KR20220055904A - Method for producing OsSLR1 gene mutant rice plant using CRISPR/Cas9 system and rice plant having dwarf phenotype produced by the same method - Google Patents

Abstract

The present invention relates to a composition for genome correction for inducing dwarf in rice plants and a use thereof. According to the present invention, the composition comprises: a complex (ribonucleoprotein) of a guide RNA specific to a target sequence of a rice-derived OsSLR1 (Oryza sativa slender rice 1) gene and endonuclease protein; or a recombinant vector including DNA encoding the guide RNA specific to the target sequence of the rice-derived OsSLR1 gene and a nucleic acid sequence encoding the endonuclease protein.

Description

Method for producing OsSLR1 gene mutant rice plant using CRISPR/Cas9 system and rice plant having dwarf phenotype produced by the method same method}

The present invention relates to a method for producing an OsSLR1 ( Oryza sativa slender rice 1) gene mutant rice plant using a CRISPR/Cas9 system, and to a rice plant having a dwarf phenotype produced by the method.

Rice, one of the main food crops consumed by about half of the world's population, is grown on about 4.5 million hectares annually. Rice breeders refer to the size and weight of a plant as load, and the greater the load, the more it will fall. Characteristics of many dwarf mutants found in plants to date are genes for the biosynthesis and signaling pathways of gibberellin (GA), indole-3-acetic acid (IAA), brassinolide and other hormones. was related to GA is a group of diterpenoid compounds involved in various growth and development processes in higher plants, including stem elongation, germination, dormancy, flowering, flower development, leaf and fruit aging, and is one of the important plant hormones. The phenotype of mutants deficient in GA biosynthesis or signaling usually shows dark green and rough leaves in rice. To date, several genes associated with defective mutations in the GA biosynthetic pathway, namely d18 , d35 , sd1 and eui , have been isolated and studied in rice. Molecular genetic studies of GA-sensitive rice and Arabidopsis mutants have identified important factors for GA signaling, which appear to be well conserved among flowering plants. The most important regulator of the GA signaling pathway is the DELLA protein, known as a GA action inhibitor. The transcription factor DELLA protein belongs to the GRAS (GAI, RGA, SCR) family and contains an N-terminal DELLA/TVHYNP motif and a C-terminal GRAS domain. is known to do In addition, genes encoding the GA receptor GA-INSENSITIVE DWARF1 (GID1), the F-box protein GA-INSENSITIVE DWARF2 (GID2) and the DELLA protein have been cloned and the integrated GA signaling pathway is known. In addition, it has been reported that DELLA family proteins regulate plant cell and organ size by interacting with growth-related transcription factors such as phytochrome interaction factor (PIF). In general, the GID1-GA-DELLA complex in plant cells recognizes GA by its receptor, but in rice, the F-box protein of GID2 additionally interacts with the DELLA protein, resulting in polyubiquitination by E3 ubiquitin-ligase, followed by 26S proteolysis. It is broken down via the teasome. In rice, internode elongation is known to be promoted by GA signaling through GID1 and DELLA proteins. Evidence accumulated to date has highlighted the N-terminus of DELLA, which is required for inhibition of GA action. In rice, slr1-d1, -d2, -d3, -d4, -d5 and -d6 mutations in the N-terminal region of the GA signaling inhibitor DELLA protein resulted in a semi-dwarf phenotype (Fitopatol. Bras. (2005)). 30:457-469), this mutant is known to have an amino acid modified by a 1 bp substitution in the conserved DELLA/TVHYNP domain of the DELLA protein.

On the other hand, Korean Patent Application Laid-Open No. 2004-0019016 discloses ' sd1 gene involved in semi-dwarfization of plants and their use', and Korean Patent Publication No. 2015-0120784 discloses ' Dh gene exhibiting dwarf phenotype and uses thereof'. is disclosed, but there is no description of a method for producing an OsSLR1 gene mutant rice plant using the CRISPR/Cas9 system of the present invention and a rice plant having a dwarf phenotype produced by the method.

The present invention was derived from the above needs, and the present inventors induced mutations using the CRISPR/Cas9 system targeting the TVHYNP domain of the OsSLR1 gene known as DELLA protein, and a total of 6 isoforms with new allelic mutations The present invention was completed by confirming that zygote editing plants, ie, slr1-d7, slr1-d8, slr1-d9, slr1-d10, slr1-d11 and slr1-d12, exhibit a dwarf phenotype.

