sequences generated by the gene editing of the SlBZR1 and the SlBES1 in the bzr1 bes-1 plant are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6; nucleotide sequences generated by the editing of the SlBZR1 and SlBES1 genes in bzr1 bes-2 plants are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 7.

The invention also provides a plasmid containing the gene.

The invention also provides a host cell containing the gene, and the host cell is an escherichia coli cell.

In the invention, the following components are added: the SlBZR1 and the SlBES1 positively regulate the plant height, the fruit size and the yield of the tomatoes. Double gene knockout of SlBZR1 and SlBES1 not only can reduce the plant height of tomatoes, but also can reduce the size and yield of tomato fruits.

The invention also provides a double-gene knockout method in tomatoes, which comprises the following steps:

1) Designing a sgRNA sequence of a double-gene editing Target of SlBZR1 and SlBES1 by using CRISPR/Cas9 technology, wherein Target 1:5'-ATGGAGATTGGAGGCACTT-3', target 2:5'-CCTCTTTCATCACCAACTA-3';

2) And (2) synthesizing a primer by using the sequence obtained in the step (1), annealing the primer, connecting the primer to an intermediate vector pYLgRNA-U6, and assembling the sgRNA expression cassette into the pYLCRISPR/Cas9 vector by a GoldenGate method.

3) Genetically transforming the vector obtained in the step 2) into a wild tomato variety, thereby obtaining a corresponding transgenic plant; plants were identified from the transgenic tomato plants that were successful in knocking out the SlBZR1 and SlBES1 genes.

The invention constructs tomato SlBZR1 and SlBES1 double-gene editing plants for the first time, and performs function research.

According to the invention, the researches show that the tomato SlBZR1 and SlBES1 genes can regulate and control the plant height of tomatoes and the fruit shape and yield of tomato fruits. The invention constructs the double-gene editing plant of the tomato SlBZR1 and the SlBES1 by cloning the genes of the tomato SlBZR1 and the SlBES 1. The heights of tomato plants are measured, the heights of the tomato plants can be reduced by the double gene knockout of the SlBZR1 and the SlBES1, and the sizes and the yields of the tomato fruits can be reduced by the double gene knockout of the SlBZR1 and the SlBES1 by counting the shapes and the yields of the tomato fruits, so that the positive regulation of the heights of the tomato plants, the sizes and the yields of the fruits by the SlBZR1 and the SlBES1 is shown. The SlBZR1 and SlBES1 genes have good application prospects in improving the plant height and the fruit shape of tomatoes and improving the yield of tomato fruits.

It should be noted that: although the prior art has informed that SlBZR1 and SlBES1 can be involved in regulating growth of tomato side shoots, leaf morphogenesis, heat and cold resistance of plants and softening of fruits, the above known properties are not relevant to the application of the invention in regulating tomato plant height and fruit shape and improving tomato fruit yield. Therefore, the mechanism of regulating and controlling the plant type and the yield of the tomatoes by analyzing the brassinosteroids and the signal transduction pathway thereof can enrich the plant hormone regulating and controlling network of the plant type and the yield of the tomatoes, can provide important gene resources for molecular design and breeding, and provides important theoretical basis and application value for genetic improvement of the tomatoes by manipulating the brassinosteroids signal pathway.

Drawings

The following describes the embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 is a phylogenetic tree analysis of BZR1/BES1 homologous genes in tomato (Solanum lycopersicum) and Arabidopsis (Arabidopsis thaliana).

FIG. 2 is an amino acid sequence alignment of tomato and Arabidopsis BZR1/BES1 homologous genes.

FIG. 3 is the CRISPR/Cas9 target position and sequencing results of tomato SlBZR1 and SlBES1 double gene editing lines.

FIG. 4 is the plant height of the SlBZR1 and SlBES1 double gene editing lines and wild type tomato.

FIG. 5 is the fruit shape and yield of the SlBZR1 and SlBES1 double gene editing lines and wild type tomato. abcd represents a significant difference (p < 0.05) between the strain and the control.

Detailed Description

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

1. construction of CRISPR/Cas9 vector for double gene knockout of tomato SlBZR1 and SlBES1

The analysis of the phylogenetic tree of the BZR1/BES1 homologous genes in tomato (Solanum lycopersicum) and Arabidopsis thaliana (Arabidopsis thaliana) showed that SlBZR1 and SlBES1 are homologous genes of Arabidopsis thaliana AtBZR1 and AtBES1 (FIG. 1).

