CN107746846B

CN107746846B - IbABF4 gene for coding sweet potato bZIP transcription factor and application thereof

Info

Publication number: CN107746846B
Application number: CN201711018018.4A
Authority: CN
Inventors: 边小峰; 禹阳; 贾赵东; 马佩勇; 郭小丁; 谢一芝
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2017-10-26
Filing date: 2017-10-26
Publication date: 2020-03-27
Anticipated expiration: 2037-10-26
Also published as: CN107746846A

Abstract

The invention discloses a coding sequence of ABF4 gene for positively regulating and controlling plant flowering sweet potato and application thereof. Wherein the IbABF4 gene for coding the sweet potato bZIP transcription factor is a nucleotide sequence shown in SEQ ID NO. 1. The protein coded by the IbABF4 gene is an amino acid sequence shown in SEQ ID No. 2. The invention separates the complete cDNA of the bZIP transcription factor from the sweet potato, connects the cDNA to a plant expression vector, and transforms the plant by using an agrobacterium infection method to obtain a transgenic plant, wherein the transgenic plant blooms in advance. The gene can be applied to genetic improvement of plants.

Description

IbABF4 gene for coding sweet potato bZIP transcription factor and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to an IbABF4 gene for coding a sweet potato bZIP transcription factor, a protein coded by the gene, a recombinant vector containing the gene and stress-resistant application of the gene.

Background

The flowering occurrence determines the reproductive and genetic capability of higher plants, and has important significance on the development of plant individuals and progeny. The flowering phase of the plant is controlled by a plurality of ways, and the ways of starting the flowering of the plant in response to various endogenous and exogenous signals are summarized as follows by synthesizing continuously updated flowering molecular genetic results: the classical photoperiod pathway, vernalization pathway, autonomic pathway, gibberellin pathway, and newer age pathway were 5 in total. In the agricultural production process, the flowering, the yield and the adaptation area of crops have a close and inseparable relationship, such as rice, wheat, corn, potatoes and the like.

The transcription factor plays an important role in regulating and controlling the plant flowering pathway, and the bZIP family gene is an important transcription factor for regulating plant flowering. Wherein, ABF is a bZIP transcription factor which can be combined with ABRE, the amino acid sequence of the basic region of the gene is very conservative, and the gene also contains special MKIK and QAY/Q motifs. The genes are mainly involved in abiotic stress resistance pathways (drought, cold, salt, oxidative stress and the like) and ABA signal transduction of plants, but reports related to plant flowering are few.

Sweet potatoes are not only important food crops, but also important economic crops and energy crops. Sweet potatoes are widely planted in more than 100 countries in the world, China is the largest producing country in the world, and sweet potato production accounts for about 80% of the sweet potatoes in the world. Compared with other grain crops, the sweet potatoes are relatively drought-tolerant, but have large difference among varieties, a considerable proportion of the sweet potatoes in the world are planted in a drought environment, the arid and semiarid regions in the world already occupy more than one third of the land area, and the influence of drought on plants is the top of various natural adversity factors. The sweet potato whole genome is about 4G, contains abundant gene resources, and ABF transcription factors are separated and cloned from the sweet potato, so that the functional characteristics of the ABF transcription factors are researched, and the gene resources can be provided for crop genetic improvement.

Disclosure of Invention

The invention aims to provide an IbABF4 gene for coding a sweet potato bZIP transcription factor.

The second purpose of the invention is to provide a protein coded by the gene.

The third purpose of the invention is to provide an expression vector containing the gene.

The fourth object of the present invention is to provide a host cell containing the expression vector.

The last object of the present invention is to provide the use of this gene.

The technical scheme of the invention is summarized as follows:

an IbABF4 gene for coding a sweet potato bZIP transcription factor, which is a nucleotide sequence shown in SEQ ID NO. 1. The nucleotide sequence consists of 1263 bases.

The protein coded by the gene is an amino acid sequence shown in SEQ ID No. 2. The sequence consists of 420 amino acid residues.

An expression vector pCAMBIA1305-IbABF4 containing the above gene has the nucleotide sequence shown in SEQ ID No. 1.

An agrobacterium host cell EHA 105: pCAMBIA 1305-2X 35s-IbABF 4.