In order to solve the above problems, the present invention provides a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsSLR1 ( Oryza sativa slender rice 1) gene (ribonucleoprotein); Or a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein and DNA encoding a guide RNA specific for the target nucleotide sequence of the rice-derived OsSLR1 gene; A composition for genome editing is provided.

In addition, the present invention comprises the steps of (a) correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsSLR1 gene into rice plant cells; And (b) re-differentiating the rice plant from the genome-corrected rice plant cells; provides a method for producing a dwarf-induced genome-corrected rice plant comprising a.

In addition, the present invention provides a dwarf-induced genome-corrected rice plant produced by the above method.

Induction and fixation of mutations, and MAS selection by crossbreeding takes a relatively long time, but the application of the CRISPR system has the advantage of inducing mutations in the desired site in a shorter time to secure mutants. In addition, the anti-dominant dwarf mutant allele according to the present invention may be usefully utilized in breeding for the development of new varieties.

Figure 1A shows the sgRNA target site for OsSLR1 gene editing, 1B and 1C are targeted deep sequencing of genome editing plants. The base sequence and amino acid sequence of each mutant plant according to the analysis result are shown.
2 is a schematic diagram of the CRISPR/Cas9 binary vector used in the present invention (A), a gel electrophoresis photograph of a PCR product performed for sequencing analysis of each vector containing a candidate sgRNA (B), and transfection with the candidate sgRNA, respectively. A gel electrophoresis photograph (C) of a PCR product performed on a nucleic acid sample of a converted plant is shown.
Figure 3 confirms the mutation efficiency of sgRNA using the T7-endonuclease I enzyme, WT is a target site DNA fragment, sg1 to sg5 are a mixture of sgRNA1 to sgRNA5 and Cas9, respectively, and a product obtained by reacting the target site DNA fragment with the target site DNA fragment. That is, - means that the target site is not edited, and + means that the target site is edited.
4 is a sequencing result (A) and a phenotypic result (B) of an OsSLR1 gene mutant plant (T ₀ ) induced using the CRISPR/Cas9 system.
Figure 5A is the result of confirming the phenotype of the wild-type (WT, Dongjin) and the mutant (slr1-d7, -d8), 5B is a scanning electron microscopy (SEM) image of the pores, 5C is the mature stage (mature) of the wild-type and the mutant stage) is an image showing the longitudinal section of the main diameter (bar=100 μm), 5D is the result of measuring the internode length, and 5E is the second leaf of each plant after treatment with different concentrations of gibberellin (GA ₃ ). It is a graph measuring the length of sheath).
6 is an analysis of changes in gene expression levels in OsSLR1 mutants (slr1-d7, -d8) and wild-type plants (WT).
Figure 7 shows the appearance of the spike (panicle) and leaves of the wild-type and mutant (slr1-d7, -d8).

In order to achieve the object of the present invention, the present invention provides a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsSLR1 ( Oryza sativa slender rice 1) gene (ribonucleoprotein) ; Or a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein and DNA encoding a guide RNA specific for the target nucleotide sequence of the rice-derived OsSLR1 gene; A composition for genome editing is provided.

The term "genome/gene editing" is a technology that can introduce target-directed mutations into the genome sequence of animal and plant cells, including human cells, and is a technique for deleting one or more nucleic acid molecules by DNA cleavage. Deletion), insertion (insertion), substitution (substitutions), etc. knock-out (knock-out) or knock-in (knock-in) a specific gene, or non-coding DNA that does not produce a protein It refers to a technology that can introduce mutations into sequences as well. For the purpose of the present invention, the genome editing may be to introduce a mutation into a plant using an endonuclease, such as a Cas9 (CRISPR associated protein 9) protein and a guide RNA. Also, 'gene editing' may be used interchangeably with 'gene editing'.

The term "target gene" refers to some DNA in the genome of a plant to be corrected through the present invention, is not limited to the type of the gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome-corrected plant to be prepared, depending on the purpose.

