KR102453800B1 - Method for producing SlMS10 gene knock-out tomato plant using CRISPR/Cas9 system and male-sterile tomato plant produced by the same method - Google Patents

Abstract

The present invention relates to a method for producing a SlMS10 ( Solanum lycopersicum male sterile 10) gene knockout tomato plant using a CRISPR/Cas9 system and a male sterile tomato plant prepared by the method, and the present invention relates to male sterility through the CRISPR/Cas9 system A tomato plant was prepared, which can be quickly introduced into an elite line, and has the advantage of reducing the time required to remove linkage drag compared to the existing breeding method.

Description

Method for producing SlMS10 gene knock-out tomato plant using CRISPR/Cas9 system and male-sterile tomato plant produced by the method same method}

The present invention relates to a method for producing a SlMS10 gene ( Solyc02g079810 ) knockout tomato plant using a CRISPR/Cas9 system, and a male sterile tomato plant produced by the method.

Tomato ( Solanum lycopersicum L.) is a representative vegetable crop belonging to the family Solanaceae, and has high economic value in the market due to its high production and consumption worldwide. In particular, tomatoes can be transformed through Agrobacterium-mediated and are used as a breeding model for horticultural crops because of their relatively short lifespan and small genome size. Tomato seeds are mostly commercially available F ₁ cultivars, which show greater biomass, higher disease resistance and higher yields than free-pollinated cultivars (meaning native species). Plant male sterility is a functional inability to produce or release pollen because anthers, microcells, or male gametes are not produced. Tomato male infertility has attracted the attention of many researchers since it was first described by Crane (J. Genet. 1915, 5:1-11), and about 50 male infertility mutations have been reported so far. It has also been reported that male infertility mutations interfere with the division of tapetum cells, promoting aborted microgametogenesis through genes such as eme1/exs , tpd1 , ams and ms1 . In Arabidopsis, several genes encoding transcription factors such as AtDYT1 , AtTDF1 , AtAMS , AtbHLH10 , AtbHLH89 , AtbHLH91 and AtMYB103 as regulatory factors involved in pollen generation have been studied. Among transcription factors, the basic helix-loop-helix (bHLH) protein plays an important role in plant growth and development. A total of 152 bHLH transcription factors were reported in the tomato genome. The bHLH motif consists of two functionally distinct regions: the basic region for DNA binding and the HLH region for protein dimerization.

Depending on their ability to bind DNA, proteins that can bind DNA are called DNA-binding bHLHs and other proteins are called non-DNA-bound bHLHs. Recent studies have reported that non-DNA-bound bHLH is functionally very important because heterodimerization occurs through the bHLH domain. It has been reported that the SlMS10 gene ( Solyc02g079810 ), encoding the bHLH transcription factor, performs both programmed cell death and meiosis in tapetum during microgametogenesis. Molecular marker development and gene targeting for other genes controlling male sterility such as ms10 (male sterile 10), ms15 , ms32 , ps2 (positional sterile 2) , ex (exserted stigma) and 7B-1 for tomato breeding have been reported. has been The male sterile tomato strain used in the present invention was prepared by knocking out the stamen-specific gene SlSTR1 ( Solyc03g053130 ) using the CRISPR/Cas9 system. In a previous study, the present inventors succeeded in introducing the male infertility ms10 gene into an elite line (MR10-3211) for backcross breeding. In the case of MAS (Marker-Assisted Selection), anthocyanin-deficient markers (aa) for foreground selection and SNP (single nucleotide polymorphism) markers derived from rearrangement data were used for background selection. The Tomato MABC (Marker-Assisted BackCrossing) breeding program significantly reduced breeding time and costs through a rapid selection system compared to traditional breeding. However, it has been reported that this MAS method causes many reproductive difficulties as undesirable genomic segments are linked to target genes.

Recent genome editing techniques have shown the potential to induce gene mutations at desired genomic DNA locations using various types of site-specific nucleases. Among them, the CRISPR/Cas9 system is known as a powerful genome editing tool in relation to plants and many other organisms. The advantage of this system is the precise and efficient introduction of mutations at the target site. In addition, it is shown that there is no difference between the gene-edited crops and the crops developed through conventional traditional breeding techniques.

On the other hand, Korea Patent Application Publication No. 2019-0043841 discloses 'a method for reducing ethylene production by LeMADS-RIN gene editing using the CRISPR/Cas9 system in plants', and Korean Patent Publication No. 2019-0020035 discloses ' Although the 'targeted DNA alteration method in plant cells' is disclosed, the method for producing SlMS10 gene knockout tomato plants using the CRISPR/Cas9 system of the present invention and male sterile tomato plants produced by the method are not described.