Amino acid sequence comparison analysis is carried out on tomato and Arabidopsis thaliana BZR1/BES1 homologous genes, and the result shows that the amino acid sequence similarity of the SlBZR1 and the SlBES1 to the Arabidopsis thaliana AtBZR1 and the AtBES1 is highest, and the amino acid sequence similarity of the SlBZR1 and the SlBES1 is as high as 79.1 percent (figure 2).

The CRISPR/Cas9 edited Target sgRNA sequences were designed in the coding sequences of the SlBZR1 and SlBES1 genes (SEQ ID NO:1 and SEQ ID NO: 3) using the online specialty software CRISPR-P and CRISPR-GE, with Target 1:5'-ATGGAGATTGGAGGCACTT-3', target 2:5'-CCTCTTTCATCACCAACTA-3'; and synthesizing primers for constructing the sgRNA expression cassette in biotechnology company, wherein:

U-F：5'-CTCCGTTTTACCTGTGGAATCG-3’；

gR-R：5'-CGGAGGAAAATTCCATCCAC-3’；

gRTB-F1：5'-AAGTGCCTCCAATCTCCATgttttagagctagaaat-3’；

U6aTB-R1：5'-ATGGAGATTGGAGGCACTTggcagccaagccagca-3’；

gRTB-F2：5'-TAGTTGGTGATGAAAGAGGgttttagagctagaaat-3’；

U6bTB-R2：5'-CCTCTTTCATCACCAACTAaacacaagcggcagc-3’；

Pps-R：5'-TTCAGAGGTCTCTACCGACTAGTCACGCGTATGGAATCGGCAGCAAA-3’；

Pgs-L：5'-AGCGTGGGTCTCGCTCGACGCGTATCCATCCACTCCAAGC-3’；

Pgs-2：5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3’；

Pps-2：5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3’。

the method comprises the steps of respectively taking pYLgRNA-OsU a and pYLgRNA-OsU b plasmids (Zeng Dongchang and the like, and an operation method of plant CRISPR/Cas9 polygene editing vector construction and mutation analysis, 2018) as templates, and respectively introducing two targets between a promoter and two sgRNA frameworks by using an overlay PCR method to construct the sgRNA expression cassette. Taking pYLgRNA-OsU a as an example, the specific steps are:

the first round of PCR employed a 15. Mu.l system: 2X Phanta Max Buffer 7.5.5. Mu.L, 10mmol/L dNTPs Mix 0.25. Mu.L, phanta Max Polymerase 0.2.2U, pYLgRNA- -OsU a plasmid 2-5 ng, U-F and gRTB-F1 each 0.3. Mu.L, U6aTB-R1 and gR-R each 0.3. Mu.L, ddH ₂ O was made up to 15. Mu.L. The PCR reaction procedure was: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 10s, annealing at 58℃for 15s, extension at 72℃for 15s, 25-26 PCR cycles; finally, the extension was carried out at 72℃for 5 minutes.

The second round of PCR constructs the promoter, target and sgRNA into a complete expression cassette. PCR amplification reaction system: 2X Phanta Max Buffer. Mu.L, 10mmol/L dNTP Mix 0.5. Mu.L, phanta Max 0.4U, 10. Mu. Mol/L Mixed Universal primer 0.5. Mu.L (two pairs of primers Pps-R/Pgs-2 and Pps-2/Pgs-L), product ddH of the first round PCR reaction ₂ O diluted 10-fold with 1. Mu.L, phanta Max Polymerase 0.5.5. Mu.L and ddH ₂ O was made up to 30. Mu.L. The PCR reaction procedure was: pre-denaturation at 95 ℃ for 30s; denaturation at 95℃for 10s, annealing at 58℃for 15s, extension at 72℃for 20s, 25-28 PCR cycles; finally, the extension was carried out at 72℃for 5 minutes. Fragments of about 830bp were excised and recovered after electrophoresis by two rounds of PCR. The target sgRNA expression cassettes of the two targeting sites can be obtained respectively by the same method.