The expression vector or the agrobacterium host cell is applied to transforming plants to obtain transgenic plants, in particular to the application in preparing transgenic arabidopsis thaliana.

The invention has the advantages that:

the invention separates the complete cDNA of the bZIP transcription factor gene from the sweet potato, connects the cDNA to a plant expression vector, transforms the plant by using an agrobacterium infection method to obtain a transgenic plant, and the result shows that the IbABF4 gene can promote the flowering of the plant.

Drawings

FIG. 1 results of phylogenetic tree analysis of the amino acid sequence of IbABF 4;

FIG. 2 is a schematic representation of the pCAMBIA 1305-2X 35s-IbABF4 vector;

FIG. 3 root comparison of untransformed Arabidopsis lines with the IbABF4 transgenic plants.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. However, the specific experimental procedures referred to in the following examples were carried out in a conventional manner or under the conditions recommended by the manufacturer's instructions unless otherwise specified.

Example 1

The bZIP transcription factor IbABF4 gene sequence in the sweet potato is obtained as follows:

total RNA was extracted from 100mg of fresh sweetpotato leaves using an OMEGA RNA kit, and cDNA was synthesized using a reverse transcription kit (Bioteke).

The specific reaction system is as follows:

the reverse transcription reaction was performed on a PCR instrument under the following conditions: 1. 50 ℃ for 45 min; 2. 10min at 70 ℃; and then cooled on ice.

The extracted total RNA is sent to a Chinese large gene (BGI), a sweet potato transcriptome database is obtained through high-throughput sequencing, and a sweet potato Unigene database is obtained through De novo splicing, wherein CL3260 is compared with an NR database to find that the gene is possibly involved in an ABA pathway. CL3260 predicts the ORF completion of the gene by OFR FINDER (http:// www.ncbi.nlm.nih.gov/projects/gorf /) online software and uses PrimerPremier 5 to design and amplify the complete ORF primers:

IbABF4(F)：5′ATGATGGGGTCATACTTGGA 3′

IbABF4(R)：5′TTACCAAGGCCCAGTAAGCG 3′

amplification was carried out using the Primerstar GXL DNA polymerase from TAKARA, as follows:

the reaction conditions were 94 ℃, 4min, 98 ℃, 10Sec, 55 ℃, 15Sec, 68 ℃, 1.5min, 72 ℃, 10min, and 30 cycles, the PCR product was purified using OMEGA DNA purification Kit, and the purified PCR product was ligated to pEASY-Blunt Vector (in this procedure using pEASY-Blunt Vector Cloning Kit from TransGEN) by transforming E-Coli.DH5 α competent with cDNA fragment 4u1 from IbABF4 gene, and 1. mu.L of pEASY-Blunt Vector under the conditions of 20-30 ℃ and 30min, plating the E-Coli.DH5 α competent ligated product on LB agar plate medium containing 40u125mg/mL X-Gal, 16ul 50mg/mL G, and 100mg/mL Amp, and selecting single colony, white pE was obtained by culturing the cloned on a NanoS agar plate medium containing 40u 125-Blunt Vector, inserting fragment of size, and obtaining a clone with the expected sequence of SEQ ID.

Example 2

IbABF4 protein sequence homology analysis is as follows:

the sequence of the IbABF4 gene obtained by sequencing is 1263bp, 421 amino acids coded by the sequence are shown in SEQ ID NO.2, and the protein sequence obtained by translation is compared with NCBI protein data (http:// blast.ncbi.nlm.nih.gov/blast.cgi) to obtain the plant species homologous gene similar to the IbABF4 protein sequence. Based on multiple comparative analysis, phylogenetic trees of various homologous plant species genes are established, and detailed description is provided in FIG. 1. Including morning glory (Ipomoea nil), tobacco (Nicotiana tabacum), potato (Solauum tuberosum), tomato (Solauum lycopersicum), pepper (Capsicum annuum), black nightshade (Solanum nigrum), Asian cotton (Gossypium arboreum), rice (Oryzasativa), walnut (Juglans regia), Arabidopsis (Arabidopsis thaliana). The MEGA 5.1 software is used for constructing a phylogenetic tree, and the obtained IbABF4 genetic relationship is closer to the genetic relationship between Arabidopsis and grape (as shown in figure 1).