The term “guide RNA” refers to an RNA specific for DNA encoding a nucleotide sequence of a target gene, and all or part of the target DNA nucleotide sequence and all or part of the nucleotide sequence are complementarily bound to form endonuclease with the target DNA nucleotide sequence. It refers to ribonucleic acid that plays a role in guiding the first protein. The guide RNA may be a dual RNA comprising two RNAs, ie, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA); Or it refers to a single-chain guide RNA (sgRNA) form comprising a first site comprising a sequence that is completely or partially complementary to a nucleotide sequence in a target gene and a second site comprising a sequence that interacts with RNA-guided nucleases. , the RNA-guided nuclease may be included in the scope of the present invention without limitation as long as it has a form capable of having activity in the target nucleotide sequence, taking into account the type of endonuclease used together or the microorganism derived from the endonuclease, etc. It can be appropriately selected according to a technique known in the art.

In addition, the guide RNA may be transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide double-stranded), or synthesized guide RNA, but is not limited thereto.

In the composition for genome editing according to the present invention, the guide RNA is specifically designed for the target nucleotide sequence of the rice-derived OsSLR1 gene, and the target nucleotide sequence of the OsSLR1 gene preferably consists of the nucleotide sequence of SEQ ID NO: 2 However, the present invention is not limited thereto. The nucleotide sequence of SEQ ID NO: 2 is a sequence of the TVHYNP motif region located at the N-terminus of the rice-derived OsSLR1 gene consisting of the nucleotide sequence of SEQ ID NO: 1.

In addition, in the composition for genome editing according to the present invention, the endonuclease protein is Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or its It may be one or more selected from the group consisting of functional analogs, and may preferably be a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni , S. thermophilus or Streptococcus aureus ( S. aureus )-derived Cas9 protein, Neisseria meningitidis -derived Cas9 protein, Pasteurella multocida -derived Cas9 protein, Francisella novicida ) derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI).

Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence of three bases known as PAM (Protospacer Adjacent Motif) must exist next to the target sequence, and the Cas9 protein has a PAM sequence (NGG). cleavage by inferring between the 3rd and 4th base pairs from

In the composition for genome editing according to the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).

The present invention also provides (a) a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsSLR1 ( Oryza sativa slender rice 1) gene into rice plant cells to generate the genome. correcting; And (b) re-differentiating the rice plant from the genome-corrected rice plant cells; provides a method for producing a dwarf-induced genome-corrected rice plant comprising a.

In the preparation method according to an embodiment of the present invention, the guide RNA and endonuclease protein specific for the target nucleotide sequence of the rice-derived OsSLR1 gene are the same as described above.

The CRISPR/Cas9 system used in the present invention introduces a double helix break at a specific position of a specific gene to be corrected, and NHEJ induces an insertion-deletion (InDel) mutation due to incomplete repair induced in the DNA repair process. (non-homologous end joining) It is a gene editing method based on the mechanism.

In the production method according to the present invention, the introduction of the guide RNA and the endonuclease protein in step (a) into the rice plant cells comprises a guide RNA and an endonuclease specific to the target nucleotide sequence of the rice-derived OsSLR1 gene. ribonucleoprotein; Alternatively, a recombinant vector comprising DNA encoding a guide RNA specific for the target nucleotide sequence of the rice-derived OsSLR1 gene and a nucleic acid sequence encoding an endonuclease protein; may be used, but is not limited thereto.

In the production method according to the present invention, the method of transducing the complex of the guide RNA and the endonuclease protein into plant cells is a calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72- 74; Injection (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70) , Agrobacterium tumefaciens ) In mediated gene transfer (incomplete) infection by a virus (EP 0 301 316) and the like.

In addition, introducing a recombinant vector comprising a DNA encoding a guide RNA specific for the target nucleotide sequence and a nucleic acid sequence encoding an endonuclease protein into a plant cell means a transformation method. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the recombinant vector according to the invention into suitable progenitor cells.

In the production method according to the present invention, the "plant cell" into which the guide RNA and endonuclease protein specific for the target nucleotide sequence are introduced may be any plant cell. Plant cells are cultured cells, cultured tissues, cultured organs or whole plants. "Plant tissue" refers to a tissue of a differentiated or undifferentiated plant, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie, single cells, protoplasts. (protoplast), shoots and callus tissues. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture state.

In the production method of the present invention, any method known in the art may be used as a method of redifferentiating a plant having a corrected genome from a plant cell having a corrected genome. Plant cells whose genome has been corrected must be redifferentiated into whole plants. Techniques for the redifferentiation of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).

