CN113999850A - Potato U6 RNA polymerase III type promoter and cloning and application thereof - Google Patents
Potato U6 RNA polymerase III type promoter and cloning and application thereof Download PDFInfo
- Publication number
- CN113999850A CN113999850A CN202111390729.0A CN202111390729A CN113999850A CN 113999850 A CN113999850 A CN 113999850A CN 202111390729 A CN202111390729 A CN 202111390729A CN 113999850 A CN113999850 A CN 113999850A
- Authority
- CN
- China
- Prior art keywords
- stu
- potato
- promoter
- sgrna
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1247—DNA-directed RNA polymerase (2.7.7.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07006—DNA-directed RNA polymerase (2.7.7.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, and particularly relates to a potato U6 RNA polymerase III type promoter, more particularly to StU 64-1 and StU 68-1 gene promoters, and further discloses a cloning method and application thereof. According to the invention, two potato RNA polymerase III type promoters StU 64-1 and StU 68-1 are obtained by cloning in potatoes, have high-efficiency transcription activity and can drive downstream sgRNA to express, and the activity of the two promoters and the feasibility of the two promoters in application to potato CRISPR/Cas9 gene editing are respectively verified through a Bunsen leaf transient transformation system and a potato stable transformation system, so that the potato genome editing guided by CRISPR/Cas9 is realized. In the field of transgenic technology, these promoters are not only suitable for potato, but also applicable to other solanaceae crops such as tobacco.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, relates to the technical field of plant transgenosis, and more particularly relates to cloning and application of a potato U6 promoter.
Background
Potato (Solanum tuberosum) is the fourth largest food crop worldwide, second only to rice, corn and wheat. Potato cultivars are mainly tetraploids (2 n =4x = 48), are vegetative propagated through tubers, are selfed crops, but have the characteristics of self-decline and self-incompatibility. The potato is mainly bred by traditional crossbreeding, namely, parents with better combining ability are utilized to prepare crossbreeding combination, and the obtained progeny of the seedling seeds are subjected to character identification, so that a new variety is bred. Therefore, the breeding cycle of the new potato variety is longer, the breeding character has stronger randomness, and the important characters such as yield, quality, stress resistance and the like are difficult to be considered. Highly efficient techniques are urgently needed to genetically modify potatoes.
In the early 2013, a CRISPR/Cas9 technology (customized regulated intersectant Short Palindromic Repeat-associated protein 9) was developed and successfully applied to gene editing of animal cells (Cong et al, 2013; Ran et al, 2013). Due to the advantages of high editing efficiency, simple and convenient operation, low off-target rate and the like, a plurality of CRISPR/Cas9 systems for plant gene editing have been developed and applied in 2013 (Miao et al, 2013; Jiang et al, 2013; Shan et al, 2013), and then the plant CRISPR/Cas9 system is rapidly developed and applied. Although the CRISPR/Cas9 technology has been widely used for crop functional gene and genetic improvement studies, most of the related studies have mainly focused on diploid crops. The genomes of some important food and economic crops are polyploids, which puts higher demands on the efficiency of the CRISPR/Cas9 system. At present, the CRISPR/Cas9 technology can be used for genetic improvement of polyploid crop traits such as wheat, switchgrass, soybean and strawberry (Wang et al, 2014; Cai et al, 2018; Liu et al, 2018; Martini i-Pizarro et al, 2019). Therefore, the development of the CRISPR/Cas9 technology of the efficient tetraploid potato cultivar is not only beneficial to the research of the potato gene function, but also provides a new tool for genetic improvement of the potato gene engineering in the future.
In the CRISPR/Cas9 system, the U6 snrna (small nuclear RNA) promoter is a type of nuclear RNA polymerase type III promoter, often used to drive expression of sgrnas in the nucleus. The U6 promoter has certain species specificity, and the endogenous U6 promoter of a plant species can be used for higher editing efficiency in the gene editing process. At present, the endogenous U6 promoter available for potato gene editing is less studied, and an applicable potato U6 promoter is still lacking, which limits the application of potato gene editing technology. Therefore, screening and researching the high-activity U6 promoter in the potato have important promotion effect on genetic improvement of genetic engineering of the potato.
The invention content is as follows:
therefore, the invention aims to provide two potato U6 promoters StU 64-1 and StU 68-1 and further discloses a cloning method and application thereof.
The potato U6 promoter provided by the invention comprises StU 64-1 and/or StU 68-1; the StU 64-1 promoter contains a DNA nucleotide sequence shown in SEQ ID No. 1; the StU 68-1 promoter has the DNA nucleotide sequence shown in SEQ ID No. 2.
The StU 64-1 promoter is derived from the 4 th chromosome of potato; the StU 68-1 promoter is derived from chromosome 8 of potato.
The invention also discloses two sgRNA expression cassette vectors for constructing the potato gene editing vector, namely StU 64-1 and/or StU 68-1 containing potato U6 promoter.