And then cloning the two sgRNA expression cassettes into a pYLCRISPR/Cas9 vector in a side-cut connection mode by adopting a Golden Gate cloning method, namely the CRISPR/Cas9 double-gene editing vector of the SlBZR1 and the SlBES 1. Preparing 15 mu L of reaction system, namely 10 xCutSmart Buffer 1.5 mu L,10mmol/LATP 1.5 mu L (1.5 mu L of 10 xT 4DNA ligase Buffer can be added to replace ATP), 60-80 ng of pYLCRISPR/Cas9 plasmid, and 20-35 ng of purified mixed sgRNA expression cassettes are used as the expression cassettes, and Bsa I-HF 10U,T4 DNA ligase 35U,ddH ₂ O was made up to 15. Mu.L. The PCR instrument is used for carrying out edge trimming and connecting reaction for 10 to 15 cycles (5 min at 37 ℃, 5min at 10 ℃, 5min at 20 ℃) and 5min at 37 ℃.

The obtained product was transformed into E.coli and subjected to colony PCR verification. The first target was detected using primers SP-R (5'-CCCGACATAGATGCAATAACTTC-3') and U6aTB-R1, and the second target was detected using primers gRTB-F1 and SP-L1 (5'-GCGGTGTCATCTATGTTACTAG-3'). And picking a monoclonal amplification and plasmid extraction of colony PCR results consistent with the reference sequence, namely the CRISPR/Cas9 double-gene editing vector of the SlBZR1 and the SlBES 1. 2. Construction and detection of gene editing materials:

the CRISPR/Cas9 double-gene editing vector of the SlBZR1 and the SlBES1 is used for transforming the agrobacterium LBA4404 strain, tomato AC (Ailsa Craig) cotyledons are used as explants and co-cultured with bacterial liquid to obtain callus, the callus is subjected to differentiation culture medium and rooting culture medium to obtain transgenic positive seedlings, and the positive transgenic plants are verified by PCR.

Synthesizing the PCR amplification primers of the SlBZR1 and SlBES1 genes, and BZR1-F: ATGATGTGGGAAGCTGGAGAATC, BZR1-R: TCATATGCGAGCATTGCCACTTC; BES1-F: ATGTGGGAAGGTGGAGGGTTG, BES1-R: TCACATCCGAGCAGTCCCAC.

The genome DNA of the tomato plant and the control variety AC thereof is used as a template, 2X Taq PCR Master Mix (TIANGEN company) is used for carrying out PCR amplification on the SlBZR1 and the SlBES1 genes respectively, the PCR amplification system is 20 ul, the PCR amplification system comprises 2X Taq PCR Master Mix ul, the upstream primer and the downstream primer (wherein BZR1-F and BZR1-R are a pair of upstream and downstream primers used for amplifying the SlBZR1 genes, BES1-F and BES1-R are another pair of upstream and downstream primers used for amplifying the SlBES1 genes, the primer concentration is 10 mu M) and 1 ul (< 1 mu g) of template DNA and 7 ul of sterile water; the PCR amplification procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30sec, annealing at 55℃for 30sec, elongation at 72℃for 30sec,35 cycles; extending at 72℃for 10min.

After sequencing analysis of PCR products, two strains of the slBZR1 and the slBES1 genes were identified, namely, the strain bzr1bes1-1 and the strain bzr1 bes-2, were successfully knocked out, the coding region of the slBZR1 gene in the two strains respectively lacks 4 bases and 287 bases, the coding region of the slBES1 gene in the strain bzr1 bes-1 respectively lacks 1 base and 3 bases, and the coding region of the slBES1 gene in the strain bzr1bes1-2 respectively lacks 8 bases and 2 bases (FIG. 3), so that the functions of the slBZR1 and the slBES1 genes are deleted. Nucleotide sequences generated by the gene editing of the SlBZR1 and the SlBES1 in the bzr1 bes-1 plant are respectively shown in SEQ ID NO. 5 and SEQ ID NO. 6, and nucleotide sequences generated by the gene editing of the SlBZR1 and the SlBES1 in the bzr1 bes-2 plant are respectively shown in SEQ ID NO. 5 and SEQ ID NO. 7.

3. Study of Gene editing Strain height

The plant heights of tomatoes are measured and counted after the double gene knockout strains bzr1 bes-1 and bzr1 bes-2 of the SlBZR1 and SlBES1 and wild tomato plants grow to four weeks. The average plant heights of the bzr1bes1-1 and bzr1bes1-2 lines were 3.45cm and 3.53cm, respectively, whereas the average plant height of the wild type tomato was 7.44cm. The results indicate that double gene knockout of SlBZR1 and SlBES1 can reduce tomato plant height (fig. 4).