The present invention was derived from the above needs, and the present inventors targeted the SlMS10 gene ( Solyc02g079810 ) encoding the bHLH transcription factor to develop male sterile tomato plants using a CRISPR/Cas9 system to edit a knockout mutant plant. was prepared. The present invention was completed by confirming that the prepared SlMS10 gene knockout mutant exhibited meiosis disorder and abnormal tapetum during flower development, making it impossible to produce pollen.

In order to solve the above problems, the present invention provides a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the tomato-derived SlMS10 ( Solanum lycopersicum male sterile 10) gene (ribonucleoprotein); Or a recombinant vector comprising a nucleic acid sequence encoding a DNA encoding an endonuclease protein and a DNA encoding a guide RNA specific for the target nucleotide sequence of the SlMS10 gene derived from tomato; containing as an active ingredient, inducing male infertility of tomato plants It provides a composition for genome editing for

In addition, the present invention comprises the steps of (a) introducing a guide RNA and an endonuclease protein specific for the target nucleotide sequence of the tomato-derived SlMS10 gene into tomato plant cells to correct the genome; And (b) re-differentiating the tomato plant from the tomato plant cell in which the genome has been corrected;

In addition, the present invention provides a genome-corrected tomato plant induced in male infertility prepared by the above method.

The utilization of male sterility in hybrid seed production can reduce costs and ensure high purity of the variety because it does not produce pollen and exposes the stigma. The present invention produced male sterile tomato plants through the CRISPR/Cas9 system, which can be rapidly introduced into elite lines, and compared to the existing breeding method, linkage drag (selection of specific traits through crossbreeding to obtain a specific trait desired, It has the advantage of shortening the time required to remove unwanted genes (the phenomenon that other genes come together) during the selection process.

1 is a phylogenetic analysis result of bHLH protein derived from various plants.
Figure 2 relates to SlMS10 ( Solanum lycopersicum male sterile 10) gene editing using the CRISPR/Cas9 system, and Figure 2 (A) shows the target position of each sgRNA in the SlMS10 gene, and the underline is the PAM site. Figure 2 (B) is a schematic diagram of the sgRNA-Cas9 vector (AtU6: sgRNA / pBAtC) used in the present invention, Figure 2 (C) is a gene-edited T ₀ generation homo-, hetero-, bi- and multi- Allelic editing rates are shown, and FIG. 2(D) shows the gene editing frequencies of sgRNA1 (SEQ ID NO: 2) and sgRNA2 (SEQ ID NO: 3).
Figure 3 confirms the mutation tendency and flowering phenotype of the sgRNA target site, Figure 3 (A) is a schematic of CRISPR / Cas9 mediated target mutagenesis in the SlMS10 gene, Figure 3 (B) is a gene-edited plant and wild type (wild) type) is the flower phenotype.
4 is a morphological analysis result of flowers of gene-edited cr-ms10-1-4, cr-ms10-2-8 mutant lines and wild-type (WT) plants. 4 (B) and 4 (C) are the results of measuring the length and width of the sepal, petal, style, anther (about, anther) and ovary (ovary), 4(D) shows the results of analysis of pollen viability by staining with carmine acetate.
Figure 5 is the result of histological analysis of anthers at different developmental stages, Figure 5 (A) shows a cross section of anthers of wild-type (WT) and gene-edited cr-ms10-1-4 mutant strains, Figure 5 (B) is the SEM analysis result. (a,g) Premeiotic stage; (b,h) Meiotic stage; (c,i) Tetrad stage; (d,j) Microspore stage; (e,k) Mitotic stage; (f,l) Dehiscence stage (dehiscence stage); dMs, degenerated meiocytes; dT, degenerated tapetum; En, endothecium; Ep, epidermis; ML, middle cell layer; Msp, microspores; PMC, pollen mother cell; SC, sporogenous cells; T, tapetum; Tds, tetrads.
Figure 6 (A) shows the developmental stage of tomato flowers in the wild type, and Figure 6 (B) is the relative expression levels of genes related to flowering in wild type (WT) and gene-edited cr-ms10-1-4 mutant lines. This is the result confirmed by RT-PCR. dpa, days post anthesis; Solyc02g079810 , MS10; Solyc08g062780 , AMS-like; Solyc03g053130 , SlSTR1; Solyc04g008420 , AMS-like-1; Solyc01g081100 , MS32; Solyc03g113530 , AtTDF1-like; Solyc10g005760 , MYB103-like; Solyc06g069220 , Aspartic protease-1; Solyc07g053460 , Cysteine protease; Solyc03g116930 , Sister chromatid cohesion; Solyc03g046200 , Endo-1,3-beta-glucanase; Solyc03g078400 , Actin.
Figure 7 (A) is a gel loading photograph of the PCR product amplified from the putative transgenic plant, Figure 7 (B) is the phenotype of the gene edited plant, Figure 7 (C) is T ₁ and T through PCR analysis This is the result of selecting null segregants from the _second generation.