In addition, the present invention provides a dwarf-induced genome-corrected rice plant produced by the above method.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

plant material

The rice variety Dongjin ( Oryza sativar L., ssp. Japonica) was used for transformation experiments. The plant was grown in the GMO greenhouse facility and paddy field of Hankyong University, and the harvested seeds were dried to a moisture content of ~14%, and then stored in a dry state at 4°C.

CRISPR/Cas9 vector construction and rice transformation

The sgRNA targeting the TVHYNP motif was designed according to the method described by Park et al. (Bioinformatics 2015, 31, 4014-4016). A target sequence including the TVHYNPSD amino acid coding sequence of the OsSLR1 gene and TGG, which is the PAM sequence, was selected.

sgRNA for editing rice OsSLR1 gene RGEN target (5'→3')
(SEQ ID NO:) direction GC content
(%, w/o PAM) Out-of frame score Mismatches 0 One 2 3 sgRNA1 ACCCCTCGGACCTCTCCTCCTGG (2) + 70.0 49.8 One 0 0 0 sgRNA2 TGGACGAGGTGGAAGCATGGCGG (3) - 60.0 72.3 One 0 0 0 sgRNA3 TGGACGAGGTGGAAGCATGGCGG (4) - 60.0 72.3 One 0 0 0 sgRNA4 TGGTTGACACGCAGGAGGCTGGG (5) + 60.0 67.0 One 0 0 0 sgRNA5 GCATCAAGCAGGGGATGCAATGG (6) + 55.0 68.8 One 0 0 0

A 20nt sgRNA scaffold sequence was synthesized by Bioneer (Daejeon, Korea). The slr-sgRNA template was annealed using two primers, 5'-ggcagACCCCTCGGACCTCTCCTCC-3' (SEQ ID NO: 7) and 5'-aaacGGAGGAGAGGTCCGAGGGGTc-3' (SEQ ID NO: 8), and OsU3:pBOsC binary digested with Aar I restriction enzymes. It was cloned into a vector. Ti-plasmid vector for sgRNA expression, OsU3:slr1-sgRNA/pBOsC and flanking sequence were confirmed by Sanger sequencing method and introduced into Agrobacterium tumefaciens EHA105 strain. Plant transformation was performed according to the previously described protocol (Bioinformatics (2017) 33:286-288). In order to identify T-DNA, nucleic acids were isolated from the redifferentiated individuals and PCR analysis was performed. Redifferentiated individuals with developed roots were planted in pots and gradually acclimatized in a glass greenhouse.

Targeted Deep Sequencing and Mutation Analysis

Genomic DNA was extracted from plant tissues using the DNA Quick Plant Kit (Inclone, Korea). Targeted deep sequencing analysis was performed as described by Park et al. (Bioinformatics (2015) 31:4014 -4016). Paired-end read sequencing of PCR amplicons was performed using MiniSeq (Illumina, San Diego, CA, USA). All data derived from MiniSeq were analyzed by Cas-Analyzer (http://www.rgenome.net/cas-analyzer).

RNA-Seq and results analysis

RNA wild-type (WT), slr1-d7 (T/T) and slr1-d8 (-3/-3 bp) plants to examine transcripts of the edited lineages obtained by editing the OsSLR1 gene via the CRISPR/Cas9 system. -seq was used for analysis. For RNA extraction, leaf tissues of 4-week-old plants were used. RNA concentrations (A260/A280 and A260/A230) were measured with a spectrophotometer (Nanodrop 2000, Thermo Scientific, Hudson, NH, USA). A Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to evaluate RNA quality. RNA-sequencing was performed at Macrogen (Korea). Unambiguous reading results were generated by removal of low-quality reads and were placed on the reference genome (https://plants.ensembl.org/) using TopHat2 (https://ccb.jhu.edu/software/tophat). mapped. Based on the location information of the mapped reads, the expression level of the gene was normalized to reads per kilobase per million mapped reads. Differentially expressed genes (DEG) analysis among RNAs of edited plants (slr1-d7, slr1-d8) was performed using standard fold change (FC) ≥ 2 and FDR (false discovery rate) <0.05. Gene ontology (GO) analysis was performed as previously reported by Chow et al. (J. Exp. Bot. (2007) 58:2429-2440).

Verification experiment of selected DEGs

To verify the accuracy of RNA-seq data, qRT-PCR was performed on selected 21 genes. The slr1-d7 and slr1-d8 lines were assessed according to WT and relative gene expression levels were normalized by the Actin gene (XM_015761709). All analyzes for each gene were performed in triplicate and RNA-seq data were stored in the NCBI database.