4. Study of fruit shape and yield of Gene-edited lines

The double gene knockout strains bzr1 bes-1 and bzr1 bes-2 of the SlBZR1 and SlBES1 and the wild tomato plants grow until the fourth spike fruits are fully enlarged, and then the fruit indexes (namely the ratio of the length to the width of the fruits), the number of single fruits, the average single fruit weight and the single fruit yield of the tomatoes are measured and counted.

Through phenotypic observation, the tomato fruits of the bzr1 bes-1 and bzr1 bes-2 strains are obviously smaller than wild tomatoes, which shows that the double gene knockout of the SlBZR1 and the SlBES1 can reduce the tomato fruit size. The average fruit type indexes of the tomato fruits of the bzr1bes1-1 and bzr1bes1-2 strains are 0.97 and 0.99 respectively, and the average fruit type index of the wild tomato is 0.83, which shows that the double gene knockout of the SlBZR1 and the SlBES1 can improve the aspect ratio of the tomato. The average single plant fruit numbers of bzr1bes1-1 and bzr1bes1-2 strains are 6.4 and 5.9 respectively, and the average single plant fruit number of wild tomatoes is 38.9, which shows that the double gene knockout of the SlBZR1 and the SlBES1 can reduce the single plant fruit number of tomatoes. The average single fruit weights of bzr1bes1-1 and bzr1bes1-2 strains are 32.0g and 30.7g respectively, and the average single fruit number of wild tomatoes is 52.9g, which shows that the double gene knockout of the SlBZR1 and the SlBES1 can reduce the single fruit weight of tomatoes. The average individual fruit yields of the bzr1bes1-1 and bzr1bes1-2 lines were 0.207kg and 0.195kg, respectively, while the average individual fruit yield of wild type tomatoes was 2.048kg, indicating that double gene knockout of SlBZR1 and SlBES1 can reduce tomato individual fruit yields (fig. 5).

From fig. 4 and 5, the following summary conclusion can be obtained: double gene knockout of SlBZR1 and SlBES1 can reduce tomato plant height, fruit size, single plant fruit number, single fruit weight and single plant fruit yield.

To sum up: the SlBZR1 and the SlBES1 positively regulate the plant height, the fruit size and the yield of the tomatoes.

Finally, it should also be noted that the above list is merely a few specific embodiments of the present invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications directly derived or suggested to one skilled in the art from the present disclosure should be considered as being within the scope of the present invention.

Claims (6)

1. The gene involved in regulating and controlling tomato plant height, fruit shape and yield is characterized in that: the gene is a SlBZR1 gene and a SlBES1 gene respectively, and the nucleotide sequence of the SlBZR1 gene is shown as SEQ ID No:1 is shown in the specification; the nucleotide sequence of the SlBES1 gene is shown as SEQ ID No: 3.

2. The protein encoded by the gene involved in regulating tomato plant height, fruit shape and yield of claim 1, wherein: the amino acid sequence of the protein coded by the SlBZR1 gene is shown as SEQ ID No:2 is shown in the figure; the amino acid sequence of the protein coded by the SlBES1 gene is shown as SEQ ID No: 4.

3. Use of a gene according to claim 1, a protein according to claim 2 for regulating tomato plant height and fruit shape and increasing tomato fruit yield.

4. A use according to claim 3, characterized in that: double gene knockout of SlBZR1 and SlBES1 can dwarf tomato plants, reduce fruits, lengthen shapes, and reduce fruit yield.

5. The use according to claim 4, characterized in that: double gene knockout of SlBZR1 and SlBES1 results in reduced tomato plant height, reduced tomato fruit size, increased tomato aspect ratio, reduced tomato yield.

A slbzr1 and SlBES1 gene double knockout strain characterized in that: bzr1bes1-1 and bzr1bes1-2;

nucleotide sequences generated by the gene editing of the SlBZR1 and the SlBES1 in the bzr1 bes-1 plant are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6; nucleotide sequences generated by the editing of the SlBZR1 and SlBES1 genes in bzr1 bes-2 plants are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 7.

Images