In order to achieve the object of the present invention, the present invention provides a complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the tomato-derived SlMS10 ( Solanum lycopersicum male sterile 10) gene (ribonucleoprotein) ; Or a recombinant vector comprising a nucleic acid sequence encoding a DNA encoding an endonuclease protein and a DNA encoding a guide RNA specific for the target nucleotide sequence of the SlMS10 gene derived from tomato; containing as an active ingredient, inducing male infertility of tomato plants It provides a composition for genome editing for

The term "genome/gene editing" is a technology that can introduce target-directed mutations into the genome sequence of animal and plant cells, including human cells, and is a technique that allows deletion of one or more nucleic acid molecules by DNA cleavage. Deletion), insertion (insertion), substitution (substitutions), etc. knock-out (knock-out) or knock-in (knock-in) a specific gene, or non-coding DNA that does not produce a protein It refers to a technology that can introduce mutations into sequences as well. For the purpose of the present invention, the genome editing may be to introduce a mutation into a plant using an endonuclease, for example, a CRISPR associated protein 9 (Cas9) protein and a guide RNA. Also, 'gene editing' may be used interchangeably with 'gene editing'.

The term "target gene" refers to some DNA in the genome of a plant to be corrected through the present invention, is not limited to the type of the gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome-corrected plant to be prepared, depending on the purpose.

The term "guide RNA (guide RNA)" refers to RNA specific for DNA encoding the nucleotide sequence of a target gene, and all or part of the target DNA nucleotide sequence and all or part of the nucleotide sequence are complementarily bound to form endonuclease as the target DNA nucleotide sequence. It refers to ribonucleic acid that plays a role in guiding the first protein. The guide RNA may include two RNAs, that is, a dual RNA including crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or it refers to a single-chain guide RNA (sgRNA) form comprising a first site comprising a sequence that is fully or partially complementary to a nucleotide sequence in a target gene and a second site comprising a sequence that interacts with an RNA-guided nuclease. , the RNA-guided nuclease may be included in the scope of the present invention without limitation as long as it has a form capable of having activity in the target nucleotide sequence, taking into account the type of endonuclease used together or the microorganism derived from the endonuclease, etc. It can be appropriately selected according to a technique known in the art.

In addition, the guide RNA may be transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide double-stranded), or synthesized guide RNA, but is not limited thereto.

In the composition for genome editing according to the present invention, the guide RNA is specifically designed for the target nucleotide sequence of the SlMS10 gene, and the target nucleotide sequence of the SlMS10 gene is preferably composed of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 may be, but is not limited thereto. The nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 is the target sequence of the first exon or the third exon region in the SlMS10 gene consisting of the nucleotide sequence of SEQ ID NO: 1, respectively.

In addition, in the composition for genome editing according to the present invention, the endonuclease protein is Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or its It may be at least one selected from the group consisting of functional analogs, and preferably, a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is Streptococcus pyogenes -derived Cas9 protein, Campylobacter jejuni -derived Cas9 protein, Streptococcus thermophilus or Streptococcus aureus ( S. aureus ) derived Cas9 protein, Neisseria meningitidis derived Cas9 protein, Pasteurella multocida derived Cas9 protein, Francisella novicida Cas9 protein derived from, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI).

Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence of three bases known as PAM (Protospacer Adjacent Motif) must exist next to the target sequence, and the Cas9 protein has a PAM sequence (NGG). cleavage by inferring between the 3rd and 4th base pairs from

In the composition for genome editing according to the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).

The present invention also

(A) tomato-derived SlMS10 ( Solanum lycopersicum male sterile 10) step of correcting the genome by introducing a guide RNA (guide RNA) and endonuclease (endonuclease) protein specific to the target nucleotide sequence of the gene into tomato plant cells; and

(b) re-differentiating the tomato plant from the tomato plant cell in which the genome has been corrected;

In the preparation method according to an embodiment of the present invention, the guide RNA and endonuclease protein specific for the target nucleotide sequence of the SlMS10 gene are the same as described above.

The CRISPR/Cas9 system used in the present invention introduces a double helix break at a specific position of a specific gene to be corrected, and NHEJ induces an insertion-deletion (InDel) mutation caused by incomplete repair induced in the DNA repair process. It is a gene editing method based on (non-homologous end joining) mechanism.