GA ₃ process

Potted slr1-d7, slr1-d8 and WT seedlings were treated with 50 μM GA ₃ (Sigma-Aldrich, Seoul, Korea) for 4 weeks. A stock solution of GA ₃ was dissolved in ethanol, and after sterilization, water cooled to about 60° C. was added to make a final 50 μM solution. WT was treated with water containing the same amount of ethanol.

Light Microscopy

Paraffin sections were prepared by harvesting stems and leaves from slr1-d7, slr1-d8 and WT plants. First, the tissue of the plant was treated with 15% hydrofluoric acid, and then dehydrated, removed, penetrated and embedded with 70% ethanol. For imaging, 10 μm microtome sections were placed on glass slides and floated in a 37°C water bath containing deionized water. Sections were floated on clean glass slides and microwaved at 65° C. for 15 minutes, after which the tissues were bound to the glass and each slide was immediately used for chemical staining.

Example 1. Using the CRISPR/Cas9 system OSSLR1 Editing the TVHYNP domain of a gene

To analyze the mutation efficiency of five candidate sgRNAs targeting the TVHYNP domain of the OsSLR1 gene, T7E1 analysis was performed using protoplast cells isolated from leaves of 10-day-old rice plants. The T7E1 assay was performed in the same manner as previously reported by Jung et al. (Plant Biotechnol. Rep. 2019, 13:511-520). As a result, it was confirmed that sgRNA2 was not mutated at the target site as shown in FIG. 3 .

The present inventors transformed a plant using a binary vector containing sgRNA1 or a binary vector containing sgRNA3, and confirmed whether or not gene editing was performed in the transformant T ₀ plant. As a result, a total of 16 mutants were identified in the transformant using sgRNA1 as shown in Table 2 below. On the other hand, no gene-edited plants were identified in the transformant using sgRNA3, 3 gene-edited plants were identified in the transformant using sgRNA4, and 1 gene-edited plant was identified in the transformant using sgRNA5. It was confirmed that the gene editing efficiency of sgRNA1 was the best.

Mutation rate according to sgRNA and type of gene-edited plant Targeted region No. of Transgenic plants No. of edited plants Mutation rate (%) Genotype Homo Hetero Bi-allelic sgRNA1 31 16 48.4 6/16 2/16 8/16 sgRNA3 19 0 0.0 - - - sgRNA4 36 3 8.3 0/3 2/3 1/3 sgRNA5 24 One 4.2 0/1 1/1 0/1

In addition, 6 homozygous mutations, 2 heterozygous mutations and 8 biallelic mutations were detected through targeted deep sequencing of the 16 mutants. All T ₀ mutants exhibited a dwarf phenotype ( FIG. 4 ) and produced many farrows. Four of the six homozygous mutants were characterized by a few base deletions and two by a few base insertions ( FIG. 1B ): a 3bp deletion mutant designated slr1-d7, 1 designated slr1-d8. -bp deletion mutant, 5bp deletion mutant, designated slr1-d9, 14bp deletion mutant, designated slr1-d10, "T" insertion mutant, designated slr1-d11 and "C" designated slr1-d12 insertion mutants. Theoretically, the slr-d7 mutation encodes a protein lacking serine (Ser, S), and the slr1-d8 to slr1-d12 mutations were identified as knockout mutations with an early stop codon that could not encode the protein (Fig. 1C). Single base deletions and insertions were expected to induce frame-shifts, resulting in knockout of the OsSLR1 gene. However, it was confirmed that all mutations did not affect the TVHYNP motif, which is the core sequence of the OsSLR1 gene. The mutant according to the present invention is an untranslated or modified SLR1 protein, and it was confirmed that the mutation site is different from the previously reported slr1-d1 to slr1-d6 alleles.