Example 3

The construction of binary plant expression vector pCAMBIA 1305-2X 35s-IbABF4 is as follows:

the pCAMBIA 1305-2X 35s-IbABF4 vector is shown in FIG. 2, and first, pEASY-Blunt-IbABF4 plasmid is used as a template, and a primer is adopted

IbABF4-PstI(F)：5′aaCTGCAGATGGCTGCCACTATTGAT3′

IbABF4-BamHI(R)：5′ccGGATCCTTATGACCCGCCCGAACCTG 3′

Cleavage sites PstI and BamHI were introduced before and after IbABF4, respectively, and the reaction system and conditions were as described in example 1. Then the PCR product and the pCAMBIA1305 empty vector plasmid are respectively cut by BamHI and PstI, and the cut products are connected, wherein the connection system is as follows:

the ligation product is transformed into E-Coli.DH5 α, the E-Coli.DH5 α is coated on an LB plate containing 100mg/ml kanamycin resistance, the culture is carried out at 37 ℃, a single colony is selected after 12h for colony PCR verification, bacteria with positive colony PCR verification are shaken to extract plasmids, a target strip is obtained through enzyme digestion identification, and finally the target strip is sent to Huada gene sequencing company for sequencing, and the result shows that the vector pCAMBIA1305-2 x 35s-IbABF4 is correctly constructed.

Example 4

Agrobacterium strain EHA105 for plant transgenesis: the construction of pCAMBIA 1305-2X 35s-IbABF4 is as follows:

the agrobacterium strain used in the present invention is EHA 105. The constructed expression vector is transferred into agrobacterium by adopting a liquid nitrogen freeze-thawing method. The specific process is as follows: 1) melting EHA105 competent cells in an ice bath, adding at least 100ng of recovered and purified expression vector plasmid, gently mixing uniformly, and carrying out ice bath for 20-30 min; 2) quickly freezing for 5min by using liquid nitrogen, thermally shocking for 5min at 37 ℃, and quickly placing on ice for 1-2 min; 3) adding 800 μ L LB culture medium without antibiotics, resuscitating at 28 deg.C and 200rpm for 3.5 h; 4) centrifuging at 4000rpm for 3min, and sucking off the culture medium; 5) uniformly mixing the residual bacteria liquid, and smearing the bacteria liquid on a solid LB culture medium added with 100mg/ml kanamycin and 100mg/ml rifampicin; 6) carrying out inverted culture at 28 ℃ for 30-48 h; 7) detecting positive clone by PCR, and storing at 4 ℃ for later use.

Example 5

IbABF4 was transformed into Col wild type Arabidopsis as follows:

the positive clone in example 4 was inoculated into 50ml YEP (containing 100. mu.g/ml of Rif, 100. mu.g/ml of Kan) liquid medium, and the culture was continued at 28 ℃ and 180rpm until OD600 became 0.8. Centrifuging at 4000rpm for 10min, removing the culture medium, and collecting the thallus. The cells were diluted with an arabidopsis thaliana infiltration buffer to an OD600 of 0.6, to prepare an arabidopsis thaliana infiltration solution. When the Arabidopsis is bolting for 4-5cm, the infection can be prepared, and the terminal inflorescence is removed 3 days before infection so as to utilize the growth of the axillary inflorescence. After the axillary inflorescence grows out, the flowers at the lower part can be transformed when the pollination begins. A large amount of water was added before transformation, and the pollinated flower buds and pods were removed. A total of 50ml of Arabidopsis thaliana staining solution (5% sucrose, 0.05% Silwet L-77) was prepared, poured into a petri dish, and the inflorescence of Arabidopsis thaliana was immersed for 30s, taking care that rosette leaves were not stained with the bacterial solution. The plants were removed, placed horizontally in trays and dark treated for 24 h. Then a square plate is vertically placed for normal illumination culture. And harvesting T0 generation seeds when the fruit pods are mature.

