CN111154771B

CN111154771B - Application of tomato SlBZR1L gene

Info

Publication number: CN111154771B
Application number: CN202010077456.3A
Authority: CN
Inventors: 汪俏梅; 刘浩然; 刘丽红; 邵志勇; 孟凡亮; 梁冬怡
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2020-01-29
Filing date: 2020-01-29
Publication date: 2021-05-25
Anticipated expiration: 2040-01-29
Also published as: CN111154771A

Abstract

The invention belongs to the technical field of biology, and particularly relates to an application of a tomato SlBZR1L gene in regulating fruit hardness, wherein a nucleotide sequence of the SlBZR1L gene is shown as SEQ ID NO: 1, the SlBZR1L gene plays a negative regulation role in improving the hardness of fruits.

Description

Application of tomato SlBZR1L gene

Technical Field

The invention belongs to the field of biotechnology; in particular to application of a tomato SlBZR1L gene in regulating fruit hardness.

Background

The tomatoes are originally produced in south America and are one of the most extensive vegetable crops cultivated all over the world, and the planting area and the yield of the tomatoes in China are in the front of the world. With the increase of the tomato yield, the loss of the postharvest shelf life of the tomatoes becomes an important problem restricting the development of the tomato industry. Increasing attention from tomato sellers and researchers has been paid to improving the quality of tomato fruits and thus prolonging the storage time of tomatoes. The hardness of the tomato fruits is a primary factor influencing the shelf life of the tomato fruits, and the shelf life of the tomato fruits can be obviously prolonged by improving the hardness of the fruits; the shelf life of the fruits is prolonged, the losses after picking are reduced, and the economic benefit loss caused by the losses of the tomato sellers is effectively avoided.

SlBZR1L (Solyc04g079980) is one of the tomato homologous genes of the core transcription factor BES1 of the Brassinosterol (BR) signal transduction pathway. The current research is concerned only with the function of BES1 in arabidopsis to resist stress.

Disclosure of Invention

The invention aims to solve the technical problem of providing an application of a SlBZR1L gene in improving fruit hardness.

In order to solve the technical problems, the invention provides the application of the SlBZR1L gene: regulating fruit hardness, and the nucleotide sequence of SlBZR1L gene is shown in SEQ ID NO: 1, the preparation method is as follows.

As an improvement of the application of the SlBZR1L gene of the invention: the fruit is a tomato.

The SlBZR1L gene is used for constructing a transgenic tomato, and the hardness of the transgenic tomato is obviously regulated and controlled.

The amino acid sequence of the protein coded by the SlBZR1L gene is shown as SEQ ID NO: 2, respectively.

Previous studies focused only on the function of BES1 in arabidopsis to resist stress. However, the function of the homologous gene SlBZR1L in negative regulation of tomato fruit hardness in tomato fruits is not reported.

The invention constructs tomato SlBZR1L gene overexpression and gene silencing plants for the first time and performs function research. By measuring the hardness of the fruit, the SlBZR1L gene is found to play a negative regulation role in improving the hardness of the fruit.

Drawings

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention are described in detail below with reference to the accompanying drawings.

FIG. 1 is a vector map of an SLBZR1L gene overexpression vector pGWB17-SLBZR 1L.

Fig. 2 is the SlBZR1L gene silencing vector pBIN 19: : SlBZR1L vector map.

FIG. 3 shows the expression level of SlBZR1L gene in fruit with over-expression of SlBZR1L gene and gene silencing;

leaves (Leaves, L), green stage (green, MG), Breaker stage (Breaker, B), Pink stage (Pink, P), Red stage (R). Asterisks represent significant differences between the lines and the control (p < 0.05).

FIG. 4 shows fruit firmness of fruit with overexpression of SlBZR1L gene and fruit with gene silencing;

green stage (quality green, MG), break stage (Breaker, B), Pink stage (Pink, P), Red stage (Red rice, R). Different letters represent significant differences between groups (p < 0.05).