Example 2. Dwarfism of new Slr1-d7 and Slr1-d8 mutant plants

The new dwarf mutants (slr1-d7 to slr1-d12) showed several defects in addition to reducing plant size. Compared to wild-type (WT), this mutant exhibited slower growth rates and dwarf and wrinkled leaves (Fig. 5A). The stomata is a key pathway regulating leaf gas exchange and water evaporation, and as a result of observing the stomata size with SEM images, it was confirmed that slr1-d7 and slr1-d8 had smaller pores than WT (Fig. 5B). To observe internode cytological differences from two mutants (slr1-d7 and slr1-d8) and from WT, internode paraffin sections were examined. As a result, the cell size of the dwarf mutant significantly decreased and the internode thickened as the cell layer increased. load was shown (FIG. 5C). Also, all internode lengths of slr1-d7 and slr1-d8 were decreased compared to WT (Fig. 5D). These results were similar to the characteristics of dn-type rice dwarf mutants previously reported by Takeda. Therefore, slr1-d7 and slr1-d8 of the present invention were semi-dominant dwarf mutants, indicating that cell length reduction could be a direct cause of stem length shortening in dwarf mutant plants. In addition, to investigate the cause of dwarfism, the length of leaf sheath was measured according to GA ₃ concentration treatment in slr1-d7, slr1-d8 and WT _. but showed decreased length extension compared to WT (Figure 5E).

Example 3. Modified Transcriptome Profiles in Slr1-d7 and Slr1-d8 Mutants

To understand the effect of dwarfism on gene expression at the whole genome level, RNA-Seq was performed from WT, slr1-d7 and slr1-d8 strains to analyze transcriptional profiling changes. RNA-seq results showed that gene expression was significantly changed between WT and slr1-d7 and slr1-d8 strains ( FIG. 6A ). 214 genes up-regulated and 154 genes down-regulated were identified in the slr1-d7 mutant compared to WT plants, and 334 genes were up-regulated and 104 genes down-regulated in the slr1-d8 mutant (Fig. 6B). . Venn diagram analysis revealed 806 genes expressed in both WT and slr1-d7 or slr1-d8 mutants ( FIGS. 6B and 6C ).