Specifically, the potato sgRNA expression cassette vector is a recombinant plasmid StU 64-1-sgRNA and/or StU 68-1-sgRNA.
The invention also provides a specific primer for cloning the potato StU 64-1 promoter or StU 68-1 promoter:
specific primers for the promoter StU 64-1 were as follows:
StU6 4-1pF：GGGCTTCACTGTGAATTTAG，
StU6 4-1pR：CAAACACATATGTTGTTGTTGA；
specific primers aiming at the promoter StU 68-1 are as follows:
StU6 8-1pF：AATTGACGGGTAGACATCA，
StU6 8-1pR：CAGACATATAGGTTAATGTTTTG。
a cloning method comprising the steps of:
(1) using genomic DNA of leaves of a potato cultivar 'Qingshu No. 9' as a template, performing PCR amplification by using an atopic primer of StU 64-1 or StU 68-1, and performing PCR amplification in a 25 mu L reaction system by using a high fidelity enzyme PhantaR Max, wherein the PCR reaction program comprises the following steps: 3min at 95 ℃; 30 cycles of 95 ℃ for 30s, 52 ℃ for 30s, 72 ℃ for 30s, then 72 ℃ for 5 min; purifying the obtained PCR product by agarose gel cutting;
(2) cloning the purified PCR product to pEASYR-Blunt cloning vector, transferring into Escherichia coli DH5 alpha, selecting single clone to extract plasmid for sequencing analysis, obtaining 466 bp StU 64-1 gene promoter fragment (shown as SEQ ID No: 1) and 511 bp StU 68-1 gene promoter fragment (shown as SEQ ID No: 2).
The invention also provides a construction method of the sgRNA expression cassette vector for the potato gene editing vector, which comprises the following steps:
(1) the StU 64-1 gene promoter sequence shown in SEQ ID No. 1 or the StU 68-1 gene promoter sequence shown in SEQ ID No. 2 is taken as a template, and the following primers containing homologous arms are used for carrying out PCR amplification on the StU 64-1 gene promoter or the StU 68-1 gene promoter:
StU6 4-1gF：GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG；
StU6 4-1gR：TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA；
StU6 8-1gF：GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA；
StU6 8-1gR：TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG；
purifying the PCR product to obtain a StU 64-1 gene promoter fragment containing a homology arm and a StU 68-1 gene promoter fragment containing the homology arm;
(2) the plasmid pYLsgRNA-AtU6-1 is used as a template, primers sgRNA-F and sgRNA-R are used for PCR, the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1 is deleted and the plasmid is linearized, and the primer sequences are as follows:
sgRNA-F：AGAGACCTCTGAAGATAACA；
sgRNA-R：TCCTTTGCTGCCGATTCCAC；
PCR amplification was performed in a 25. mu.L reaction system using the high fidelity enzyme PhantaR Max, and the PCR procedure was: 3min at 95 ℃; 95 ℃ 30s, 52 ℃ 30s, 72 ℃ 3: 30s, 30 cycles, then 5min at 72 ℃; purifying the obtained PCR product by agarose gel cutting to obtain a linearized pYLsgRNA plasmid;
(3) and (2) recombining the StU 64-1 gene promoter fragment containing the homologous arm or the StU 68-1 gene promoter fragment containing the homologous arm in the step (1) into the linearized pYLsgRNA plasmid in the step (2) by using an ExnasRII recombinase to obtain a sgRNA expression cassette vector StU 64-1-sgRNA or StU 68-1-sgRNA used for the potato gene editing vector.
The potato U6 promoter StU 64-1 and/or StU 68-1 is applied to the transgenic technology of solanaceae plants or the construction of gene editing vectors of solanaceae plants. The Solanaceae plant includes tobacco and potato. The potato StU 64-1 promoter and the StU 68-1 promoter have transcriptional activity, can drive the expression of downstream sgRNA, realize the directional editing of Nicotiana benthamiana and potato genes driven by the potato endogenous U6 promoter, and can carry out single-site or multi-site gene editing on the targeted genes.
The sgRNA expression cassette vector is applied to the transgenic technology of solanaceae plants or the construction of gene editing vectors of the solanaceae plants. The Solanaceae plant includes tobacco and potato.
Has the advantages that:
the invention clones two new potato U6 promoters, constructs StU 64-1-sgRNA and StU 68-1-sgRNA expression cassette vectors used for potato gene editing, and constructs the NbPDS and potato StPDS gene editing vectors through the two vectors. The transient transformation of the Nicotiana benthamiana leaves and the stable transformation of the embryonic callus of the potato stem segments verify the activities of two U6 promoters and the feasibility of applying the two promoters to the CRISPR/Cas9 technology of the tobacco and the potato, realize the single-target-site and multi-target-site CRISPR/Cas9 gene editing of target genes of the potato and the tobacco, and further realize the efficient and purposeful genetic improvement and germplasm innovation of the potato or other solanaceae crops. In the gene editing operation, the StU 64-1 and StU 68-1 promoters can be used for driving expression of single target-sgRNA (as in example 3) and multiple target-sgrnas (as in example 4), respectively, i.e., single target site editing or multiple gene (multiple target sites) gene editing can be realized.