Before sowing seeds of T0 generation, vernalizing the seeds in a refrigerator at 4 ℃ for 3d, sterilizing the surface of 0.5% NaClO, and sowing the seeds on 1/2MS solid medium (macroelements and microelements are reduced by half, and the content of hygromycin is 20 mg/L) for culture. After 7-14 days, the transformant is selected, the transformant with hygromycin resistance can grow on a hygromycin-containing culture medium, the root is obviously elongated, and the non-transformant gradually yellows and dies. When 4-5 leaves grow out, extracting DNA of the leaves for PCR identification, and cloning the primers and the PCR program as the middle fragment of the IbABF4 gene in the example 1. The PCR product was detected by 1% agarose gel electrophoresis. The arabidopsis positive transformant of the target fragment can be obtained through PCR amplification, and the arabidopsis positive transformant is continuously cultured until the fruit pod is mature, and T1 generation seeds are obtained. And continuously sowing seeds of T1 generations harvested from the plants identified as positive by the PCR, and counting the character segregation ratio of the plants after the hygromycin resistance screening. The separation ratio of 3: 1 in Mendelian's law of inheritance is met by the chi-square test. The partially resistant seedlings were transplanted into soil and transgenic seeds homozygous for the T2 generation were harvested.

Identification of phenotype of transgenic IbABF4 Gene Arabidopsis

IbABF4 overexpression Arabidopsis strains (OV-1, OV-2) and transformed Wild Type (WT) plants are selected and sown on 1/2MS culture medium for growth, and phenotype (figure 3) is observed, and IbABF4 overexpression in Arabidopsis can positively control the flowering time of the plants.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> IbABF4 gene encoding sweet potato bZIP transcription factor and application thereof