<110> Hankyong Industry Academic Cooperation Center <120> Method for producing OsSLR1 gene mutant rice plant using CRISPR/Cas9 system and rice plant having dwarf phenotype produced by the same method <130> PN20303 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 2553 <212> DNA <213> Oryza sativa <400> 1 tgccttcctc tctgatcacc tgatgccctt cctcttctcc ccccttgcta ctactagttg 60 cttgcctctt cccacctcac ctcgcattgc aatctcgcat cgcctcttcc ttctcttctt 120 ccccttcttc tccccttctc atccaacctc gcttcccaac cctggatcca aatcccaacc 180 tatcccaaag ccgaaaccga ggagaggaaa aaggttacgc gcaattatta ctagctatag 240 ctaggtaggt ttgggggagg cgagatcatg aagcgcgagt accaagaagc cggcgggagc 300 agcggcggcg ggagcagcgc cgatatgggg tcgtgcaagg acaaggtgat ggcgggggcg 360 gcgggggagg aggaggacgt cgacgagctg ctggcggcgc tcgggtacaa ggtgcggtcg 420 tccgacatgg ccgacgtcgc gcagaagctg gagcagctgg agatggccat ggggatgggc 480 ggcgtgagcg cccccggcgc cgcggatgac gggttcgtgt cgcacctggc cacggacacc 540 gtgcactaca acccctcgga cctctcctcc tgggtcgaga gcatgctttc cgagctcaac 600 gcgccgctgc cccctatccc gccagcgccg ccggctgccc gccatgcttc cacctcgtcc 660 actgtcaccg gcggcggtgg tagcggcttc tttgaactcc cagccgctgc cgactcgtcg 720 agtagcacct acgccctcag gccgatctcc ttaccggtgg tggcgacggc tgacccgtcg 780 gctgctgact cggcgaggga caccaagcgg atgcgcactg gcggcggcag cacgtcgtcg 840 tcctcatcgt cgtcttcctc tctgggcggt ggggcctcgc ggggctctgt ggtggaggct 900 gctccgccgg cgacgcaagg ggccgcggcg gcgaatgcgc ccgccgtgcc ggttgtggtg 960 gttgacacgc aggaggctgg gatccggctg gtgcacgcgt tgctggcgtg cgcggaggcc 1020 gtgcagcagg agaacttcgc ggccgcggag gcgctggtca agcagatccc cacgctggcc 1080 gcgtcccagg gcggcgccat gcgcaaggtc gctgcctact tcggcgaggc cctcgcccgc 1140 cgcgtgtacc gcttccgccc cgcggacagc accctcctcg acgccgcctt cgccgacctt 1200 ctgcacgccc acttctacga gtcctgcccc tacctcaagt tcgcccactt caccgcaaat 1260 caagccatcc tcgaggcttt cgccggctgc caccgcgtcc acgtcgtcga cttcggcatc 1320 aagcagggga tgcaatggcc agctctcctc caggccctcg cccttcgtcc cggcggcccc 1380 ccatcgttcc gcctcaccgg cgtcggcccc ccgcagccgg acgagaccga cgccttgcag 1440 caggtgggtt ggaagcttgc ccagttcgcg cacaccattc gcgtcgactt ccagtaccgg 1500 ggactcgtcg ccgccactct cgcggacttg gagccgttca tgctgcagcc ggagggcgag 1560 gcggacgcga acgaggagcc tgaggtgatc gccgtcaact cggtgttcga gctgcaccgg 1620 ctgctcgcgc agcccggcgc gctggagaag gtcctgggca cggtgcacgc ggtgcggcca 1680 aggatcgtca ccgtggtaga gcaggaggcc aaccacaact ccggctcatt cctcgaccgg 1740 ttcaccgagt cgctgcacta ctactccacc atgttcgatt ccctcgaggg cggcagctcc 1800 ggccaggccg agctctctcc gccggctgcc gggggcggcg gtggcacgga ccaggtcatg 1860 tccgaggtgt acctcggccg gcagatctgc aacgtcgtgg cgtgcgaggg cgcggagcgc 1920 acggagcgcc acgagacgct ggggcagtgg cgcaaccgcc tcggccgcgc cggcttcgag 1980 cccgtgcacc tgggctccaa tgcctacaaa caggcgagca cgctcctcgc gcttttcgcc 2040 ggcggcgacg gctaccgggt ggaggagaag gagggctgcc tcacgctggg ctggcacacg 2100 cgcccgctca tcgccacctc ggcatggcgc gtcgccgcgg cgtgatcgca aagtttttgg 2160 gacgctgcac cacgtgtttg ccgccgatca cggcgcgacc cccccccccc cccctctctc 2220 tctccccggc tcaccggcgg cacaattgaa gcttgacgtc aacgaacgct caattgcagc 2280 gaccgatcgg gcttacggtt ctcgccggcg tgaagagatc gacgactgga ctccgaccag 2340 accgacggct tgttcgttct cctttcccaa ttaccccgtt ccttggtcct cctagcccat 2400 ctattatgtt taaatgtcaa ttattatgtg taatttctcc aatcgctcat attaaataag 2460 gacgaaccga actggatttc attagctcca atgagaattt tgtatacaag gcaccgatct 2520 aaaaattgag ctatatgttc atgagttaca gaa 2553 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLR1-sgRNA1 target sequence <400> 2 acccctcgga cctctcctcc tgg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLR1-sgRNA2 target sequence <400> 3 tggacgaggt ggaagcatgg cgg 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLR1-sgRNA3 target sequence <400> 4 tggacgaggt ggaagcatgg cgg 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLR1-sgRNA4 target sequence <400> 5 tggttgacac gcaggaggct ggg 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLR1-sgRNA5 target sequence <400> 6 gcatcaagca ggggatgcaa tgg 23 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ggcagacccc tcggacctct cctcc 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aaacggagga gaggtccgag gggtc 25

Claims (6)

a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsSLR1 ( Oryza sativa slender rice 1) gene (ribonucleoprotein); Or a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein and DNA encoding a guide RNA specific for the target nucleotide sequence of the rice-derived OsSLR1 gene; A composition for genome editing. The composition according to claim 1, wherein the target nucleotide sequence of the OsSLR1 gene consists of the nucleotide sequence of SEQ ID NO: 2. (a) correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsSLR1 ( Oryza sativa slender rice 1) gene into plant cells of rice; and
(b) re-differentiating the rice plant from the genome-corrected rice plant cells; A method for producing a dwarf-induced genome-corrected rice plant comprising a. The complex of claim 3, wherein the introduction of the guide RNA and endonuclease protein in step (a) into rice plant cells comprises a guide RNA specific for the target nucleotide sequence of the rice-derived OsSLR1 gene and an endonuclease protein. (ribonucleoprotein); or a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein and DNA encoding a guide RNA specific for the target nucleotide sequence of the rice-derived OsSLR1 gene. The method according to claim 3, wherein the target nucleotide sequence of the OsSLR1 gene consists of the nucleotide sequence of SEQ ID NO: 2. A dwarf-induced genome-corrected rice plant produced by the method of any one of claims 3 to 5.

Images