KR20230001450A - Method for producing cabbage plant having late-flowering trait using CRISPR/Cas complex - Google Patents

Abstract

The present invention relates to a manufacturing method of flowering-delayed cabbage plants using a CRISPR/Cas complex targeting flowering control genes of cabbage.

Description

Manufacturing method of delayed flowering cabbage plants using CRISPR / Cas complex {Method for producing cabbage plant having late-flowering trait using CRISPR/Cas complex}

The present invention relates to a method for preparing a flowering-delayed cabbage corrector using a CRISPR/Cas complex.

Cabbage is an oleracea species among Brassica genus ( Gunus ) crops belonging to the Brassica family ( Cruciterae ), and its scientific name is Brassica oleracea L. var capitata L. The same oleracea species includes kale (var. acephala ), which uses buds, cauliflower (var. botrytis ), broccoli (var. italica ), and Brussels sprouts (var. gemmifera ), which use small axils. There are various variants such as The English names are called cabbage, white cabbage, etc., and the Chinese names are 捲心菜, 圓白菜, and 甘藍.

Cabbage is a thermophilic vegetable that likes a cool climate. It tolerates both high and low temperatures better than Chinese cabbage (scientific name: Brassica rapa ), so it can be grown in summer and stored outside during winter. Also, as a vegetable with high nutritional value, it is important for health and contains ingredients that have a good effect on stomach ulcers. Although it is a cold-sensitive vegetable like Chinese cabbage, it is not sensitive to low temperature when the hair is young, and it is a green plant vernal type that responds to low temperature only when the stem diameter of the hair is 5~6mm or more. Spring-sown varieties are sensitive to cold because they are not cold-resistant, so care must be taken in preparation for early sowing.

The CRISPR/Cas9 system has a very high target specificity and can recognize methylated DNA as a target, so it can be applied to a wide variety of genes, and it has the advantage of being passed on to offspring according to Mendel's genetic law and enabling generational fixation of traits. there is. In addition, since it requires only Cas9 protein and sgRNA (single guide RNA), it has the advantage of being able to introduce target traits at a lower cost than the above two methods, and is a new breeding technology that has recently been widely applied in animals and plants.

On the other hand, Korean Patent Publication No. 2016-0052350 discloses 'a radish-derived FLC gene that regulates the flowering period of a plant and its use', and Korean Patent No. 2113500 discloses 'late autumn traits by correcting the SOC1 gene. A method for producing an eggplant genome-corrected cabbage plant and a plant thereof' is disclosed, but the 'method for producing a flowering-delayed cabbage corrector using a CRISPR/Cas complex' of the present invention is not described.

The present invention has been derived from the above needs, and the present inventors intend to develop genome-edited cabbage by constructing a CRISPR/Cas9 vector targeting the flowering control gene of cabbage to delay flowering of cabbage plants.

In order to solve the above problems, the present invention is a recombinant DNA encoding a guide RNA specific to a target sequence of a flowering control gene of cabbage and a nucleic acid sequence encoding an endonuclease protein. Provided is a genome editing composition for delaying flowering of cabbage, containing a vector as an active ingredient.

In addition, the present invention (a) introduces a recombinant vector containing DNA encoding a guide RNA specific to the target sequence of the flowering control gene of cabbage and a nucleic acid sequence encoding an endonuclease protein into cabbage plant cells, correcting; and (b) regenerating cabbage plants from the genome-corrected cabbage plant cells.

In addition, the present invention provides a genome-corrected cabbage plant with delayed flowering prepared by the above method and a genome-corrected seed thereof.

The induction of mutations through editing of flowering control genes proposed in the present invention can be usefully used to develop plants with delayed flowering. In addition, since the method according to the present invention induces mutations that are indistinguishable from natural mutations, cost and time are saved, unlike GMO (Genetically Modified Organism) crops, which require enormous costs and time to evaluate safety and environmental hazards. Expect to be able to do it.