In the production method according to the present invention, the introduction of the guide RNA and the endonuclease protein of step (a) into tomato plant cells includes a guide RNA and an endonuclease specific to the target nucleotide sequence of the tomato-derived SlMS10 gene. ribonucleoprotein; Alternatively, a recombinant vector comprising a DNA encoding a guide RNA specific for the target nucleotide sequence of the tomato-derived SlMS10 gene and a nucleic acid sequence encoding an endonuclease protein; may be used, but is not limited thereto.

In the production method according to the present invention, the method of transducing the complex of the guide RNA and the endonuclease protein into plant cells is a calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72- 74; Injection (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70) , Agrobacterium tumefaciens ) In mediated gene transfer (incomplete) infection by a virus (EP 0 301 316) and the like.

In addition, introducing a recombinant vector including a DNA encoding a guide RNA specific for the target nucleotide sequence and a nucleic acid sequence encoding an endonuclease protein into a plant cell means a transformation method. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the recombinant vector according to the invention into suitable progenitor cells.

In the production method according to the present invention, the "plant cell" into which the guide RNA and endonuclease protein specific for the target nucleotide sequence are introduced may be any plant cell. Plant cells are cultured cells, cultured tissues, cultured organs or whole plants. "Plant tissue" refers to a tissue of a differentiated or undifferentiated plant, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie, single cells, protoplasts. (protoplast), shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture state.

In the production method of the present invention, any method known in the art may be used as a method of redifferentiating a plant having a corrected genome from a plant cell having a corrected genome. Plant cells whose genome has been corrected must be redifferentiated into whole plants. Techniques for the redifferentiation of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).

The present invention also provides a genome-corrected tomato plant induced in male infertility prepared by the manufacturing method according to the present invention.

The genome-corrected tomato plant induced in male infertility according to the present invention was corrected for the SlMS10 gene encoding the bHLH transcription factor using the CRISPR/ Cas9 system. It is a male infertile tomato plant that is unable to produce pollen due to mitosis and abnormal tapetum.

The male infertility-induced genome-corrected tomato plant according to the present invention does not generate pollen by itself, so a seed is not formed by itself, but a seed can be generated through crossing with a normal pollen-producing tomato plant, so the breeding value is very great.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Phylogenetic tree analysis

The amino acid sequence of SlMS10 and other genetic homologues associated with male infertility were collected from BLASTP (https://blast.ncbi.nlm.nih.gov). Amino acid multiple alignment was performed by ClustalW in MEGA 7.0 with default parameters. Full-length amino acid sequences of a total of 37 plant species were aligned, and maximum likelihood trees were generated with default settings. The phylogenetic tree was constructed by the neighbor-joining method as previously reported by Kumar et al. (Mol. Biol. Evol. 2016, 33:1870-1874).

2. Construction of the sgRNA-Cas9 Vector

For the design of sgRNA, three target sites were selected from the S1MS10 sequence using the CRISPR RGEN tool program (http://www.rgenome.net/) (Table 1). T7E1 analysis was performed in the same manner as previously reported by Jung et al. (Plant Biotechnol. Rep. 2019, 13:511-520). In the pBAtC vector, the Cas9 gene was regulated by the 35S mosaic virus promoter and the sgRNA was configured to be regulated by the Arabidopsis U6 promoter. A DNA oligo corresponding to the designed sgRNA was synthesized by Bioneer Co., Ltd. (Daejeon, Korea), and the dimer was cloned into pBAtC, a plant expression vector. The constructed plasmid AtU6:sgRNA/pBAtC was introduced into the A. tumefaciens EHA105 strain using electroporation.

sgRNA for tomato SlMS10 gene editing RGEN target (5'→3')
(SEQ ID NO:) direction GC content
(%, w/o PAM) Out-of frame score Mismatches 0 One 2 3 sgRNA1 GCCTATTTCTCTCAGCCTTAAGG (2) - 45.0 68.9 One 0 0 0 sgRNA2 GTTCTGCCAAAAGAAAAGAGGTGG (3) + 45.0 73.1 One 0 0 0 sgRNA3 ATGGAGGCAATGAATGCTCTTGG (4) + 45.0 67.0 One 0 0 0