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

firstly, obtaining the full-length sequence of a tomato SlBZR1L gene:

a Primer Premier 6.0 is used for designing a whole-gene amplification Primer, wild tomato Ailsa Craig (AC) leaf cDNA planted in a greenhouse of hong Kong school of Zhejiang university is taken as a template (the extraction mode of the cDNA is the conventional technology, for example, refer to CN104561025A), specific primers SlBZR1L-F and SlBZR1L-R are designed, and a SlBZR1L fragment is amplified by PrimerSTAR Hi-Fi enzyme PCR.

The primer sequence is as follows: SlBZR 1L-F: 5'-ATGTGGGAAGGTGGAGGGTTGC-3'

SlBZR1L-R：5’-CATCCGAGCAGTCCCACTTCCGA-3’

PCR amplification reaction System: 2xPrimerSTAR buffer 25ul, dNTP mix 5ul, PrimerSTAR DNA polymerase 1ul, ddH₂O16 ul, cDNA1ul, and upstream and downstream primers each 1ul, for a total of 50 ul. The PCR reaction program is: pre-denaturation at 94 ℃ for 90 seconds; denaturation at 94 ℃ for 30 seconds, annealing at 57 ℃ for 45 seconds, extension at 72 ℃ for 1 minute, 35 cycles; and finally, final extension is carried out for 5 minutes at 72 ℃, the obtained PCR product is identified by 1% agarose gel electrophoresis, then an amplification band is recovered and purified by an Axygen DNA gel kit, the recovered product is constructed on an pQB-V3 vector, and the recombinant plasmid is sent to the engine company for sequencing confirmation.

The nucleotide sequence of the obtained gene SlBZR1L is shown as SEQ ID No: 1 is shown in the specification; the amino acid sequence of the protein coded by the gene is shown as SEQ ID No: 2, respectively.

Secondly, construction of an overexpression vector of the SlBZR1L gene

Construction of an overexpression vector of SlBZR1L, pGWB17 is used as a final vector, and a pGWB17-SlBZR1L vector with a CaMV35S recombinant overexpression promoter is constructed.

The desired fragment (i.e.the sequence described in SEQ ID No: 1) was transferred from the pQB-V3 initial vector to the pGWB 17-carrying final vector by means of an LR reaction. Use of

LR

II Enzyme mix (Thermo Fisher) kit, methods according to the instructions in the kit.

After the reaction, the pGWB17-SlBZR1L plasmid was transformed into E.coli Top10 competent. And screening by a coating method, screening pGWB17 recombinant plasmids with target fragments (the recombinant plasmids which meet the requirement that the bands with the size of about 1000bp are pGWB 17) by colony PCR, and sequencing and identifying. The sequencing results were analyzed using DNAMAN software. pGWB17 was named for the correct transformant SlBZR1L (FIG. 1).

Construction of SlBZR1L gene silencing vector

The RNAi interference vector uses pHANNIBAL as an original vector, and constructs a SlBZR1L hairpin silencing unit driven by a CaMV35S promoter through PCR and enzyme digestion recombination. Selecting a fragment of about 305bp in the full-length fragment of the SlBZR1L gene, determining other genes which are not coded by the sequence of the fragment, and taking the sequence as a fragment for RNA interference. Finally, the original vector pHANNIBAL and the intermediate vector pBIN19 are utilized to carry out the common enzyme cutting sites of SacI and speI and finally integrated on a plant binary vector pBIN19, and finally a gene silencing vector pBIN19 is obtained: : SlBZR1L (fig. 2).