1 is a schematic diagram of the cloning process of cabbage-derived FLC gene.
Figure 2 shows the gene editing process of cabbage plants using the CRISPR / Cas9 system.
Figure 3 shows the Flowering Locus C ( FLC ) target sgRNA site determined using CRISPR RGEN Tools.
Figure 4 is a result of analyzing the mutation ratio of wild type (wild type), Cas9 protein transformant, RGEN transformants cabbage protoplasts using targeted deep sequencing targeting the GI ( GIGANTEA ) gene target site.

In order to achieve the object of the present invention, the present invention includes DNA encoding a guide RNA specific to the target sequence of the flowering control gene of cabbage and a nucleic acid sequence encoding an endonuclease protein. It provides a composition for genome correction for delaying flowering of cabbage, containing a recombinant vector as an active ingredient.

In the composition of the present invention, the flowering control gene may be FLC ( Flowing Locus C ) or GI ( GIGANTEA ), but is not limited thereto.

As used herein, the term "genome/gene editing" refers to a technology capable of introducing target-directed mutations into genomic sequences of animal and plant cells, including human cells, and includes one or more nucleic acid molecules by cutting DNA. Knock-out or knock-in of a specific gene by deletion, insertion, substitution, etc., or non-coding that does not produce a protein Coding refers to a technology that can introduce mutations into DNA sequences. For the purposes of the present invention, the genome editing may be to introduce mutations into plants using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and guide RNA. In addition, 'gene editing' may be used interchangeably with 'gene editing'.

In addition, the term "target gene" refers to some DNA in the genome of a plant to be corrected through the present invention, and is not limited to the type of gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be produced, depending on the purpose.

In addition, the term "guide RNA" refers to a short single-stranded RNA, which is specific for a target DNA among base sequences encoding a target gene, and binds to the target DNA base sequence in whole or in part complementarily. It means ribonucleic acid that serves to guide the endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain comprising a first region comprising a sequence complementary in whole or in part to a base sequence in a target gene and a second region comprising a sequence interacting with an endonuclease (particularly, an RNA-guided nuclease). Guide RNA (single guide RNA, sgRNA) form, but if the endonuclease can be active in the target sequence, it can be included in the scope of the present invention without limitation, and the type of endonuclease used together or endo It can be prepared and used according to known techniques in the art in consideration of the microorganism derived from the nuclease.

In addition, the guide RNA may be a guide RNA transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide duplex), or synthesized guide RNA, but is not limited thereto.

In addition, in the genome editing composition according to the present invention, the endonuclease protein is Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analogue thereof It may be one or more selected from the group consisting of, preferably an RNA-guided nuclease such as Cas9 or Cpf1, more preferably a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni , a Cas9 protein derived from Streptococcus thermophilus ( S. thermophilus ) or Streptococcus aureus ( S. aureus ) derived Cas9 protein, Neisseria meningitidis ( Neisseria meningitidis ) derived Cas9 protein, Pasteurella multocida ( Pasteurella multocida ) derived Cas9 protein, Francisella novicida ( Francisella novicida ) derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from known databases such as GenBank of National Center for Biotechnology Information (NCBI). For the Cas9 gene information, a known sequence may be used as it is or a sequence optimized for the codon of a target (organism) to be transduced may be used, but is not limited thereto.

The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must be present next to the target sequence, and the Cas9 protein has a PAM sequence (NGG) It is cut by estimating between the 3rd and 4th base pairs from .

In the composition for genome editing according to the present invention, the CRISPR/Cas9 system used introduces a double helix break at a specific position of a specific gene to be corrected to insert-deletion (insertion-deletion) caused by incomplete repair induced in the DNA repair process. , InDel) It is a gene editing method by NHEJ (non-homologous end joining) mechanism that induces mutations.

The present invention also

(a) introducing a recombinant vector containing DNA encoding a guide RNA specific to a target sequence of a cabbage flowering control gene and a nucleic acid sequence encoding an endonuclease protein into cabbage plant cells Correcting the dielectric by doing; and

(b) regenerating cabbage plants from the genome-corrected cabbage plant cells; providing a method for producing a genome-corrected cabbage plant with delayed flowering.

In the manufacturing method of the present invention, the flowering control gene may be FLC ( Flowering Locus C ) or GI ( GIGANTEA ), but is not limited thereto.