3. Tomato Transformation

The transformation procedure was performed using the KS-13 variety as reported by Jung et al. (Hortic. Sci. Technol. 2018, 36:396-405). Briefly, cotyledons of 10 to 14-day-old seedlings were immersed in Agrobacterium suspension culture medium, gently stirred, wiped with sterile Whatman paper, and slightly dried explants were co-culture medium (4.3 g/L MS, 30.0 g/L sucrose, 300 mg/L zeatin, 30 mg/L acetosyrigone, and 3.0 g/L gelrite) and cultured for 2 days in the dark at 23±2°C. After co-culture, all cotyledons were washed with sterile distilled water containing 300 mg/L cefotaxime to prevent bacterial overgrowth. This washing procedure was repeated three times and then the cotyledons were wiped with sterile Whatman paper. Leaf discs were treated with 4.3 g/L MS, 30.0 g/L sucrose, 300 mg/L zeatin, 400 mg/L carbenicillin, 100 mg/L kanamycin and 3.0 It was transferred to selective medium containing g/L gelrite and inverted. Redifferentiated shoots (height 2 cm) were separated from the original cotyledon and transferred to a rooting medium containing 0.3 mg/L indole acetic acid (IAA), 50 mg/L kanamycin and 400 mg/L carbenicillin. Tomato plants with well-developed roots were acclimatized to pots and grown in greenhouses.

4. Targeted Deep Sequencing and Mutation Analysis

DNA extraction of tomato plants was performed using a DNA Quick Plant Kit (Inclone Ltd., Korea). First, PCR analysis was performed using NPTII gene-specific primers to identify transformants in redifferentiated plants. After that, targeted deep sequencing analysis was performed as described by Jung et al. Paired-end read sequences were generated by PCR amplicons using MiniSeq (Illumina, USA). All data derived from sequences were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer) as reported by Park et al. (Bioinformatics 2017, 33:286-288). In general, it is known that the Cas cleavage site in the CRISPR/Cas9 system occurs mainly 3bp upstream of the protospacer. Therefore, insertion and deletion mutations in the vicinity of 3bp upstream of the protospacer were considered as Cas9-induced mutations. Transgene-free mutant plants were screened in the T ₁ generation and double identified in the T ₂ generation. To obtain T-DNA-free plants, PCR amplification was performed using DNA extracted from individual plants using NPTII gene-specific primers. For potential off-target analysis, PCR analysis was performed with specific primers using plants lacking T-DNA. PCR products were sequenced and mutations identified.

5. Analysis of Plant Growth and Morphological Characteristics

All tomato seedlings were grown in pots using sterilized soil in the greenhouse of the farm attached to Hankyong University (Anseong, Korea). Flower traits were investigated in wild-type, mutant lines of the T ₁ and T ₂ generations. Two flowers were collected per plant using a stereomicroscope, and the shape of the flowers was observed at the flowering stage. The number of sepals and petals was counted for each flower, and the length and width were measured using representative sepals and petals. Anther, ovary and pistil lengths were also measured. All data recorded are expressed as mean ± standard error.

6. Microscopic observation

To determine the pollen phenotype, two flowers per plant were sampled, stained with 1% acetocarmine solution, and observed under a light microscope. Paraffin sections were prepared by harvesting flower buds around the meiosis stage from each plant. First, the flower buds were treated with 15% hydrofluoric acid, followed by dehydration, removal, penetration and embedding processes. For imaging, a 10 μm microtome section was placed on a glass slide and floated in a 37 °C water bath containing deionized water, and the section was placed on a clean glass slide and microwaved at 65 °C for 15 min. The tissue was then glued to glass and immediately used for chemical staining. Flower phenotype was analyzed by observation with a scanning electron microscope (SEM). After removing the anthers and petals and separating the individual anthers from the androecium, the flowers were fixed for 3 hours using 3% glutaraldehyde (pH 7.2), and cacodylate buffer was used for 10 hours. and then fixed in 1.1% osmium tetroxide for 8 hours. After that, it was dehydrated with an ethanol series. Flower phenotype was observed using a 5200 JEOL JSMSEM (JEOL Ltd., Japan).

7. RNA Extraction and RT-PCR Analysis

Total RNA was extracted from plant leaves using Trizol reagent (Invitrogen, Korea). cDNA synthesis was synthesized using reverse transcriptase (Promega, Seoul, Korea) using 2 μg of total RNA. For RT-PCR analysis, 200 ng of cDNA was used and the amplified PCR product was separated on a 1% agarose gel. Then, it was stained with EtBr (ethidium bromide) and the amplification product was observed under a UV lamp. The primer sequences of the genes used for RT-PCR analysis are shown in Table 3.