Description of the drawings:
FIG. 1: the StU 64-1 promoter and the StU 68-1 promoter cloned from the potato leaf genome.
FIG. 2: schematic diagrams of StU 64-1-sgRNA vectors and StU 68-1-sgRNA vectors constructed by a homologous recombination method.
FIG. 3: bsa I enzyme digestion identification of StU 64-1-sgRNA vector and StU 68-1-sgRNA vector.
FIG. 4: a vector schematic diagram for the NbPDS gene editing of the Nicotiana benthamiana is shown, and a nucleic acid sequence in the diagram is a gene editing target point of the NbPDS.
FIG. 5: sequencing peak diagrams and sequencing results of the editing sequence mutation of the NbPDS gene of Nicotiana benthamiana; sequencing results show that transformation of StU 64-1/NbPDS-Cas 9 and StU 68-1/NbPDS-Cas 9 vectors can cause the NbPDS gene sequence to generate base deletion mutation.
FIG. 6: vector schematic for potato StPDS gene editing, where T1 and T2 represent gene editing target sequences driven by two potato U6 promoters, respectively.
FIG. 7: sequencing peak map and sequencing result of the potato StPDS gene editing sequence mutation. Sequencing results show that after the StPDS-Cas9 vector is transferred into the embryonic callus of the potato stem segment, the sequence of the potato StPDS gene is changed, and base deletion or insertion mutation occurs in two gene editing target sites.
The specific implementation mode is as follows:
for further understanding of the present invention, the following description will be made for two potato U6 promoters and cloning and application thereof, in conjunction with the following examples, and the scope of the present invention is not limited by the following examples.
Example 1:
the method for obtaining two potato U6 gene promoters StU 64-1 and StU 68-1 comprises the following steps:
1. a typical U6 gene sequence in the potato is found by performing BlastN alignment in a potato genome database (http:// spuddb. uga. edu/dm _ v6_1_ download. sht-ml) by utilizing an Arabidopsis AtU6-1 gene sequence. The typical potato U6 gene sequence has only 3 SNP differences compared with the Arabidopsis AtU6-1 gene sequence, which indicates that the U6 gene sequence is relatively conserved between potato and Arabidopsis. The promoter sequence of the potato U6 gene and the promoter sequence of the Arabidopsis AtU6-1 gene both have two typical cis-acting elements, namely TATA box and USE motif. The StU 64-1 and StU 68-1 promoters were finally selected for cloning.
2. Primers were designed in the reference sequences of the StU 64-1 and StU 68-1 promoters for sequence cloning.
The following primers were designed for the StU 64-1 promoter clone:
StU6 4-1pF：GGGCTTCACTGTGAATTTAG；
StU6 4-1pR：CAAACACATATGTTGTTGTTGA；
the following specific primers were designed for the promoter StU 68-1:
StU6 8-1pF：AATTGACGGGTAGACATCA；
StU6 8-1pR：CAGACATATAGGTTAATGTTTTG；
3. using the above primers, PCR amplification was performed using the high fidelity enzyme PhantaR Max using genomic DNA from the leaves of the potato cultivar ` sweet potato No. 9 ` as a template. The PCR reaction volume was 25. mu.L. The PCR reaction program is 95 ℃ for 3 min; 30 cycles of 95 ℃ for 30s, 52 ℃ for 30s, 72 ℃ for 30s, then 72 ℃ for 5 min; the resulting PCR product was purified by agarose gel cutting (as shown in FIG. 1). And connecting the purified PCR fragment with a pEASYR-Blunt cloning vector, transferring the PCR fragment into Escherichia coli DH5 alpha, picking a monoclonal colony, and extracting plasmids in positive cloning bacterial liquid for sequencing analysis. Obtain 466 bp StU 64-1 gene promoter fragment shown in SEQ ID No. 1 and 511 bp StU 68-1 gene promoter fragment shown in SEQ ID No. 2.
Example 2:
the construction of potato StU 64-1-sgRNA and StU 68-1-sgRNA expression cassette vectors comprises the following specific steps:
1. the 466 bp StU 64-1 gene promoter fragment shown in SEQ ID No. 1 and the 511 bp StU 68-1 gene promoter fragment shown in SEQ ID No. 2 are taken as templates, and the following primers containing homologous arms are designed to respectively carry out PCR amplification on the StU 64-1 gene promoter and the StU 68-1 gene promoter:
StU6 4-1gF：GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG；
StU6 4-1gR：TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA；
StU6 8-1gF：GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA；
StU6 8-1gR：TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG；
2. PCR amplification was performed with the high fidelity enzyme PhantaR Max. The PCR reaction volume was 25. mu.L. The PCR reaction program is 95 ℃ for 3 min; 30 cycles of 95 ℃ for 30s, 52 ℃ for 30s, 72 ℃ for 30s, then 72 ℃ for 5 min; the PCR product was purified by agarose gel cutting.
