CN113817033A

CN113817033A - Application of ZmELF3.1 protein and functional deletion mutant thereof in regulating and controlling number or layer number of aerial roots of crops

Info

Publication number: CN113817033A
Application number: CN202110753684.2A
Authority: CN
Inventors: 谢钰容; 王海洋; 王宝宝; 赵永平
Original assignee: South China Agricultural University; Biotechnology Research Institute of CAAS
Current assignee: South China Agricultural University; Biotechnology Research Institute of CAAS
Priority date: 2021-07-02
Filing date: 2021-07-02
Publication date: 2021-12-21
Anticipated expiration: 2041-07-02
Also published as: CN113817033B

Abstract

The invention discloses an application of ZmELF3.1 protein and a function deletion mutant thereof in regulating and controlling the number or the layer number of aerial roots of crops. The invention uses the protein sequence of Arabidopsis ELF3 as the basis, obtains ELF3 genes of 2 corns by homologous alignment in a corn genome database, and the genes are respectively named as ZmELF3.1 and ZmELF3.2. The invention further utilizes the RISPR/Cas9 gene editing technology to mutate the maize ZmELF3.1 gene, and the mutant with the function deletion shows the phenotype of increasing the number of aerial root layers and the total number of aerial roots under the conditions of long sunlight and short sunlight, thereby determining that the maize ZmELF3.1 gene plays a crucial role in regulating and controlling the number and the number of the aerial root layers of the maize. The method has application prospect in regulating and controlling the number of layers of the aerial roots of the corn, and can also be applied to improvement of a corn inbred line and crossbreeding.

Description

Application of ZmELF3.1 protein and functional deletion mutant thereof in regulating and controlling number or layer number of aerial roots of crops

Technical Field

The invention relates to a new application of ZmELF3.1 protein and a function deletion mutant thereof, in particular to an application of the ZmELF3.1 protein and the function deletion mutant thereof in regulating and controlling the number of aerial roots or/and the number of layers of crops, belonging to the field of new applications of the ZmELF3.1 functional protein and the mutant thereof.

Background

Corn is the grain crop with the largest planting area all over the world, important feed and industrial raw materials, and the improvement and stability of the yield directly influence the global grain supply safety. Research shows that the number of aerial roots is large, the total number of roots is large, the accumulated amount of dry matter is large after flowering, and the accumulated amount of dry matter is large in the whole life no matter the corn group is the same or different in density; the large number of aerial roots is more beneficial to increasing the accumulated amount of the dry matter production of the population after the flowers are planted, thereby increasing the accumulated amount of the dry matter in the whole life. The number of aerial roots and the total number of roots of the population with different varieties and the same density or the population with the same variety and different densities have extremely obvious positive correlation with the yield, the increase of the number of grains per spike is more facilitated by the number of aerial roots, and the number of the aerial roots is an important mark for the low yield of the variety. Thus, an increase in aerial roots, whether in a variety or a population, is the most obvious feature of the root system that increases the total number of grains in the population and increases yield. Meanwhile, as one of the most important factors influencing the corn yield, the lodging degree of the plants is mainly influenced by the characteristics of the stalks and the root system structure. As an important component of the root system, aerial roots are gaining increasing attention for their role in lodging resistance in maize plants. Research shows that the three important characters of the aerial roots, namely the number of aerial root layers, the number of aerial root layers and the ground-grasping radius, are different in different maize subgroups, the range of the number of the aerial root layers in blood borders of tropical zone and subtropical zone is large, the number of the aerial roots and the ground-grasping radius of the aerial roots are more extreme values in the blood border subgroups of the tropical zone and the subtropical zone, the three characters of the aerial roots are obviously related in pairs, and the correlation coefficient between the number of the aerial root layers and the ground-grasping radius of the aerial roots is the highest, so that in certain tropical and subtropical environments, plants need more aerial root layers, ground-grasping radii and numbers, and fixation and support are provided for the plants. However, no report is available on the regulation and control of the number of aerial root layers and/or aerial root number by corn ELF3.

Disclosure of Invention

One of the purposes of the invention is to provide the application of ZmELF3.1 protein in regulating the number of aerial root layers or/and the number of aerial root layers of crops;

the above object of the present invention is achieved by the following technical solutions:

the invention utilizes CRISPR/Cas9 gene editing technology to edit and create a Zmelf3.1 mutant with ZmELF3.1 protein defect, and the number of layers and the number of the Zmelf3.1 mutant are increased by 400-; the invention simultaneously carries out functional defect mutation on the ZmELF3.2 protein to obtain the mutant zmelf3.2, and the result shows that compared with the wild type, the phenotype of the mutant zmelf3.2 does not show obvious increase in the number of aerial root layers and the number; therefore, the invention determines the application of the ZmELF3.1 protein or the mutant with function defect thereof in the aspects of regulating and controlling the number of aerial roots or/and the number of layers of the corn and the like.

The amino acid sequence of the ZmELF3.1 protein is shown in SEQ ID No. 1; the polynucleotide sequence of the encoding gene of the ZmELF3.1 protein is shown in SEQ ID No. 2.

More specifically, the regulation of the number of aerial roots or/and the number of layers of the crop comprises increasing the number of aerial roots or/and the number of layers of the crop or reducing the number of aerial roots or/and the number of layers of the crop.