Example 1. Phylogenetic analysis of SlMS10 and other bHLH homologs

A phylogenetic analysis was performed to confirm information on the genetic relationship between SlMS10 and the bHLH homologue associated with male infertility in other plant groups. Thirty-seven SlMS10 and other bHLHs collected from the NCBI database were analyzed using the MEGA7 program. As a result, as shown in FIG. 1, all putative and identified proteins of SlMS10 and other bHLH homologues were classified into clades by phylogenetic numbers. In the phylogenetic tree, three proteins related to SlMS10 and bHLH homologues were recorded in the tomato genome and were well conserved in the plant genomes of other species. The results showed that SlMS10, OsUDT1, CabHLH and AtDYT1 were classified within the same clade, suggesting that transcription factors of the tomato bHLH family exhibit very high homology regardless of origin.

Example 2. Preparation of Male Infertile Lines Using the CRISPR/Cas9 System

To generate transgenic plants with targeted mutations in the SlMS10 gene, we designed CRISPR/Cas9 vector constructs targeting the first and third exons of the SlMS10 gene, respectively (Fig. 2A and Table 1), and Agrobacterium-mediated traits. Using the transformation method, 60 independent T ₀ transgenic tomato plants were prepared from the tomato KS-13 line. In the transgenic T ₀ generation, it was confirmed that chimeric, bi-allelic, heterozygous and homozygous S1MS10 mutations were present at the target site through deep sequencing (FIGS. 2B-D and Table 4).

Frequency of S1MS10 gene editing using the CRISPR/Cas9 system target region No. of regenerated plants No. of
transgenic
plants No. of
edited
plants Genotype homo-
allelic hetero-allelic bi-
allelic multiple-allelic SlMS10
-sg 1 44 42 15 4 3 8 - SlMS10
-sg 2 20 18 13 2 3 6 2

Most of the mutations except for some in-frame deletion mutations in the target region were frame-shifted (Fig. 3A). Then, male infertility of frame-shift mutants and in-frame mutants was investigated. As a result, in-frame mutants generally produced pollen, but all frame-shift mutants showed male infertility (Fig. 3B). Among the frame-shift mutants, "Allele 1-4" and "Allele 2-5" mutants were selected for cr-ms10-1-4 (-61/-61) and cr-ms10-2-8 (-10/ -10). T ₁ seeds were generated by crossing the selected mutant with pollen of KS-13 used for transformation. T ₁ and T ₂ mutant lines without T-DNA were screened through PCR (Fig. 7C), and potential off-target mutations in T ₂ mutant lines were investigated. After sequencing the PCR products obtained from T ₂ mutant plants lacking T-DNA, 10 samples containing 4 mismatched bases were used using Cas-OFFinder (http://www.rgenome.net/cas-offinder/). Potential off-target sites were investigated. As a result, no mutations were observed in all 10 potential off-target sites, suggesting that mutagenesis of the predicted sites was designed with high specificity (Table 5).

Mutation analysis of potential off-target sites in gene editing plants Target putative
off-target Off-target locus Sequence of off-target site ^* No. of
mutation
plants sgRNA 1 OFF 1 ch02:611807-611829 GCCTATTgaTtTCAaCCTTAGGG 0 OFF 2 ch03:2207687-22076709 GCCTAgTTCTtgCAGCtTTATGG 0 OFF 3 ch03:9357140-9357162 GCCTATTgtaCaCAGCCTTACGG 0 OFF 4 ch09:1577070-157729 GaggATTTCTCTtAGCCTTAGGG 0 OFF 5 ch09:58165589-58165611 cCaTATTTCTCTCAagCTTAAGG 0 OFF 6 ch12:6683409-6683409 aCCTATTTCTtTCAGgtTTATGG 0 sgRNA 2 OFF 1 ch01:56429029-56429051 tcCTGCaAAAAGAAAAAGAaG 0 OFF 2 ch01:74607309-74607931 ccCTGCaAAAAAAAAAAGAaG 0 OFF 3 ch03:29122126-29122148 aTCTGagAAAAGAgAAGAGG 0 OFF 4 ch07:6556684-6556706 GTCTtttAAAAGAAAAGAcG 0 OFF 5 ch10:42400100-42400122 agCTGCCAAAAAGAAAAGgGa 0 Lowercase letters mean 4 mismatched bases.