3. The plasmid pYLsgRNA-AtU6-1 is used as a template, primers sgRNA-F and sgRNA-R are designed for PCR, a AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1 is deleted and the plasmid is linearized, and the primer sequences are as follows:
sgRNA-F：AGAGACCTCTGAAGATAACA；
sgRNA-R：TCCTTTGCTGCCGATTCCAC；
PCR amplification was performed with the high fidelity enzyme PhantaR Max. The PCR reaction volume was 50. mu.L. The PCR reaction program is 95 ℃ for 3 min; 95 ℃ 30s, 55 ℃ 30s, 72 ℃ 3: 30min, 30 cycles, then 5min at 72 ℃; and (3) carrying out agarose gel cutting purification on the obtained PCR product to obtain a linearized pYLsgRNA plasmid fragment.
4. The StU 64-1 promoter fragment and the StU 68-1 promoter fragment containing the homologous arm sequences obtained in the step 2 are respectively connected into the linearized pYLsgRNA plasmid obtained in the step 3 through a homologous recombination reaction. The homologous recombination reaction is carried out by using ExnasERI recombinase, the reaction volume is 20 mu L, the reaction system is 2 mu L of ExnasERI recombinase, 4 mu L of 5 XCE buffer, 2 mu L of linearized pYLsgRNA plasmid, 1 mu L of promoter fragment containing homology arm U6, and ddH2O11. mu.L. The homologous recombination reaction was performed at 37 ℃ for 40min and on ice for 2 min. Then 10 mul of homologous recombination products are transferred into escherichia coli DH5 alpha, and monoclonal colonies are picked up, and plasmids in positive clone bacterial liquid are extracted for sequencing analysis. Obtaining potato StU 64-1-sgRNA and StU 68-1-sgRNA expression cassette vectors.
5. The StU 64-1-sgRNA and StU 68-1-sgRNA expression cassette vectors constructed by homologous recombination should respectively contain 3 Bsa I enzyme cutting sites (as shown in figure 2), so the vector accuracy is identified by carrying out Bsa I enzyme cutting on the StU 64-1-sgRNA and StU 68-1-sgRNA expression cassette vectors. Through Bsa I single enzyme digestion reaction, both the StU 64-1-sgRNA and StU 68-1-sgRNA expression cassette vectors can be digested into 3 strips, which is consistent with theoretical expectation (as shown in figure 3), and the accuracy of the construction of the two potato U6 promoter expression cassette vectors is further illustrated.
Example 3:
the construction of the NbPDS gene editing vector and the NbPDS gene sequence mutation of the tobacco comprise the following specific steps:
1. NbPDS gene editing target site design and target joint preparation
Selecting TACGAGAACTGCAGTCCACG as a target site sequence according to the NbPDS gene sequence of the Nicotiana benthamiana, and designing a target joint primer pair according to the sequence:
the following primer pairs were designed for the target linked to the StU 64-1 promoter:
NbPDS-4-F：TTTGTACGAGAACTGCAGTCCACG；
NbPDS-4-R：AAACCGTGGACTGCAGTTCTCGTA；
the following primer pairs were designed for the target linked to the StU 68-1 promoter:
NbPDS-8-F：TCTGTACGAGAACTGCAGTCCACG；
NbPDS-8-R：AAACCGTGGACTGCAGTTCTCGTA；
the adapter primers were dissolved in 100. mu.M of the mother solution, and 1. mu.L of each of the pair primers was added to 98. mu.L of 0.5 XTE and mixed and diluted to 1. mu.M. And cooling at 90 ℃ for 30s at room temperature to finish annealing.
2. StU 64-1-sgRNA and StU 68-1-sgRNA plasmids 1 μ g each were digested with 10U Bsa I for 20min in 25 μ L reaction, and the digested product was stored at-20 ℃ under refrigeration.
3. Construction of NbPDS single-target gene editing vector
And (3) respectively connecting the target joint obtained in the step (1) with the plasmid digestion products of the StU 64-1-sgRNA and the StU 68-1-sgRNA obtained in the step (2) by using T4 DNA ligase to respectively obtain fragments of the StU 64-1 promoter-target-sgRNA and the StU 68-1 promoter-target-sgRNA. By using a 'edge cutting ligation' method (Ma et al., 2015), fragments of StU 64-1 promoter-target-sgRNA and StU 68-1 promoter-target-sgRNA are respectively ligated into a 35S-Cas9-Kana vector, and finally two single-target NbPDS gene editing vectors of StU 64-1/NbPDS-Cas 9 and StU 68-1/NbPDS-Cas 9 are obtained.