In addition, introducing a recombinant vector containing DNA encoding a guide RNA specific to the target sequence and a nucleic acid sequence encoding an endonuclease protein into plant cells refers to a transformation method. Transformation of plant species is now common for plant species including both dicotyledonous as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vectors according to the invention into suitable progenitor cells.

In the production method according to the present invention, the guide RNA may be capable of specifically binding to a multi-copy gene, but is not limited thereto.

In the production method according to the present invention, the method of transducing the complex of the guide RNA and endonuclease protein into plant cells is the calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72- 74; Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts (Shillito et al., 1985, Bio/Technol. 3:1099-1102), brown rice as plant element injection (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70) , infection by bacteria in Agrobacterium tumefaciens mediated gene transfer (incomplete), and the like.

In the production method according to one embodiment of the present invention, when the recombinant vector is transformed into a plant cell, it binds to an endonuclease protein having DNA binding and cutting activity and the endonuclease protein, and converts the endoplasmic recombinant vector into a target sequence. The sgRNA leading to the nuclease protein is also expressed.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide or a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell in its natural state, but the gene has been reintroduced into the cell by artificial means as a modified one.

Also, the term "vector" is used to refer to DNA fragment(s) or nucleic acid molecules that are delivered into cells. Vectors replicate DNA and can reproduce independently in host cells. The term “delivery vehicle” is often used interchangeably with “vector”. The term "expression vector" refers to a recombinant DNA molecule comprising a coding sequence of interest and appropriate nucleic acid sequences necessary to express the operably linked coding sequence in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

In the manufacturing method according to the present invention, the "plant cell" into which the target sequence-specific guide RNA and endonuclease protein are introduced can be any plant cell. A plant cell is a cultured cell, cultured tissue, cultured organ or whole plant. "Plant tissue" refers to differentiated or undifferentiated plant tissue, including, but not limited to, roots, stems, leaves, pollen, microspores, ovules, seeds, and various types of cells used in culture, i.e., single cells, Includes protoplast, shoot and callus tissues. Plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.

In the production method of the present invention, any method known in the art may be used as a method for regenerating genome-corrected plants from genome-corrected plant cells. The genome-corrected plant cell must regenerate into a whole plant. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vols. 1-5, 1983-1989 Momillan, N.Y.).

The present invention also provides a genome-corrected cabbage plant with delayed flowering prepared by the above method and a genome-corrected seed thereof.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

1. Cabbage FLC cloning of genes

In order to clone the cabbage FLC gene, cultured seedlings of cabbage variety 'Speed' (Jeil Seed, Korea) obtained by germinating seeds in vitro were grown for 10 days, and then young leaves were taken and DNA was extracted. PCR was performed by designing specific primer sets for each of the cabbage FLC1 , FLC3 , and FLC2/4 genes disclosed in NCBI with the extracted DNA, and then the amplified products were purified and sequenced (FIG. 1). To prepare primers, primers were prepared by referring to conserved regions of FLC1 ( CAJ77613 ), FLC2/4 (AAQ76275 ), and FLC3 ( CAJ77614 ) gene sequences (Table 1). The PCR amplification product was ligated into a TA cloning vector, reinserted into E. coli, cultured in LB medium, transferred to Kanamycin antibiotic solid medium, cultured overnight, colony PCR was performed, and 1.2% agarose gel was used. After confirming the band size of the target gene by electrophoresis, it was transferred to kanamycin antibiotic liquid medium and grown for 24 hours. Then, after extracting and purifying the plasmid DNA, we proceeded to secure the genetic sequence unique to the 'Speed' variety.

Primer information used for FLC gene cloning Target gene Sequence (5'→3') Amplicon size (bp) FLC1 F AGATCAAATTAGGGCGCAAAGC (SEQ ID NO: 15) 5400 R ATTCGCCGATTAAAGGTAAC (SEQ ID NO: 16) FLC3 F CACTTGAACCGAACCTCTGG (SEQ ID NO: 17) 5107 R ATTTCAGCCCCGTCTAAAGG (SEQ ID NO: 18) FLC2/4 F ACCGAACCGAACCTCAGGATC (SEQ ID NO: 19) 5634 R GTAGTTTTTACACACGGGGTC (SEQ ID NO: 20)

2. Guide RNA design and transformation for gene editing

Based on FLC and cabbage GI gene information of cabbage 'Speed', CRISPR RGEN Tools (http://rgenome.net/) was used to target exon regions to simultaneously target multi-copy FLC and GI genes, high Target sites of several different FLC and GI sgRNAs were determined by out-of-frame scoring.