<130>2017

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>1263

<212>DNA

<213>Ipomoea batatas

<400>1

atgatggggt catacttgga cttcaagaac tttgtggaga caccacagcc agaaggtaat 60

ggagggaagc cagccagtct tttccctttg gctcgacaat cttcgatata ctccttgaca 120

tttgatgagc tccagacaac atttagcgga cttgggaagg atttcgggtc tatgaatatg 180

gaggatctgt tgaagagcat ttggactgcc gaggaatctc aacccttcca ggcatgttgt 240

gttggtgcag gagataatgg tagtgtccct ggtgggaact tgcagagaca aggctctcta 300

acgctgccca ggacgctcag tcagaaaact gtggatgaag tgtggaaaga ctttcagaaa 360

gacactggtg ccaccaaaga ttgtggctat ggtggatcaa gctttggcca aagacaatct 420

actttggggg aaatgacatt ggaggagttt ttgttcaaag caggggttgt aagggaagaa 480

atggttccaa atagtgttgg atttggcagc agtgtgactc agctgaatag tatgggattt 540

caagaaatca cagataataa cagtgctgcc attcctggtg catcatctaa ttcaatgctt 600

agtgcaggag ccaccagatc tacccagcaa caacctttgc agcatcatca acagcttcag 660

cttcaccaac cactttttcc taagcagaca accttgacct ttgcctctcc aatgcaatta 720

caaaacaatg ctcagcaggc taggtcagga gcaaggcgtc ctgctcttgg aatgccaagt 780

cctccacata acactaatca agttcaggga gaacttatcc aaggcagtgc gaatagcatg 840

gcaggattac gccaaaatgg ggctgcagga ggaggaggag gaggatcccc tggaattcca 900

ttgtcttcag atgtggctct taatagtaat ctgggcatgt catccctatc cccttcgcct 960

tatgcattta acgaaggcgg gagagggagg agagcatgta actctataga aaaggtggtg 1020

gagcggaggc gtaggagaat gattaagaac agagagtctg ctgcaagatc acgagccagg 1080

aagcaggcct ataccataga gttggaagcg gaagtagaaa agcttaaaga aatcaaccaa 1140

gaattgatga aaaaacaggc tgaatttctg gagaagcgga aaaatcagat gagggagaaa 1200

atgtttgtgc catgggaaag taaaccaaga tgcttgaaga ggacgcttac tgggccttgg 1260

taa 1263

<210>2

<211>420

<212>PRT

<213>Ipomoea batatas

<400>2

Met Met Gly Ser Tyr Leu Asp Phe Lys Asn Phe Val Glu Thr Pro Gln

1 5 10 15

Pro Glu Gly Asn Gly Gly Lys Pro Ala Ser Leu Phe Pro Leu Ala Arg

20 25 30

Gln Ser Ser Ile Tyr Ser Leu Thr Phe Asp Glu Leu Gln Thr Thr Phe

35 4045

Ser Gly Leu Gly Lys Asp Phe Gly Ser Met Asn Met Glu Asp Leu Leu

50 55 60

Lys Ser Ile Trp Thr Ala Glu Glu Ser Gln Pro Phe Gln Ala Cys Cys

65 70 75 80

Val Gly Ala Gly Asp Asn Gly Ser Val Pro Gly Gly Asn Leu Gln Arg

85 90 95

Gln Gly Ser Leu Thr Leu Pro Arg Thr Leu Ser Gln Lys Thr Val Asp

100 105 110

Glu Val Trp Lys Asp Phe Gln Lys Asp Thr Gly Ala Thr Lys Asp Cys

115 120 125

Gly Tyr Gly Gly Ser Ser Phe Gly Gln Arg Gln Ser Thr Leu Gly Glu

130 135 140

Met Thr Leu Glu Glu Phe Leu Phe Lys Ala Gly Val Val Arg Glu Glu

145 150 155 160

Met Val Pro Asn Ser Val Gly Phe Gly Ser Ser Val Thr Gln Leu Asn

165 170 175

Ser Met Gly Phe Gln Glu Ile Thr Asp Asn Asn Ser Ala Ala Ile Pro

180 185 190

Gly Ala Ser Ser Asn Ser Met Leu Ser Ala Gly Ala Thr Arg Ser Thr

195 200 205

Gln Gln Gln Pro Leu Gln His His Gln Gln Leu Gln Leu His Gln Pro

210 215 220

Leu Phe Pro Lys Gln Thr Thr Leu Thr Phe Ala Ser Pro Met Gln Leu

225 230 235 240

Gln Asn Asn Ala Gln Gln Ala Arg Ser Gly Ala Arg Arg Pro Ala Leu

245 250 255

Gly Met Pro Ser Pro Pro His Asn Thr Asn Gln Val Gln Gly Glu Leu

260 265 270

Ile Gln Gly Ser Ala Asn Ser Met Ala Gly Leu Arg Gln Asn Gly Ala

275 280 285

Ala Gly Gly Gly Gly Gly Gly Ser Pro Gly Ile Pro Leu Ser Ser Asp

290 295 300

Val Ala Leu Asn Ser Asn Leu Gly Met Ser Ser Leu Ser Pro Ser Pro

305 310 315 320

Tyr Ala Phe Asn Glu Gly Gly Arg Gly Arg Arg Ala Cys Asn Ser Ile

325 330 335

Glu Lys Val Val Glu Arg Arg Arg Arg Arg Met Ile Lys Asn Arg Glu

340 345 350

Ser Ala Ala Arg Ser Arg Ala Arg Lys Gln Ala Tyr Thr Ile Glu Leu

355 360 365

Glu Ala Glu Val Glu Lys Leu Lys Glu Ile Asn Gln Glu Leu Met Lys

370 375 380

Lys Gln Ala Glu Phe Leu Glu Lys Arg Lys Asn Gln Met Arg Glu Lys

385 390 395 400

Met Phe Val Pro Trp Glu Ser Lys Pro Arg Cys Leu Lys Arg Thr Leu

405 410 415

Thr Gly Pro Trp

420

Claims

1. An IbABF4 gene for coding a sweet potato bZIP transcription factor, which is characterized in that the IbABF4 gene is a nucleotide sequence shown in SEQ ID NO. 1; the IbABF4 gene has the function of positively regulating and controlling plant flowering.

2. The protein encoded by the IbABF4 gene as set forth in claim 1, which is the amino acid sequence shown in SEQ ID No. 2.

3. An expression vector pCAMBIA 1305-2X 35s-IbABF4 containing the gene of claim 1.

4. An agrobacterium host cell EHA 105: pCAMBIA 1305-2X 35s-IbABF 4.

5. Use of the expression vector of claim 3 or the agrobacterium host cell of claim 4 for transforming plants to obtain transgenic plants.

6. The use of claim 5, wherein said plant is Arabidopsis thaliana.