4. NbPDS gene editing vector for instantly converting Nicotiana benthamiana leaves
StU 64-1/NbPDS-Cas 9 and StU 68-1/NbPDS-Cas 9 gene editing vectors are respectively transferred into agrobacterium LBA4404 by a freeze-thaw method. Carrying out bacterium shaking on LBA4404 bacterial liquid containing StU 64-1/NbPDS-Cas 9 and StU 68-1/NbPDS-Cas 9 gene editing vectors, and adjusting the concentration of the bacterial liquid to OD by using a bacterial liquid injection buffer solution600=1.0, a syringe is used to suck a suitable amount of agrobacterium liquid, and the liquid is injected into the leaf from the lower epidermis of the ben. 5 days after injecting the Nicotiana benthamiana leaf, the NbPDS gene target sequence of the leaf injection part is subjected to sequencing analysis.
5. Sequencing analysis of NbPDS Gene target site sequences
The DNA of the tobacco leaf of Ben's is extracted by a CTAB method, and the following primers are used:
NbPDS-F：GGAAGTGGCTGAACGATAT；
NbPDS-R：TCACCATGCTAAACTACGC；
and carrying out PCR amplification on the NbPDS gene segment in the instantly transformed Nicotiana benthamiana leaf, and purifying a PCR product. The PCR product was Sanger sequenced with primer NbPDS-F, and if the sequencing result showed nested peaks near the target site, it was considered that the NbPDS gene target site had undergone gene editing (as shown in fig. 5). Connecting NbPDS gene segments with gene editing into a pEASYR-Blunt cloning vector, then transferring into escherichia coli DH5 alpha, selecting a monoclonal colony, and extracting plasmids in positive cloning bacterial liquid for sequencing analysis. Through alignment with a wild type NbPDS gene sequence, the specific mutation mode of the NbPDS target site in the leaves of the StU 64-1/NbPDS-Cas 9 and StU 68-1/NbPDS-Cas 9 gene editing vector is analyzed. As shown in FIG. 5, the transformation of the StU 64-1/NbPDS-Cas 9 and StU 68-1/NbPDS-Cas 9 gene editing vectors can cause the NbPDS gene target site to undergo gene editing, and the type of the gene editing is base deletion.
Example 4:
the method comprises the following steps of potato StPDS double-target gene editing vector construction and StPDS sequence mutation:
1. cloning of StPDS Gene sequences
The genomic DNA of the leaf of the potato variety 'sweet potato No. 9' is extracted by a CTAB method. Designing the following primers according to a reference sequence of a potato StPDS gene:
StPDS-F：ATGCCTCAAATTGGACTTGT；
StPDS-R：TATGAAACAGACCCTACCCC；
the primers are used, high fidelity enzyme PhantaR Max is applied, potato leaf DNA is used as a template, and PCR amplification is carried out in a 25 mu L system. The PCR reaction program is 95 ℃ for 3 min; 95 ℃ 30s, 54 ℃ 30s, 72 ℃ 1: 30min, 30 cycles, then 5min at 72 ℃; and detecting the PCR product by agarose gel electrophoresis and cutting and purifying. Sanger sequencing of the PCR products was performed using primers StPDS-seqF and StPDS-seqR, the primer sequences were as follows:
StPDS-seqF：GGCTTGCAAAATACTGTACT；
StPDS-seqR：GCTTCCTTCGAAATAAAGCA；
and finally obtaining StPDS gene sequence information.
2. StPDS gene editing target site design and target site joint preparation
From the StPDS gene sequence obtained in step 1, two gene editing target sites were selected, respectively the sequence T1 located in the first exon: CCATGCCACGACCAGAAGAT, sequence located in the third exon T2: AACCGATACTACTGGAGGCA are provided. Design target adapter primers based on T1 and T2 sequences:
the following primer pairs were designed for the T1 target linked to the StU 64-1 promoter:
StPDS-4-F：TTTGCCATGCCACGACCAGAAGAT；
StPDS-4-R：AAACATCTTCTGGTCGTGGCATGG；
the following primer pairs were designed for the T2 target linked to the StU 68-1 promoter:
StPDS-8-F：TCTGAACCGATACTACTGGAGGCA；
StPDS-8-R：AAACTGCCTCCAGTAGTATCGGTT；
the adapter primers were dissolved in 100. mu.M of the mother solution, and 1. mu.L of each of the pair primers was added to 98. mu.L of 0.5 XTE and mixed and diluted to 1. mu.M. And cooling at 90 ℃ for 30s at room temperature to finish annealing.
3. StU 64-1-sgRNA and StU 68-1-sgRNA plasmids 1 μ g each were digested with 10U Bsa I for 20min in 25 μ L reaction, and the digested product was stored at-20 ℃ under refrigeration.
4. Potato StPDS double-target gene editing vector construction
And (3) respectively connecting the target joint obtained in the step (2) with the plasmid digestion products of the StU 64-1-sgRNA and the StU 68-1-sgRNA obtained in the step (3) by using T4 DNA ligase to respectively obtain fragments of the StU 64-1 promoter-target T1-sgRNA and the StU 68-1 promoter-target T2-sgRNA. By using a 'edge cutting ligation' method (Ma et al, 2015), fragments of StU 64-1 promoter-target point T1-sgRNA and StU 68-1 promoter-target point T2-sgRNA are sequentially ligated into a 35S-Cas9-Kana vector, and finally, a StPDS-Cas9 double-target gene editing vector is obtained, wherein the T1 target point-sgRNA is driven by a StU 64-1 promoter, and the T2-target point-sgRNA is driven by a StU 68-1 promoter (as shown in FIG. 6).