After preparing pBAtC::FLC-sgRNA containing the designed sgRNA sequence, cabbage leaf explants were transformed using Agrobacterium (Fig. 2). Briefly, the pBAtC :: FLC-sgRNA was transformed into Agrobacterium tumefaciens GV3101 strain, incubated at 28 ° C. for 18 hours, and the transformed Agrobacterium strain was converted into LB medium It was transferred and cultured until the OD ₆₀₀ value was about 0.8 to 1. The Agrobacterium was then co-cultured with leaf explants of cabbage variety 'Speed' to transform cabbage. Thereafter, the leaf explants were transferred to a selection medium and cultured, and then shoot growth was induced in a shoot induction medium and then grown as transgenic plants.

3. Confirmation of gene correction of transgenic plants

After extracting genomic DNA from transgenic plants, the sgRNA target site was amplified by PCR, and the editing of the target gene was analyzed by sequencing analysis.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Method for producing cabbage plant having late-flowering trait using CRISPR/Cas complex <130> PN21188 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 1 gagaccgttg cgtcgtttgg agg 23 <210> 2 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 2 gacggatgcg tcacagagaa cgg 23 <210> 3 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 3 cttctcctcc ggtgataacc cgg 23 <210> 4 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 4 tatcgatcaa ggatcttgac cgg 23 <210> 5 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 5 acttgtgggaa agcaagcttg agg 23 <210> 6 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 6 ccatctggct agccaaaaca tgg 23 <210> 7 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 7 ctcctcgttg tctcagcctc tgg 23 <210> 8 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 8 cgccggcgat gacctggtca agg 23 <210> 9 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 9 cagtcagaag ctccgaagta tgg 23 <210> 10 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 10 gcttgtcgaa agtaagcttg tgg 23 <210> 11 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 11 ggagacaacg agaagcgcga tgg 23 <210> 12 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 12 cctgaccagg ttatcaccgg cgg 23 <210> 13 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 13 cagtcaaaag ctctgagcta tgg 23 <210> 14 <211> 23 <212> DNA <213> artificial sequence <220> <223> sgRNA target sequence <400> 14 ttatagagagag agcattctca agg 23 <210> 15 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 15 agatcaaatt agggcgcaaa gc 22 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 16 attcgccgat taaaggtaac 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 17 cacttgaacc gaacctctgg 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 18 atttcagccc cgtctaaagg 20 <210> 19 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 19 accgaaccga acctcaggat c 21 <210> 20 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 20 gtagttttta cacacggggt c 21

Claims (7)

Cabbage containing, as an active ingredient, a recombinant vector containing DNA encoding a guide RNA specific to the target sequence of the flowering control gene of cabbage and a nucleic acid sequence encoding an endonuclease protein. A composition for genome correction for delaying flowering. The composition for genome editing according to claim 1, wherein the flowering control gene is FLC ( Flowering Locus C ) or GI ( GIGANTEA ). (a) introducing a recombinant vector containing DNA encoding a guide RNA specific to a target sequence of a cabbage flowering control gene and a nucleic acid sequence encoding an endonuclease protein into cabbage plant cells Correcting the dielectric by doing; and
(b) regenerating cabbage plants from the genome-corrected cabbage plant cells; a method for producing a genome-corrected cabbage plant with delayed flowering. The method according to claim 3, wherein the flowering control gene is FLC ( Flowering Locus C ) or GI ( GIGANTEA ). The method according to claim 3, wherein the guide RNA is capable of specifically binding to a multi-copy gene. A genome corrected cabbage plant with delayed flowering prepared by the method of any one of claims 3 to 5. The genome of the cabbage plant according to claim 6 is corrected.

Images