Example 3. Phenotypic characteristics of cr-ms10-1-4 and cr-ms10-2-8 mutant strains

The phenotypes of cr-ms10-1-4 and cr-ms10-2-8 mutant lines and wild-type (WT) plants were confirmed to be almost similar until the flowering stage ( FIG. 4A ). However, the cr-ms10-1-4 and cr-ms10-2-8 mutant lines were observed to have longer sepals and shorter petals than the WT plants at the flowering stage (Fig. 4A). In addition, the stamens of cr-ms10-1-4 and cr-ms10-2-8 lines were significantly reduced compared to WT, had a bright color, and generally the stigma (stigma) was strongly maintained (Figs. 4B and 4C). ). As a result of staining with 1% acetocarmine to confirm pollen viability analysis, orange-stained pollen was seen in WT plants, but pollen was not confirmed in cr-ms10-1-4 and cr-ms10-2-8 lines. did not (Fig. 4D). Therefore, the cr-ms10-1-4 and cr-ms10-2-8 lines were unable to produce fruit after self-pollination, but were able to produce fruit as a result of artificial pollination of WT plants.

Example 4. Histological analysis of anther in cr-ms10-1-4 lineage

To investigate the spatial and temporal occurrence of the SlMS10 gene defect in the cr-ms10-1-4 lineage, histological examinations of anthers at different developmental stages were performed (Fig. 5A). In the preliminary meiosis stage, the cell layer differentiation of cr-ms10-1-4 lineage anthers appeared similar to that of WT. Also, in the meiosis stage, meiosis was completed when spore cells were developed from pollen mother cells (Fig. 5A (b, h)), and from this point on, cr-ms10-1-4 Morphological differences were observed between the anthers of and WT. In the anthers of WT, pollen blast cells were divided into continuous quadrilaterals after meiosis and continuously developed into microspores, vesicular microspores and pollen particles (Fig. 5A), and tapetal cells gradually disappeared after highly condensed. . However, in the anthers of the cr-ms10-1-4 lineage, pollen blast cells were decomposed and could not produce tetrapods (Fig. 5A (c, i)). In addition, the elongated and tapered cells were excessively expanded and vacuolated in the tetrahedral stage, and this state was maintained until the dehiscence stage (FIG. 5). In addition, anthers of cr-ms10-1-4 and WT were analyzed by SEM. As a result, the anthers of WT were observed as normal spherical pollen grains, but the anthers of the cr-ms10-1-4 line were not observed (FIG. 5B).

Example 5. Expression analysis of genes related to floral development

Considering that the cr-ms10-1-4 mutant line cannot produce pollen due to abnormalities in meiosis and tapetum development (Fig. 6A), RT-PCR analysis of 10 genes related to flower development expression analysis was performed. As a result, the same genes were strongly expressed in Solyc03g116930 encoding sister chromatid cohesion, Solyc07g053460 encoding cysteine protease, Solyc08g062780 encoding AMS-like and Solyc03g053130 encoding SlSTR1 , but the same genes were strongly expressed in WT. It was not expressed in the cr-ms10-1-4 mutant line ( FIG. 6B ). In addition, in the cr-ms10-1-4 mutant line, Solyc01g081100, encoding MS32 , Solyc03g113530, encoding AtTDF1-like, Solyc10g005760 encoding MYB103 -like, Solyc06g069220 encoding Aspartic protease-1, Endo-1,3-beta Expression levels of genes such as Solyc03g046200 encoding -glucanase and Solyc04g008420 encoding AMS-like-1 were found to be very low compared to WT (FIG. 6B).

<110> Hankyong Industry Academic Cooperation Center Clone Co., Ltd. <120> Method for producing SlMS10 gene knock-out tomato plant using CRISPR/Cas9 system and male-sterile tomato plant produced by the same method <130> PN20287 <160> 40 <170> KoPatentIn 3.0 <210> 1 <211> 1002 <212> DNA <213> Unknown <220> <223> Solanum lycopersicum <400> 1 atggaattcc ccagtacccc atttgataat tcaaacaact ctgaagaaag ggaagtagga 60 agaagaacag ataaaaggaa gcaaattgat ggtgaagtta aagaatacaa atccaagaac 120 cttaaggctg agagaaatag gcgtcaaaaa cttagcgaaa ggcttcttca attacgctca 180 ttggtcccaa acataacaaa tgcaatgaat caaaaacctt cattctttac atagtttcat 240 aaagaatgaa tttttttaaa aaaaatctaa aaaagtttaa attcttgtct gatttcagat 300 gacaaaagaa accataatca ctgacgccat cacctacatt agggagctac aaatgaatgt 360 ggacaaccta agtgagcagc ttcttgaaat ggaagcaact cagggggagg aactggagac 420 aaaaaatgaa gagattatcg atactgcaga cgagatgggt aaatggggca tagaggtagg 480 taactttatg tataaaacca aagtttcaat ctttgatatt cttgaattat aaggacagta 540 aaacaacttt gatctttgtt tttctaaaac agcctgaagt tcaagtggct aacattggcc 600 caactaagct ttggataaaa atagtctgcc aaaagaaaag aggtggatta actaaactga 660 tggaggcaat gaatgctctt ggatttgata taaatgacac cagtgccact gcctctaaag 720 gagctattct tattacttca tctgtggagg taggagaaac atatgttaaa aaagtaatct 780 ttttagtagc gataaagaaa ctattgcccg aaaatatcaa gatttgtaat agtacaaaaa 840 ggagatcttg cttagcacct tgtactgtgt gtgctgcaat tattagcaac ataaacaatt 900 tataaatctt tctgtgtatt atttcaggtg gttagaggtg gactaactga agctaatcga 960 atcagagaga tcttactgga gatcatccac ggaatctact ag 1002 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SlMS10 target site for sgRNA1 <400> 2 gcctatttct ctcagcctta agg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SlMS10 target site for sgRNA2 <400> 3 gtctgccaaa agaaaagagg tgg 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SlMS10 target site for sgRNA3 <400> 4 atggaggcaa tgaatgctct tgg 23 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gattgcctat ttctctcagc ctta 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 aaactaaggc tgagagaaat aggc 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gattgtctgc caaaagaaaa gagg 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aaaccctctt ttcttttggc agac 24 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atgattgaac aagatggatt gcac 24 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tcagaagaac tcgtcaagaa ggc 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gaattcccca gtaccccatt 20 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tgcagcacac acagtacaag g 21 <210> 13 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 acactctttc cctacacgac gataattcaa acaactctga agaaagg 47 <210> 14 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gtgactggag ttcagacgtg taatgaaggt ttttgattca ttgc 44 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 acactctttc cctacacgac ggacagtaaa acaactttga tctttg 46 <210> 16 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gtgactggag ttcagacgtg tcatatgttt ctcctacctc caca 44 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tgtttccatt accaagatgc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gggggttgtg ggggtagatt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tgtttccatt accaagatgc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gggggttgtg ggggtagatt 20 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 agatctctct gattcgatta gcttcag 27 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcttgaaatg gaagcaactc agg 23 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tgcagagatg ttatgtttca gcatc 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tcgtctctgt ctctttctcc ttctg 25 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 acaaattacc ttaggcctga tctcaaaca 29 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 aattcccata ccagataatt tctttttgag 30 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 gggcgtcttt gctacaatcc caac 24 <210> 28 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 atccatcctt gattgccaac ataatcg 27 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 gaacggataa tgatgtgaag aacct 25 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ctggtctaga cataaatgca cctttt 26 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 attggtgtcg attggaggaa g 21 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 caaatgcact ttccataaac cc 22 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gtgatattaa ttggcttcaa tgtgaacc 28 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 atactcgccg gaacctgtaa catc 24 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 agtgagatca tgagaattac agctcc 26 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 gatgaagttt gacagcactt tcttg 25 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 aaaaagatta ctacgcgagt caaaacattt 30 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 gacggatcag gaaggacagt agatttt 27 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 gggatggaga agtttggtgg tgg 23 <210> 40 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 cttcgaccaa gggatggtgt agc 23

Claims (6)

A complex of a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the tomato-derived SlMS10 ( Solanum lycopersicum male sterile 10) gene consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3. Complex (ribonucleoprotein) ; Or SEQ ID NO: 2 or a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein and DNA encoding a guide RNA specific to the target nucleotide sequence of the tomato-derived SlMS10 gene consisting of the nucleotide sequence of SEQ ID NO: 3; A composition for genome editing for inducing male infertility of tomato plants. delete (a) Tomato-derived SlMS10 ( Solanum lycopersicum male sterile 10) consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3, a specific guide RNA (guide RNA) and endonuclease (endonuclease) protein to the target nucleotide sequence of the gene tomato Correcting the genome by introducing it into plant cells; and
(b) re-differentiating the tomato plant from the tomato plant cells in which the genome has been corrected; comprising, a method for producing a genome-corrected tomato plant induced in male infertility. The method according to claim 3, wherein the introduction of the guide RNA and the endonuclease protein in step (a) into tomato plant cells is based on the target nucleotide sequence of the tomato-derived SlMS10 gene consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 a complex of specific guide RNA and endonuclease protein (ribonucleoprotein); or SEQ ID NO: 2 or SEQ ID NO: 3, a recombinant vector comprising a DNA encoding a guide RNA specific for the target nucleotide sequence of the SlMS10 gene derived from tomato consisting of the nucleotide sequence of SEQ ID NO: 3 and a nucleic acid sequence encoding an endonuclease protein; Manufacturing method characterized in that. delete A genome-corrected tomato plant induced in male infertility produced by the method of claim 3 or 4.

Images