5. Stable callus transformation of potato stem
The StPDS-Cas9 double-target gene editing vector is transferred into Agrobacterium LBA4404 by a freeze-thaw method. Shaking the LBA4404 bacterial liquid containing the StPDS-Cas9 carrier, and suspending the bacterial liquid to the bacterial liquid concentration OD by using an MS liquid culture medium600= 0.5. And (3) taking the stem section of the potato variety D187 tissue culture seedling as an explant, and carrying out agrobacterium infection. The stem explants were co-cultured for 2d, cultured for about 30d on Kana-containing resistant callus induction medium, and cultured for about 30d on Kana-containing cluster shoot induction medium. Embryogenic resistant callus at differentiation stage was finally obtained.
6. Sequencing analysis of StPDS Gene target site sequence
Extracting embryonic resistant callus DNA of potato stem segments by using a CTAB method, carrying out PCR amplification by using StPDS-F and StPDS-R primers, and purifying a PCR product. StPDS target sites T1 and T2 were subjected to Sanger sequencing using primers StPDS-seqF and StPDS-seqR, respectively, and when a nested peak was shown near the target site as a result of sequencing, it was considered that StPDS gene target site had undergone gene editing (as shown in FIG. 7). And connecting the StPDS gene segment with gene editing into a pEASYR-Blunt cloning vector, transferring into escherichia coli DH5 alpha, selecting a monoclonal colony, and extracting plasmids in positive cloning bacterial liquid for Sanger sequencing analysis. The specific mutation mode of the StPDS target site in the injury of resistance of the transformation StPDS-Cas9 gene editing vector is analyzed through the alignment with the wild StPDS gene sequence. As shown in FIG. 7, transformation of StPDS-Cas9 gene editing vector can cause gene editing of two target sites of StPDS gene T1 and T2 in potato resistant callus, and the type of gene editing is base deletion or base insertion.
Therefore, the potato StU 64-1 promoter and the StU 68-1 promoter obtained by the invention have transcriptional activity, can drive downstream sgRNA to express, realize the directional editing of the tobacco benthamiana and potato genes driven by the endogenous U6 promoter of the potato, and can carry out single-site or multi-site gene editing on the targeted genes; after gene editing, sequencing the clone sequence of the target site to find the mutation types including base insertion and base deletion. Therefore, the two potato endogenous U6 promoters can be applied to potatoes and a CRISPR/Cas9 gene editing system of tobacco, so that efficient and accurate trait genetic improvement of solanaceous crops such as tobacco and potatoes is realized.
The foregoing is merely a preferred embodiment of the invention, which is described in some detail and with some particularity and detail, and is not therefore to be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make several modifications without departing from the principle of the present invention, and these modifications should be construed as the protection scope of the present invention.
SEQUENCE LISTING
<110> Yunnan university of agriculture
<120> potato U6 RNA polymerase III type promoter, and cloning and application thereof
<130> 2021-09-24
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 466
<212> DNA
<213> Solanum tuberosum
<400> 1
agttgcaggt agcatggcca atttgaaaaa acgagaaatg aacagtagat ataactcatc 60
aatagcagta ctctactcct attataaatt gcttttatta tgactgacta aattactcat 120
tttcgtgcta ccatataggc atatcaatta atttctgctc atccttaata aaaataagtg 180
acggccagta ggtaacttct taaaacctcc ttatgataat gattatttta gttgtgggca 240
taaggatatt agtttcgaaa taaaatgtaa aattattatt ttcggtttga ttatgaaaat 300
caatgcatag gatatgccta acttttcaaa ttgcaaaaat caaaccaaat aagaaggccc 360
ggcccattat gtttataagt ccaggcccat acgttatttc tccctcatcg tctgcagaga 420
gaagctttgc tgtgtttata taactcaaca acaacatatg tgtttg 466
<210> 2
<211> 511
<212> DNA
<213> Solanum tuberosum
<400> 2
cgaaagagaa aaaatacact atggacgaat atttttatag aattcaatat gtaaaactaa 60
taaacaagaa cttttattca aagtaatgaa gaagaagaat tgaagaaata tttacataat 120
caataaaaaa aaatcattca aaagaatcgt gtgtatgaga aagaagagaa aaaaactact 180
tcccaataaa aaaggacatc atgctgccac ctcctaaaat tatgtaattt aatttttaaa 240
aaaacttccc aatacgtggg ctactatttg caaaatttaa tttttaaaaa cctttttttg 300
tcaagaaaat aaaagatggc tatttgttgc caattagtaa aatgagatgt catgctgtgc 360
cattttttca aaatataaat accagcccat tacagttaat gggctttgct caggcccata 420
ccagcgaaaa cacccaagct agttctccct catcgtctgc agaaagcttc tttgttgtgt 480
ttataaagca aaacattaac ctatatgtct g 511
Claims (8)
1. A potato U6 promoter sequence characterized in that: the potato U6 promoter sequence is StU 64-1 or StU 68-1; the StU 64-1 promoter contains a DNA nucleotide sequence shown in SEQ ID No. 1; the StU 68-1 promoter has the DNA nucleotide sequence shown in SEQ ID No. 2.