The invention provides a method for increasing the number of aerial roots or/and the number of layers of crops, which comprises the following steps: constructing a gene editing vector of the ZmELF3.1 gene or a gene knockout vector of the ZmELF3.1 gene; transferring the gene editing vector or the gene knockout vector into a receptor plant to obtain a transgenic crop with ZmELF3.1 protein function defect; the number of aerial roots and the number of layers of the obtained transgenic crop are obviously more than those of wild plants.

The invention also provides a method for cultivating a new corn variety with the aerial root number or/and the layer number obviously more than those of a wild type variety, which comprises the following steps: constructing a gene editing vector of the ZmELF3.1 gene or a gene knockout vector of the ZmELF3.1 gene; transferring the gene editing vector or the gene knockout vector into receptor crop corn to obtain transgenic corn with ZmELF3.1 protein function defect; and (3) hybridizing the transgenic corn with the number of aerial roots or/and the number of layers which are obviously more than those of the wild type plant and different corn materials, backcrossing and transforming, and improving the hybrid to obtain a new corn variety with the number of aerial roots or/and the number of layers which are obviously more than those of the wild type plant.

Wherein, the gene editing vector of the ZmELF3.1 gene or the gene knockout vector of the ZmELF3.1 gene can be obtained according to the conventional construction method in the field.

As a preferred embodiment, the present invention provides a method for constructing a gene editing vector of ZmELF3.1 gene, comprising:

(1) preparing a corn U6-2 promoter fragment, wherein the primers of SEQ ID No. 3 and SEQ ID No. 4 are adopted for PCR amplification to obtain the corn U6-2 promoter fragment;

(2) preparation of sgRNA expression cassette

Fusing a target sequence of the ZmELF3.1 gene with a joint and a sgRNA framework sequence together by using an Overlap PCR method, and obtaining a PCR product named as a ZmELF3.1-1 fragment; wherein the primer sequence of the Overlap PCR is shown as SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7; the sgRNA framework sequence is shown in SEQ ID No. 8;

then, the fusion PCR fragment obtained in the last step and the U6-2 promoter fragment are fused into a fragment by using an Overlap PCR method, and the obtained PCR product is the sgRNA expression cassette; wherein, the used PCR primer sequences are shown as SEQ ID No. 9, SEQ ID No. 10 and SEQ ID No. 11;

(3) the sgRNA expression cassette was ligated with the CPB-pUbi-hspcas9 vector: and (3) connecting the sgRNA expression cassette to a CPB-Ubi-hspcas9 vector to obtain a connection product.

The invention also provides a method for increasing the number of aerial roots or/and the number of layers of crops, which comprises the following steps: (1) carrying out function defect mutation on the ZmELF3.1 protein to obtain a ZmELF3.1 protein function defect mutant; (2) constructing a recombinant plant expression vector containing the encoding gene of the ZmELF3.1 protein function deficiency mutant; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) the genes encoding functionally deficient mutants of the ZmELF3.1 protein are overexpressed in plant tissues or cells.

The functionally deficient variants of the ZmELF3.1 protein of the invention may be produced by genetic polymorphism or by human manipulation, such manipulations being generally known in the art. For example, a functionally deficient variant derived from the amino acid shown in SEQ ID No.1 by substitution, deletion or/and insertion of one or more amino acid residues may be used.

The invention also provides a method for reducing the number of aerial roots and the number of layers of crops, which comprises the following steps: (1) constructing a recombinant plant expression vector containing the encoding gene of the ZmELF3.1 protein; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) the coding gene of ZmELF3.1 protein is over-expressed in plant tissues or cells.

Operably connecting the encoding gene of the ZmELF3.1 protein with an expression regulation element to obtain a recombinant plant expression vector capable of expressing the encoding gene in a plant; the recombinant plant expression vector can consist of a 5 ' end non-coding region, a polynucleotide sequence shown in SEQ ID No.2 and a 3 ' non-coding region, wherein the 5 ' end non-coding region can comprise a promoter sequence, an enhancer sequence or/and a translation enhancing sequence; the promoter can be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region may comprise a terminator sequence, an mRNA cleavage sequence, and the like. Suitable terminator sequences can be taken from the Ti-plasmid of Agrobacterium tumefaciens, for example the octopine synthase and nopaline synthase termination regions.

The recombinant plant expression vector may also contain a selectable marker gene for selection of transformed cells. Selectable marker genes are used to select transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance, genes conferring resistance to herbicidal compounds, and the like. In addition, the marker gene also comprises phenotypic markers, such as beta-galactosidase, fluorescent protein and the like.

In addition, the polynucleotide shown in SEQ ID No.2 can be optimized by those skilled in the art to enhance expression efficiency in plants. For example, polynucleotides may be synthesized using optimization of preferred codons of the target plant to enhance expression efficiency in the target plant.

The transformation protocol described in the present invention and the protocol for introducing the polynucleotide or polypeptide into a plant may vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the polynucleotide or polypeptide into a plant cell include: microinjection, electroporation, agrobacterium-mediated transformation, direct gene transfer, and high-speed ballistic bombardment, among others. In particular embodiments, the genes of the invention can be provided to plants using a variety of transient transformation methods. The transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al plant Cell reports.1986.5: 81-84).