The 305bp fragment used for gene silencing is:

AGTCCCTAAGCAGATATTTAATCTTGAGACTTTGGCTAGAGAGTCTATGTCTGCTCTAAATATCCCTTTCTTTGCTGCTTCAGCCCCAACTAGCCCAACTCGAGGTCAGCGATTCACTCCTGCTACAATACCAGAGTGTGACGAATCTGATTCATCCACCATTGATTCTGGCCAGTGGATGAGCTTTCAAAAGTACGCAGCCAATGGGATCCCTACTTCTCCGACTTTTAATCTTATTAAGCCTGTAGCTCAGAGAATTCCTTCTAATGATATGATCATCGACAAGGGTAAGAGCATTGAATTTG。

fourthly, constructing and detecting transgenic materials:

and (2) mixing an overexpression vector pGWB17 SlBZR1L or a gene silencing vector pBIN 19: : the SlBZR1L is transferred to agrobacterium LBA4404 in a combining way, the cotyledon infection of tomato is carried out, tissue culture seedlings are obtained by inducing callus, resistance inducing differentiation and rooting culture, and PCR and RT-PCR are utilized to verify positive transgenic plants. Seeds of T2 generation were sown on kanamycin (50mg/L) medium for germination, resulting in 5 over-expressed transgenic lines.

Remarks explanation: the separation ratio of long side roots to non-long side roots on kanamycin (50mg/L) culture medium of the seeds meets 3: 1 and the condition that the gene expression quantity is increased by more than two times belongs to overexpression, and the condition that the gene expression quantity is reduced by more than one time belongs to gene silencing. 2 over-expression strains OE-1 and OE-2 with higher gene transcription level and 2 gene silencing strains RNAi-1 and RNAi-2 with lower gene transcription level were selected as study objects (FIG. 3).

In FIGS. 3 and 4, AC represents a non-transgenic wild-type tomato, OE-1 and OE-2 represent two overexpression lines of SlBZR1L, and RNAi-1 and RNAi-2 represent two gene silencing lines of SlBZR 1L.

Fifth, study on fruit hardness of transgenic tomato

Wild type and transgenic materials are planted in the same greenhouse of a Huajiachi vegetable base of Zhejiang university, when four inflorescences of tomato plants grow out and are subjected to flowering phase marking, each inflorescence is thinned to have only four fruits, all green fruits are green ripe (MG) without continuously expanding after 35 days of flowering, the top of the fruiting in the green ripe phase 3d turns Red to a Breaker phase (B), the fruiting in the green ripe phase 3d is Pink (Pink, P), and the fruiting in the Pink phase 7d is Red ripe phase (Red rice, R).

Fruits of selected specific periods without obvious mechanical damage at the same position of wild type and transgenic material are picked, four points are uniformly measured on the equator part of the fruit by using an instrument TA-XT2i (Godalming, UK), about twenty-five biological repetitions are measured at each time, a plastic probe with the diameter of 7.5mm is used at each measuring point, the measuring depth is 10mm, and the measuring speed is 1mm/s (taking the pricked fruit peel as a standard). The maximum force which can be born by the fruit is taken as an index for measuring the hardness of the fruit, and the unit is Newton (N).

The results obtained were: the fruit hardness of two tomato over-expression strains OE-1 and OE-2 of SlBZR1L is obviously reduced, and the fruit hardness of two tomato gene silencing strains RNAi-1 and RNAi-2 of SlBZR1L is obviously improved (figure 4); thus it was demonstrated that: the fruit hardness can be obviously improved by reducing the expression level of the SlBZR1L gene, and the SlBZR1L gene can regulate and control the fruit hardness.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang university

Application of <120> tomato SlBZR1L gene

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 984

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgatgtggg aaggtggagg gttgccggtg gagggtggtg gtggtgttgg tgaaggtggt 60

ggtgttggtg gtggtggagg tggtggtagt gggaggagga agccatcatg gagggaaagg 120

gagaataata ggaggaggga aaggaggaga agggcaatag cagctaagat ttatagtgga 180

ttaagagcac aggggaatta taatcttcct aaacattgtg ataacaatga ggttttgaag 240

gctctttgtg ttgaagctgg atggattgtt gagcctgatg gaactactta tagaaaggga 300

tgcaggccaa ctccaatgga gattggaggc acttcagcca acattacgcc aagttcttca 360

cgaaatccaa gtcctccctc ttcatacttt gctagcccga ttccatctta ccaagttagt 420

ccaacatcct cgtctttccc aagtccatct cgtggtgatg ctaacatgtc gtcacatcca 480

tttgcatttc tccatagttc cattcccttg tcgctaccac cattacgaat atcaaacagt 540

gcccctgtaa caccacctct ttcatcacca actagagtcc ctaagcagat atttaatctt 600

gagactttgg ctagagagtc tatgtctgct ctaaatatcc ctttctttgc tgcttcagcc 660

ccaactagcc caactcgagg tcagcgattc actcctgcta caataccaga gtgtgacgaa 720

tctgattcat ccaccattga ttctggccag tggatgagct ttcaaaagta cgcagccaat 780

gggatcccta cttctccgac ttttaatctt attaagcctg tagctcagag aattccttct 840

aatgatatga tcatcgacaa gggtaagagc attgaatttg actttgagaa tgtatcagtt 900

aaggcagcat gggaaggtga aaagattcat gaggttggtt tagatgatct ggagctcact 960

ctcggaagtg ggactgctcg gatg 984

<210> 2

<211> 328

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Met Trp Glu Gly Gly Gly Leu Pro Val Glu Gly Gly Gly Gly Val

1 5 10 15

Gly Glu Gly Gly Gly Val Gly Gly Gly Gly Gly Gly Gly Ser Gly Arg

20 25 30

Arg Lys Pro Ser Trp Arg Glu Arg Glu Asn Asn Arg Arg Arg Glu Arg

35 40 45

Arg Arg Arg Ala Ile Ala Ala Lys Ile Tyr Ser Gly Leu Arg Ala Gln

50 55 60

Gly Asn Tyr Asn Leu Pro Lys His Cys Asp Asn Asn Glu Val Leu Lys

65 70 75 80

Ala Leu Cys Val Glu Ala Gly Trp Ile Val Glu Pro Asp Gly Thr Thr

85 90 95

Tyr Arg Lys Gly Cys Arg Pro Thr Pro Met Glu Ile Gly Gly Thr Ser

100 105 110

Ala Asn Ile Thr Pro Ser Ser Ser Arg Asn Pro Ser Pro Pro Ser Ser

115 120 125

Tyr Phe Ala Ser Pro Ile Pro Ser Tyr Gln Val Ser Pro Thr Ser Ser

130 135 140

Ser Phe Pro Ser Pro Ser Arg Gly Asp Ala Asn Met Ser Ser His Pro

145 150 155 160

Phe Ala Phe Leu His Ser Ser Ile Pro Leu Ser Leu Pro Pro Leu Arg

165 170 175

Ile Ser Asn Ser Ala Pro Val Thr Pro Pro Leu Ser Ser Pro Thr Arg

180 185 190

Val Pro Lys Gln Ile Phe Asn Leu Glu Thr Leu Ala Arg Glu Ser Met

195 200 205

Ser Ala Leu Asn Ile Pro Phe Phe Ala Ala Ser Ala Pro Thr Ser Pro

210 215 220

Thr Arg Gly Gln Arg Phe Thr Pro Ala Thr Ile Pro Glu Cys Asp Glu

225 230 235 240

Ser Asp Ser Ser Thr Ile Asp Ser Gly Gln Trp Met Ser Phe Gln Lys

245 250 255

Tyr Ala Ala Asn Gly Ile Pro Thr Ser Pro Thr Phe Asn Leu Ile Lys

260 265 270

Pro Val Ala Gln Arg Ile Pro Ser Asn Asp Met Ile Ile Asp Lys Gly

275 280 285

Lys Ser Ile Glu Phe Asp Phe Glu Asn Val Ser Val Lys Ala Ala Trp

290 295 300

Glu Gly Glu Lys Ile His Glu Val Gly Leu Asp Asp Leu Glu Leu Thr

305 310 315 320

Leu Gly Ser Gly Thr Ala Arg Met

325

Claims

The application of the SlBZR1L gene is characterized in that: regulating fruit hardness, and the nucleotide sequence of SlBZR1L gene is shown in SEQ ID NO: 1, the fruit is tomato.