2. The potato U6 promoter sequence of claim 1, wherein: the StU 64-1 promoter sequence is derived from the 4 th chromosome of potato, and the StU 68-1 promoter sequence is derived from the 8 th chromosome of potato.
3. The sgRNA expression cassette vector for constructing the potato gene editing vector is characterized in that: comprising the potato U6 promoter StU 64-1 or/and StU 68-1 of claim 1 or 2.
4. The sgRNA expression cassette vector of claim 3, wherein: the sgRNA expression cassette vector is recombinant plasmid StU 64-1-sgRNA and/or StU 68-1-sgRNA.
5. A primer specific for cloning the potato U6 promoter of claim 1 or 2, wherein:
specific primers of the promoter StU 64-1 are as follows:
StU6 4-1pF：GGGCTTCACTGTGAATTTAG；
StU6 4-1pR：CAAACACATATGTTGTTGTTGA；
specific primers of the promoter StU 68-1 are as follows:
StU6 8-1pF：AATTGACGGGTAGACATCA；
StU6 8-1pR：CAGACATATAGGTTAATGTTTTG；
a method for constructing the sgRNA expression cassette vector of claim 3 or 4 for potato gene editing vector, comprising the steps of:
(1) the StU 64-1 gene promoter sequence shown in SEQ ID No. 1 or the StU 68-1 gene promoter sequence shown in SEQ ID No. 2 is taken as a template, and the following primers containing homologous arms are used for carrying out PCR amplification on the StU 64-1 gene promoter or the StU 68-1 gene promoter:
StU6 4-1gF：GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG；
StU6 4-1gR：TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA；
StU6 8-1gF：GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA；
StU6 8-1gR：TGTTATCTTCAGAGGTCTCTCAGACATATAGGTTAATGTTTTG；
purifying the PCR product to obtain a StU 64-1 gene promoter fragment containing a homology arm and a StU 68-1 gene promoter fragment containing the homology arm;
(2) the plasmid pYLsgRNA-AtU6-1 is used as a template, primers sgRNA-F and sgRNA-R are used for PCR, the AtU6-1 gene promoter in the plasmid pYLsgRNA-AtU6-1 is deleted and the plasmid is linearized, and the primer sequences are as follows:
sgRNA-F：AGAGACCTCTGAAGATAACA；
sgRNA-R：TCCTTTGCTGCCGATTCCAC；
PCR amplification was performed in a 25. mu.L reaction system using the high fidelity enzyme PhantaR Max, and the PCR procedure was: 3min at 95 ℃; 95 ℃ 30s, 52 ℃ 30s, 72 ℃ 3: 30s, 30 cycles, then 5min at 72 ℃; purifying the obtained PCR product by agarose gel cutting to obtain a linearized pYLsgRNA plasmid;
(3) and (2) recombining the StU 64-1 gene promoter fragment containing the homologous arm and/or the StU 68-1 gene promoter fragment containing the homologous arm in the step (1) into the linearized pYLsgRNA plasmid in the step (2) by using ExnasRII recombinase to obtain a sgRNA expression cassette vector StU 64-1-sgRNA and/or StU 68-1-sgRNA used for the potato gene editing vector.
6. The use of the potato U6 promoter StU 64-1 and/or StU 68-1 of claim 1 or 2 in transgenic technology of Solanaceae plants or construction of gene editing vector of Solanaceae plants.
7. The use of the sgRNA expression cassette vector of claim 3 or 4 in solanaceae plant transgenic technology or in construction of solanaceae plant gene editing vectors.