Crop species described in the present invention include, but are not limited to, monocots or dicots, preferably corn.

The invention uses the protein sequence of Arabidopsis ELF3 as the basis, obtains ELF3 genes of 2 corns by homologous alignment in a corn genome database, and the genes are respectively named as ZmELF3.1 and ZmELF3.2. The maize ZmELF3.1 or ZmELF3.2 gene is respectively mutated by using a CRISPR/Cas9 gene editing technology, and the result shows that the functional deletion mutant of the ZmELF3.1 protein shows a phenotype that the number of aerial roots and the number of layers are obviously increased under the conditions of long sunlight and short sunlight. Compared with the wild type, the phenotype of the functional deletion mutant of the ZmELF3.2 protein does not show obvious increase in the number of aerial roots and the number of layers; therefore, the corn ZmELF3.1 gene is determined to play an important role in regulating and controlling the number of aerial roots or/and layers of corn. The invention has important application prospect in improving the number and the layer number of the corn aerial roots and can also be applied to rice inbred line improvement and crossbreeding.

Definitions of terms to which the invention relates

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, and the like). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res.19:5081 (1991); Ohtsuka et al, J.biol.chem.260: 2605-S2608 (1985); and Cassol et al (1992); Rossolini et al, Mol cell. probes 8:91-98 (1994)).

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, the description for a polypeptide applies equally to the description of a peptide and to the description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

The term "plurality" as used herein generally means 2 to 8, preferably 2 to 4; the "substitution" refers to the substitution of one or more amino acid residues with different amino acid residues, respectively; the term "deletion" refers to a reduction in the number of amino acid residues, i.e., the absence of one or more amino acid residues, respectively; by "insertion" is meant a change in the sequence of amino acid residues that results in the addition of one or more amino acid residues relative to the native molecule.

The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

The term "transformation" refers to the genetic transformation of a polynucleotide or polypeptide into a plant in such a way that the encoding gene is introduced inside the plant cell. Methods for introducing such polynucleotides or polypeptides into plants are well known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, virus-mediated methods, and the like.

The term "stable transformation" refers to the introduction of a polynucleotide construct integrated into the genome of a plant cell and capable of being inherited by its progeny.

The term "transient transformation" refers to a polynucleotide that is introduced into a plant but is only transiently expressed or present in the plant.

The term "operably linked" refers to a functional linkage between two or more elements that may be operably linked and may or may not be contiguous.

The term "conversion": a method for introducing a heterologous DNA sequence into a host cell or organism.

The term "expression": transcription and/or translation of endogenous genes or transgenes in plant cells.

The term "coding sequence": a nucleic acid sequence transcribed into RNA.

The term "recombinant plant expression vector": one or more DNA vectors for effecting plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, together with vectors with helper plasmids, are most commonly used for agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selectable markers engineered to be capable of expression in plant cells, heterologous DNA sequences to be transcribed, and the like.

Drawings

FIG. 1 is a diagram of the mutant zmelf3.1 obtained by CRISPR/Cas9 gene editing method; the sequencing results, as can be seen in the figure: the mutant zmelf3.1 produced a 136bp long base large deletion or a 1bp insertion in the second exon of the edited zmelf3.1 gene, resulting in a protein frameshift mutation.

FIG. 2 shows that the gene ZmELF3.1 in zmelf3.1 is hardly transcribed by identifying T2 generation plants, selecting homozygote plants (FIG. 2-A), and carrying out qPCR detection of the gene ZmELF3.1 on homozygote mutant plants.

FIG. 3 is the number of aerial root layers and number phenotype of homozygous mutant zmelf 3.1; a: number of layers and number of phenotypes of mutant zmelf3.1 and wild type C01 aerial roots; b: counting and comparing the number of aerial root layers; c: and (5) counting and comparing the number of aerial roots.

Detailed Description

The invention is further described below in conjunction with specific embodiments, the advantages and features of which will become apparent from the description. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Wild type C01 in the following examples is maize inbred transformation material from the Chinese seed group (Wuhan).

Example 1 obtaining of ZmELF3.1 Gene and creation of mutant zmelf3.1

1. Acquisition of ZmELF3.1 Gene

The test uses the protein sequence of Arabidopsis ELF3 as the basis, obtains ELF3 genes of 2 corns by homologous alignment in a corn genome database, and the genes are named ZmELF3.1 and ZmELF3.2 respectively.

2. Creation of mutant Zmelf3.1

Firstly, acquiring a genome sequence of ZmELF3.1(Zm00001d044232) from a corn Gramene database, marking a CDS sequence in the genome sequence, then designing 2 target sites in the CDS sequence by Snap Gene Viewer software, and carrying out BLAST comparison in the corn Gramene database after the target sites are found to ensure the specificity of the two target sites. The target sequences are respectively:

ZmELF3.1-Guide 1：GTCCTCACAGACCAAGAACAAGG

ZmELF3.1-Guide 2：GTAGACTGTCGATAAAATCTAGG

then extracting the genome DNA of the maize wild type inbred line C01 by using a CTAB method. With primers:

ZmELF3.1-F2:5'TGGCTGTAATGATATGCTTGGG 3'

ZmELF3.1-R2:5'TTCTCTTAGCACCAACTTCCCG 3'

the genomic DNA mentioned above was subjected to PCR amplification, and the amplified product was sequenced. The sequencing result is compared with the B73 reference sequence, and the ZmELF3.1 target site sequence of C01 is found to be identical with the B73 reference sequence.

Primers were then synthesized for construction of the CRISPR-Cas9 vector for zmelf3.1 based on the sequencing results, as follows:

ZmELF3.1-1F:

5'GAGCCGCAAGCACCGAATTGTCCTCACAGACCAAGAACAGTTTTAGAGCTAGAAATAGCAAGTT 3'

ZmELF3.1-2F:

5'GAGCCGCAAGCACCGAATTGTAGACTGTCGATAAAATCTGTTTTAGAGCTAGAAATAGCAAGTT 3'

then constructing a CRISPR-Cas9 vector of ZmELF3.1, and specifically comprising the following steps:

(1) the CPB-pUbi-hspcas9 vector was digested with HindIII and recovered

(2) Preparation of maize U6-2 promoter fragment:

the primer sequence is as follows:

MU62-1F：5'TGCACTGCACAAGCTGCTGTTTTTGTTAGCCCCATCG 3'MU62-1R:5'AATTCGGTGCTTGCGGCTC 3'

the PCR amplification system is shown in Table 1.

TABLE 1PCR amplification System

Composition (I)	Volume of
		2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
		MU62-1F	1.5μL
MU62-1R	1.5μL
		KOD Fx	1μL
B73DNA	1μL
		Add ddH₂O	Up to 50μL

The PCR reaction procedure was as follows:

and (3) carrying out agarose gel electrophoresis on the PCR product, and then cutting and recovering the gel to obtain the corn U6-2 promoter fragment.

(3) Preparation of sgRNA expression cassette

Firstly, a target sequence with a linker and a sgRNA framework sequence are fused together by using an Overlap PCR method, and obtained PCR products are named as ZmELF3.1-1 fragment and ZmELF3.1-2 fragment respectively.

The primer sequence is as follows:

ZmELF3.1-1F:

5'GAGCCGCAAGCACCGAATTGTCCTCACAGACCAAGAACAGTTTTAGAGCTAGAAATAGCAAGTT 3'

ZmELF3.1-2F:

5'GAGCCGCAAGCACCGAATTGTAGACTGTCGATAAAATCTGTTTTAGAGCTAGAAATAGCAAGTT 3'

MUsgR-2R:5'GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG3'

the PCR amplification system is shown in Table 2.

TABLE 2PCR amplification System

Composition (I)	Volume of
		2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
		ZmELF3.1-1F/ZmELF3.1-2F	1.5μL
MUsgR-2R	1.5μL
		KOD Fx	1μL
Synthetic sgRNA framework sequences	1μL
		Add ddH₂O	Up to 50μL

The sequence of an artificially synthesized sgRNA framework fragment is as follows:

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

the PCR reaction procedure was as follows:

and then, the fusion PCR fragment obtained in the last step and the U6-2 promoter fragment are fused into a fragment by using an Overlap PCR method, and the obtained PCR product is the sgRNA expression cassette which is respectively named as a U62-ZmELF3.1-1 fragment and a U62-ZmELF3.1-2 fragment. The primer sequence is as follows:

MU62-1F：5'TGCACTGCACAAGCTGCTGTTTTTGTTAGCCCCATCG3'(U62-ZmELF3.1-1)

MU62-2F:5'TGCTTTTTTTAAGCTGCTGTTTTTGTTAGCCCCATCG3'(U62-ZmELF3.1-2)

MUsgR-2R:5'GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG3'

the PCR amplification system is shown in Table 3.

TABLE 3PCR amplification System

Composition (I)	Volume of
		2×PCR Buffer for KOD Fx	25μL
2mM dNTPs	10μL
		MU62-1F/MU62-2F	1.5μL
MUsgR-2R	1.5μL
		KOD Fx	1μL
U6-2 promoter fragment	1μL
		ZmELF3.1-1 fragment/ZmELF3.1-2 fragment	1μL
Add ddH₂O	Up to 50μL

(4) The sgRNA expression cassette is connected with a CPB-pUbi-hspcas9 vector

The ligation product was obtained by ligating 2 sgRNA expression cassettes sequentially to CPB-Ubi-hspcas9 vector according to the following reaction system and procedure.

The reaction system and procedure are shown in Table 4.

TABLE 4 reaction systems and procedures

Composition (I)	Volume of
		sgRNA expression cassette	1μL
CPB-pubi-hspcas9 vector fragment	1μL
		Recombinant enzyme	0.5μL

The recombinase is an In-Fusion enzyme from Clontech, and the reaction conditions are 50 ℃ and 30 min.

Note: the U62-ZmELF3.1-1 fragment was ligated with the CPB-pubi-hspcas9 vector fragment, and the U62-ZmELF3.1-2 fragment was ligated with the CPB-pubi-hspcas9-U62-ZmELF3.1-1 vector fragment (both with HindIII digestion).

(5) Transformation of Escherichia coli DH5 alpha and validation

The ligation product was transformed into E.coli DH 5. alpha. by heat shock method at 42 ℃ and the bacterial solution was spread on a plate containing 50mg/L kanamycin and cultured at 37 ℃ for about 12 to 16 hours. Picking single colony growing on the plate, shaking the bacteria and propagating. And carrying out PCR verification by using the bacterial liquid as a template.

The PCR amplification system is shown in Table 5.

TABLE 5PCR amplification System

Composition (I)	Volume of
		ddH₂O	5.75μL
2XTsinGKE master mix	7.5μL
		Ubi-4F	0.375μL
PstI-R	0.375μL
		Bacterial liquid	1μL
Total	15μL

Wherein the upstream primer designed according to the vector is Ubi-4F:5 'CTTAGACATGCAATGCTCATTATCTC 3', and the downstream primer is PstI-R:5 'CTGGCGAAAGGGGGATGT 3', and is used for detecting positive clones.

The PCR reaction procedure was as follows:

the correct PCR band size of the bacterial suspension was sequenced. And (3) obtaining a first ligation product vector fragment after the plasmid with the correct sequencing result is subjected to single enzyme digestion by HindIII, and then repeating the steps (4) and (5) to connect the U62-ZmELF3.1-2 fragment to the CPB-pubi-hspcas9 vector.

(6) The constructed CPB-pubi-hspcas9-ZmELF3.1 gene editing vector is introduced into Agrobacterium EHA105 by electric shock.

(7) CPB-pubi-hspcas 9-ZmELF3.1T-DNA is introduced into a maize inbred line C01 receptor by utilizing an agrobacterium-mediated maize immature embryo genetic transformation method (entrusting the completion of the life science and technology center of the Chinese seed group Limited company, and the address is No. 3 Biogarden 888 # of high and new technology development area of Wuhan city, Hubei province). Transgenic T0 generation seeds were obtained.

(8) Seeds of T0 generation were sown in the field, and when the corn grew to 4 developed leaves, the leaf tips were smeared with a Basta reagent (200 g/l glufosinate, purchased from the san Chun autumn farm shop of Taobao) diluted 1000-fold, and T1 generation plants without inserted T-DNA (the Basta smeared part died) were selected. Then sampling and extracting the genome DNA of the T1 generation plants, carrying out PCR amplification and sequencing to identify whether the target site is mutated or not.

The PCR amplification system is shown in Table 6.

TABLE 6PCR amplification System

Composition (I)	Volume of
		ddH₂O	5.75μL
2XTsinGKE master mix	7.5μL
		ZmELF3.1-F3	0.375μL
ZmELF3.1-R3	0.375μL
		Genomic DNA	1μL
Total	15μL

ZmELF3.1-F3:5'GACAGAGTTTCTTCATCCAGGTTT 3'

ZmELF3.1-R3:5'CCACAGCTTTTGATCCTTGC 3'

The PCR reaction procedure was as follows:

since the zmelf3.1 gene designs two targets, theoretically if Cas9 cuts at two targets at the same time, a single miniband fragment should be obtained after PCR amplification of the zmelf3.1 homozygous mutant. Wild type plants should obtain single large band fragments without cutting after PCR amplification, while heterozygous plants should amplify 2 bands (large and small fragments) (see FIG. 2-A), as shown in Table 7 below:

TABLE 7 amplified bands

Large band bp	Minor band bp
		516	382

After primary PCR screening and identification, a single small band fragment is selected and sent to a company for sequencing. The sequencing result is shown (figure 1-C), identified 3 independent events from the homozygous mutant zmelf3.1, 2 deleted 136bp, one inserted a base T, they all have frame shift mutation, thus making ZmELF3.1 protein loss function.

Test example 1 phenotypic analysis of Zmelf3.1 mutant

Carrying out functional deficiency mutation on the Zmelf3.2 protein by the method of reference example 1 to obtain a Zmelf3.2 homozygous mutant; one of the zmelf3.1 homozygous mutants of example 1 was crossed with the zmelf3.2 homozygous mutant to yield the double mutant elf3.1elf 3.2.

Homozygous zmelf3.1 corn mutant, homozygous zmelf3.2 corn mutant, double mutant elf3.1elf3.2 and wild type corn were planted in the international high-tech industrial park base of Wanzhuangzhou Yidingmu in Guangyang area of corridor city, north Hei province and the university demonstration park of West Town Mamura city of autonomous county of Ledong county, south China, the wild type and each mutant were planted in 3 rows, 15 rows each. Investigation of the number of aerial roots and number of wild-type maize and mutant maize plants in the field revealed that the number of aerial roots of the zmelf3.1 mutant was significantly greater than the wild-type (P) under long and short day conditions (P.sub.L.sub.L.sub.L.sub.L.sub.L)<10^-10) The number of aerial roots and the number of layers of aerial roots of the corn are not greatly influenced after the elf3.2 mutation, and compared with the wild type, the number of aerial roots and the number of layers of aerial roots are not shown obviouslyThe number of layers and the number of aerial roots are inhibited by the ZmELF3.1 gene of maize (FIG. 3).

SEQUENCE LISTING

<110> institute of biotechnology of academy of agricultural sciences of China, southern China university of agriculture

Application of <120> ZmELF3.1 protein and functional deletion mutant thereof in regulation and control of number or layer number of aerial roots of crops

<130> BJ-2002-210508A

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 756

<212> PRT

<213> Zea mays

<400> 1

Met Thr Arg Gly Gly Gly Gly Gln Gly Gly Lys Glu Glu Pro Gly Lys

1 5 10 15

Val Met Gly Pro Leu Phe Pro Arg Leu His Val Ser Asp Ala Gly Lys

20 25 30

Gly Gly Gly Pro Arg Ala Pro Pro Arg Asn Lys Met Ala Leu Tyr Glu

35 40 45

Gln Phe Thr Val Pro Ser Asn Arg Phe Ser Ser Pro Ala Ala Ser Ala

50 55 60

Arg Ala Ala Gly Ala Ser Leu Val Pro Ser Thr Ala Ala Ala Gln Val

65 70 75 80

Tyr Gly Tyr Asp Arg Thr Leu Phe Gln Pro Phe Asp Val Pro Ser Asn

85 90 95

Glu Pro Pro Arg Ser Ser Glu Lys Phe Lys Gly Asn Thr Ile Asn Gly

100 105 110

Gln Ser Asn Ser Thr Arg Arg Glu Pro Leu Arg Met Ser Ser Gln Thr

115 120 125

Lys Asn Lys Asp Val Cys Ala Ser Lys Ser Ile Ala Lys Cys Thr Ser

130 135 140

Gln His Arg Val Gly Asn Thr Ile Met Ser Ser Gly Lys Lys Val Val

145 150 155 160

Ser Asp Asp Glu Phe Met Val Pro Ser Ile Cys Tyr Pro Arg Phe Tyr

165 170 175

Arg Gln Ser Thr Gln Asp His Ala Asp Lys Ser Lys Pro Gln Ser Thr

180 185 190

Thr Asn Pro His Lys Ser Pro Ala Met Ser Lys Ser Ser Val Glu Cys

195 200 205

Tyr Ser Thr Val Asn Lys His Leu Asp Lys Ile Asn Glu Ala Asp Arg

210 215 220

Arg Leu Met Asn Ser Pro Lys Val Lys Glu Lys Glu Ala Val Gln Gly

225 230 235 240

Ser Lys Ala Val Glu Val Lys Glu Lys Ser Ser Ser Phe Gln Ala Ser

245 250 255

Glu Lys Phe Lys Asp Lys Tyr Ala Lys Leu Cys Gln Met Arg Asn Lys

260 265 270

Ala Ser Asn Ile Asn His Cys Asp Asn Asn Gly Cys Gln Pro Ala Ser

275 280 285

Val Asn Gly Asn Phe Thr Glu Ala Lys Asn Pro Thr Ala Ala Arg Asn

290 295 300

Thr Ser Ser Cys Lys Pro Cys Thr Asp Val Asp Ser Ser Asn Arg Lys

305 310 315 320

Ser Asn Leu Leu Glu Arg Ser Pro Arg Glu Val Gly Ala Lys Arg Lys

325 330 335

Arg Gly His His Asn Gly Glu Gln Asn Asp Asp Leu Ser Asp Ser Ser

340 345 350

Val Glu Cys Ile Pro Gly Gly Glu Ile Ser Pro Asp Glu Ile Val Ala

355 360 365

Ala Ile Gly Pro Lys His Phe Trp Lys Ala Arg Arg Ala Ile Gln Asn

370 375 380

Gln Gln Arg Val Phe Ala Val Gln Val Phe Glu Leu His Lys Leu Ile

385 390 395 400

Lys Val Gln Lys Leu Ile Ala Ala Ser Pro His Leu Leu Ile Glu Gly

405 410 415

Asp Pro Val Leu Gly Asn Ala Leu Thr Gly Lys Arg Asn Lys Leu Pro

420 425 430

Lys Gly Asn Ser Lys Val Gln Thr Leu Ser Ile Thr Asn Lys Asp Asp

435 440 445

Ile Gln Pro Thr Leu Glu Gln Pro Glu Leu Ser Lys Gln Asp Thr Glu

450 455 460

Gly Asn Leu Leu Ala His Ser His Asp Asp Gly Leu Gly Asp Asn His

465 470 475 480

His Asn Gln Ala Ala Thr Asn Glu Thr Phe Thr Ser Asn Pro Pro Ala

485 490 495

Met His Val Ala Pro Asp Asn Lys Gln Asn Asn Trp Cys Met Asn Pro

500 505 510

Pro Gln Asn Gln Trp Leu Val Pro Val Met Ser Pro Ser Glu Gly Leu

515 520 525

Val Tyr Lys Pro Phe Ala Gly Pro Cys Pro Pro Val Gly Asn Leu Leu

530 535 540

Thr Pro Phe Tyr Ala Asn Cys Ala Pro Ser Arg Leu Pro Ser Thr Pro

545 550 555 560

Tyr Gly Val Pro Ile Pro His Gln Pro Gln His Met Val Pro Pro Gly

565 570 575

Ala Pro Ala Met His Met Asn Tyr Phe Pro Pro Phe Ser Met Pro Val

580 585 590

Met Asn Pro Gly Thr Pro Ala Ser Ala Val Glu Gln Gly Ser His Ala

595 600 605

Ala Ala Pro Gln Pro His Gly His Met Asp Gln Gln Ser Leu Ile Ser

610 615 620

Cys Asn Met Ser His Pro Ser Gly Val Trp Arg Phe Leu Ala Ser Arg

625 630 635 640

Asp Ser Glu Pro Gln Ala Ser Ser Ala Thr Ser Pro Phe Asp Arg Leu

645 650 655

Gln Val Gln Gly Asp Gly Ser Ala Pro Leu Ser Phe Phe Pro Thr Ala

660 665 670

Ser Ala Pro Asn Val Gln Pro Pro Pro Ser Ser Gly Gly Arg Asp Arg

675 680 685

Asp Gln Gln Asn His Val Ile Arg Val Val Pro Arg Asn Ala Gln Thr

690 695 700

Ala Ser Val Pro Lys Ala Gln Pro Gln Pro Ser Ser Gly Gly Arg Asp

705 710 715 720

Gln Lys Asn His Val Ile Arg Val Val Pro His Asn Ala Gln Thr Ala

725 730 735

Ser Glu Ser Ala Ala Trp Ile Phe Arg Ser Ile Gln Met Glu Arg Asn

740 745 750

Gln Asn Asp Ser

755

<210> 2

<211> 2271

<212> DNA

<213> Zea mays

<400> 2

atgacgaggg gaggcggtgg acaaggaggc aaggaggagc cggggaaggt gatgggtccg 60

ctgttcccgc ggctccacgt cagcgacgca ggcaagggcg gcggcccgcg ggctccgcca 120

aggaacaaga tggcgctcta cgagcagttc accgtgccgt ccaaccgctt cagctccccc 180

gcggcctccg cccgcgccgc gggggccagc ctcgtgccct ccacggcggc tgcccaggtt 240

tatggttatg acaggacgct gttccagccc ttcgacgtgc cttcaaatga gcctcctcgt 300

tcatctgaaa agttcaaagg aaacactatc aacgggcagt ctaatagtac aagaagagaa 360

cctttgagga tgtcctcaca gaccaagaac aaggacgtct gtgcttcaaa atcaattgcc 420

aagtgcacct cacagcatag agtgggcaac accatcatgt cttctggaaa gaaagtggtc 480

agtgatgatg aatttatggt tccttccatc tgttatccta gattttatcg acagtctact 540

caagatcatg cagataaatc aaaaccccaa tctactacaa acccacacaa aagtcctgca 600

atgtccaaat catctgtaga gtgctatagt actgtgaaca agcacttgga caaaatcaat 660

gaagctgata ggaggttaat gaactctcca aaggttaagg agaaagaagc agtgcaagga 720

tcaaaagctg tggaagttaa agaaaagagt tcatcatttc aggcatcaga aaagttcaaa 780

gacaaatatg ctaagctatg tcaaatgagg aataaggcaa gtaatataaa tcattgtgac 840

aacaacggtt gccaacctgc aagcgtgaat ggaaatttca cagaagcaaa gaaccctaca 900

gcagctagaa atacatcttc ctgtaaacca tgtactgatg tagatagctc taacaggaag 960

tctaatttac tggaaagaag cccacgggaa gttggtgcta agagaaaaag aggacatcac 1020

aatggagagc aaaatgatga tttatctgac tcctcagtgg aatgcatacc tgggggggag 1080

atctctccag atgaaattgt tgctgctatt ggtccaaagc atttctggaa agcaagaaga 1140

gctattcaga atcagcagag ggtttttgct gtccaagtgt tcgagctgca taagctgata 1200

aaagtgcaga aattaatcgc ggcatctcca catctgctta ttgaaggtga tcctgtcctt 1260

ggcaatgcat taacaggaaa aaggaacaaa cttcctaaag gaaattcgaa agttcagacc 1320

ctgtcaatca caaacaaaga tgatatccag ccaaccctag agcaaccaga gttatcaaaa 1380

caagacacag aaggaaactt attggcccat tctcatgatg atggacttgg tgacaaccat 1440

cataatcaag ctgcaacaaa tgaaaccttt acaagcaacc ctccagctat gcatgttgct 1500

cctgacaaca aacagaataa ctggtgcatg aatccaccgc agaatcaatg gcttgtccca 1560

gttatgtcgc cttctgaagg tcttgtctat aagccttttg ccggcccttg tcccccagtt 1620

ggaaatctgc tgacaccatt ttacgccaac tgtgctccgt caaggctgcc ttctacacca 1680

tatggcgttc ctattcctca ccagccacag cacatggtcc ctcctggtgc ccctgccatg 1740

catatgaact acttcccgcc tttcagtatg ccagtgatga atccaggaac accagcatct 1800

gcagtggagc aagggagcca tgctgctgcg ccacagcctc atgggcacat ggaccagcag 1860

tcgctgatct catgtaacat gtcacacccg agtggcgttt ggaggtttct tgcatcaagg 1920

gacagcgagc cacaggccag cagcgccacc agccctttcg acaggctcca agtccaaggt 1980

gatggaagtg ctccgttgtc attctttccc acggcttcag ctccgaatgt ccagcctccg 2040

ccctcatctg gaggccggga ccgggaccag cagaaccatg taatcagggt tgttccgcgt 2100

aacgcacaga ctgcttcagt cccgaaagcc caacctcagc cgtcatccgg aggccgggac 2160

caaaagaacc atgtaatcag ggttgttccg cataacgcgc agactgcttc ggagtcagca 2220

gcgtggatct tccggtcaat acaaatggag aggaaccaaa atgattcgta g 2271

<210> 3

<211> 37

<212> DNA

<213> Artifical sequence

<400> 3

tgcactgcac aagctgctgt ttttgttagc cccatcg 37

<210> 4

<211> 19

<212> DNA

<213> Artifical sequence

<400> 4

aattcggtgc ttgcggctc 19

<210> 5

<211> 64

<212> DNA

<213> Artifical sequence

<400> 5

gagccgcaag caccgaattg tcctcacaga ccaagaacag ttttagagct agaaatagca 60

agtt 64

<210> 6

<211> 64

<212> DNA

<213> Artifical sequence

<400> 6

gagccgcaag caccgaattg tagactgtcg ataaaatctg ttttagagct agaaatagca 60

agtt 64

<210> 7

<211> 34

<212> DNA

<213> Artifical sequence

<400> 7

ggccagtgcc aagcttaaaa aaagcaccga ctcg 34

<210> 8

<211> 83

<212> DNA

<213> Artifical sequence

<400> 8

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt ttt 83

<210> 9

<211> 37

<212> DNA

<213> Artifical sequence

<400> 9

tgcactgcac aagctgctgt ttttgttagc cccatcg 37

<210> 10

<211> 37

<212> DNA

<213> Artifical sequence

<400> 10

tgcttttttt aagctgctgt ttttgttagc cccatcg 37

<210> 11

<211> 34

<212> DNA

<213> Artifical sequence

<400> 11

ggccagtgcc aagcttaaaa aaagcaccga ctcg 34

Claims

The ZmELF3.1 protein or the function defect mutant thereof is applied to the regulation and control of the number of aerial roots or/and the layer number of crops.
2. Use according to claim 1, wherein the modulation is an increase in the number of aerial roots or/and layers of the crop.
3. A method of increasing the number of aerial roots or/and the number of layers in a crop comprising: constructing a gene editing vector of the ZmELF3.1 gene or a gene knockout vector of the ZmELF3.1 gene; the gene editing vector or the gene knockout vector is transferred into receptor crops to obtain transgenic crops with ZmELF3.1 protein function defect.
4. The method according to claim 3, wherein the gene-editing vector of ZmELF3.1 gene is constructed by a method comprising:

(1) preparing a corn U6-2 promoter fragment;

(2) preparing an sgRNA expression cassette;

fusing a target sequence of the ZmELF3.1 gene with a joint and a sgRNA framework sequence together by using an Overlap PCR method, and obtaining a PCR product named as a ZmELF3.1-1 fragment;

then, the fusion PCR fragment obtained in the last step and the U6-2 promoter fragment are fused into a fragment by using an Overlap PCR method, and the obtained PCR product is the sgRNA expression cassette;

(3) the sgRNA expression cassette was ligated with the CPB-pUbi-hspcas9 vector: and (3) connecting the sgRNA expression cassette to a CPB-Ubi-hspcas9 vector to obtain a connection product.
5. The method according to claim 4, wherein the primers shown in SEQ ID No. 3 and SEQ ID No. 4 are used in the PCR amplification in step (1) to obtain a corn U6-2 promoter fragment; the primer sequence of the Overlap PCR in the step (2) is shown as SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7; the sgRNA framework sequence is shown in SEQ ID No. 8; the PCR primer sequences used in the step (2) are shown as SEQ ID No. 9, SEQ ID No. 10 and SEQ ID No. 11.
6. A method for increasing the number of aerial roots or/and the number of layers of a crop, comprising: (1) carrying out function defect mutation on the ZmELF3.1 protein to obtain a ZmELF3.1 protein function defect mutant; (2) constructing a recombinant plant expression vector containing the encoding gene of the ZmELF3.1 protein function deficiency mutant; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) the genes encoding functionally deficient mutants of the ZmELF3.1 protein are overexpressed in plant tissues or cells.
7. A method for breeding a new corn variety with more aerial roots or/and layers than wild type, which comprises the following steps: constructing a gene editing vector of the ZmELF3.1 gene or a gene knockout vector of the ZmELF3.1 gene; transferring the gene editing vector or the gene knockout vector into receptor plant corn to obtain transgenic corn with ZmELF3.1 protein function defect; and (3) hybridizing the transgenic corn with the number of aerial roots and the number of layers which are obviously more than those of the wild type plant obtained by screening with different corn materials, backcrossing and transforming, and improving the hybrid to obtain a new corn variety with the number of aerial roots or/and the number of layers which are obviously more than those of the wild type plant.
8. Use according to claim 1, wherein the modulation is a reduction in the number of aerial roots or/and the number of layers of the crop.
9. A method for reducing the number of aerial roots or/and the number of layers of a plant, comprising: (1) constructing a recombinant plant expression vector containing the encoding gene of the ZmELF3.1 protein; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) the coding gene of ZmELF3.1 protein is over-expressed in plant tissues or cells.
10. Use according to claim 1-2 or 8, method according to any one of claims 3-6 or 9-10, wherein the crop plant is a monocotyledonous or dicotyledonous plant, preferably maize.