8. Use according to claim 7 or 8, characterized in that: the Solanaceae plant includes tobacco and potato.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111390729.0A CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
| CN202310415113.7A CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111390729.0A CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310415113.7A Division CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113999850A true CN113999850A (en) | 2022-02-01 |
| CN113999850B CN113999850B (en) | 2023-06-23 |
Family
ID=79929881
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310415113.7A Pending CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
| CN202111390729.0A Active CN113999850B (en) | 2021-11-23 | 2021-11-23 | Potato U6 RNA polymerase III type promoter, cloning and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310415113.7A Pending CN117402874A (en) | 2021-11-23 | 2021-11-23 | Potato U6 gene promoter StU6 8-1 and cloning and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN117402874A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481259A (en) * | 2020-11-24 | 2021-03-12 | 南昌大学 | Cloning and application of two sweet potato U6 gene promoters IbU6 |
| CN114703189A (en) * | 2022-03-31 | 2022-07-05 | 东北林业大学 | Fraxinus mandshurica U6 gene promoter proFmU6.3, and cloning and application thereof |
| CN117844863A (en) * | 2024-03-06 | 2024-04-09 | 云南师范大学 | Potato mitochondria targeted expression vector, construction method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109312358A (en) * | 2016-05-03 | 2019-02-05 | 莱克拜斯塔奇公司 | Amylopectin-potato starch with improved anti-retrogradation stability and improved freeze-thaw stability |
-
2021
- 2021-11-23 CN CN202310415113.7A patent/CN117402874A/en active Pending
- 2021-11-23 CN CN202111390729.0A patent/CN113999850B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109312358A (en) * | 2016-05-03 | 2019-02-05 | 莱克拜斯塔奇公司 | Amylopectin-potato starch with improved anti-retrogradation stability and improved freeze-thaw stability |
Non-Patent Citations (4)
| Title |
|---|
| "S.tuberosum DNA for U6 small nuclear RNA promter region" * |
| F. GUERINEAU等: "The U6 small nuclear RNA gene family of potato" * |
| IDA ELISABETH JOHANSEN: "High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato" * |
| YUNQIAN HU等: "Cloning and characterisation of a U6 small nuclear RNA gene from potato" * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481259A (en) * | 2020-11-24 | 2021-03-12 | 南昌大学 | Cloning and application of two sweet potato U6 gene promoters IbU6 |
| CN112481259B (en) * | 2020-11-24 | 2022-09-16 | 南昌大学 | Cloning and application of two sweet potato U6 gene promoters IbU6 |
| CN114703189A (en) * | 2022-03-31 | 2022-07-05 | 东北林业大学 | Fraxinus mandshurica U6 gene promoter proFmU6.3, and cloning and application thereof |
| CN114703189B (en) * | 2022-03-31 | 2023-05-23 | 东北林业大学 | Fraxinus mandshurica U6 gene promoter proFMU6.3, cloning and application thereof |
| CN117844863A (en) * | 2024-03-06 | 2024-04-09 | 云南师范大学 | Potato mitochondria targeted expression vector, construction method and application |
| CN117844863B (en) * | 2024-03-06 | 2024-05-17 | 云南师范大学 | Potato mitochondria targeted expression vector, construction method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117402874A (en) | 2024-01-16 |
| CN113999850B (en) | 2023-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105063061B (en) | A kind of rice mass of 1000 kernel gene tgw6 mutant and the preparation method and application thereof | |
| CN113999850B (en) | Potato U6 RNA polymerase III type promoter, cloning and application thereof | |
| CN109097387B (en) | Method for creating purple tomato mutant by using CRISPR/Cas9 gene editing system and application | |
| CN112852813B (en) | Asparagus U6 gene promoter AspU6p3 and cloning and application thereof | |
| CN109705198B (en) | Application of OsCKX7 protein and coding gene thereof in regulation and control of resistance to plant sheath blight | |
| CN111187778B (en) | Wheat salt-tolerant gene TaFLZ2 and application thereof | |
| CN113265422B (en) | Method for targeted knocking out rice grain type regulatory gene SLG7, rice grain type regulatory gene SLG7 mutant and application thereof | |
| CN115927757A (en) | Method for efficiently screening antiviral germplasm resources based on PEMV-1 and PEMV-2 infectious clones | |
| CN113106120B (en) | Needle-leaved tree plant gene editing vector, construction method and application thereof | |
| CN116640770B (en) | Application of OsBRY1 gene in improving rice yield traits | |
| CN107988225B (en) | Corn grain development related gene miR169o and application thereof | |
| CN108165578B (en) | Efficient preparation method for mutant aiming at multiple members of same gene family of cabbage mustard simultaneously | |
| CN116410986A (en) | Gene involved in regulating and controlling plant height, fruit shape and yield of tomatoes and application thereof | |
| CN105175519B (en) | Applications of the Protein S RL2 in cultivating leaf roll Qushui River rice | |
| CN110923231B (en) | Method for preparing tomato material with high fruit solid content | |
| KR20230001450A (en) | Method for producing cabbage plant having late-flowering trait using CRISPR/Cas complex | |
| CN113215187A (en) | Method for rapidly obtaining fragrant rice material by using CRISPR/Cas9 technology | |
| CN108070598B (en) | Cotton root tip specific promoter and application thereof | |
| CN111909956A (en) | Method for improving drought resistance of rice by blocking or weakening gene expression of OsNAC092 of rice | |
| CN112481259B (en) | Cloning and application of two sweet potato U6 gene promoters IbU6 | |
| CN116004622B (en) | Promoter of cotton APR gene, acquisition method and application thereof, fusion vector, preparation method and application | |
| CN114703188B (en) | Fraxinus mandshurica U6 gene promoter proFMU6.6 and cloning and application thereof | |
| CN114181951B (en) | Corn sheath blight disease resistance related gene Zmbzip45 and application thereof | |
| CN111518181B (en) | Method for increasing rice yield and protein used by same | |
| CN107760679B (en) | Plant pistil specific promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |