KR102629157B1 - Recombinant vector for gene editing of Solanum lycopersicum using Potato Virus X vector and uses thereof - Google Patents

Abstract

The present invention provides, within the Potato Virus X vector, a nucleic acid sequence encoding an endonuclease protein; A nucleic acid sequence encoding hammerhead ribozyme; and DNA encoding a guide RNA specific to the target base sequence of a tomato-derived gene. The present invention relates to a recombinant vector for improving gene editing efficiency in tomato plants, wherein the vector is operably linked, and its use.

Description

Recombinant vector for gene editing of Solanum lycopersicum using Potato Virus X vector and uses thereof}

The present invention relates to a recombinant vector for gene editing of tomato plants using the Potato Virus

Since the CRISPR/Cas9-based programmable DNA molecular scissors technology was first reported in 2012, case studies of gene editing have been published in various horticultural crops. In particular, in 2021, the first gene-edited tomato variety with high GABA content was launched on the market in Japan. Unlike GMO (Genetically Modified Organism), which has previously been controversial, gene editing technology can be free from legal regulations in that no introduced foreign genes remain if components for gene editing are removed through generation after gene editing. In particular, technology to carry out gene editing by transporting CRISPR-Cas9 RNP (ribonucleoprotein) into protoplasts has been developed in many animal cells and plant cells, but this method has difficulties in redifferentiating cells without cell walls. In addition, the particle bombardment method, which performs gene editing by transporting the Cas9 protein and gRNA to cells using tungsten or gold particles, has the problem of low gene editing efficiency.

Meanwhile, gene editing technology using viruses has recently been developed by co-expressing Cas9 and gRNA using RNA viruses with large cargo capacity, such as Potato Virus Studies developing gene editing organisms have been published. Recently, cases of successful application of this Virus-induced gene editing (VIGE) system have been reported in tobacco or wheat.

Meanwhile, tomato ( Solanum lycopersicum ) is the most consumed horticultural crop in the world, and is a crop with diverse characteristics and great agricultural value. As consumers' income levels rise, the consumption of high-value crops is rapidly increasing. However, traditional breeding methods or breeding using molecular markers have the disadvantage of being costly and time-consuming for generation advancement. Gene correction through foreign gene insertion has the advantage of being able to quickly introduce desired traits, but is free from GMO regulations. There is a downside to not being able to do this.

Meanwhile, Korean Patent Publication No. 2023-0032679 discloses ‘Potato virus 'Virus-based replicon for genome correction without insertion of a replicon and its use' is disclosed, but in 'Recombinant vector for gene correction of tomato plants using Potato Virus X vector and its use' of the present invention. There is nothing written about it.

The present invention has been derived from the above-mentioned needs, and the present inventors have provided a nucleic acid sequence encoding an endonuclease protein in the Potato Virus A nucleic acid sequence encoding hammerhead ribozyme; and DNA encoding guide RNA specific for the target base sequence of the tomato-derived PDS (phytoene desaturase) gene; a recombinant vector (PVX-SlPDS-HH) was sequentially linked, and the recombinant vector (PVX- The gene correction efficiency of tomato plants inoculated with the Agrobacterium GV3101 strain inserted (SlPDS-HH) increases compared to the control group (tomato plants inoculated with the Agrobacterium strain inserted with a recombinant vector that does not contain a hammerhead ribozyme). confirmed. In addition, after inoculation with the Agrobacterium GV3101 strain into which the recombinant vector (PVX-SlPDS-HH) was inserted, the gene correction efficiency of tomato plants heat-treated at 37°C was higher than that of the control group (Agrobacterium into which the PVX-SlPDS-HH vector was inserted). The present invention was completed by confirming an increase compared to tomato plants that were not heat-treated at 37°C after inoculation with the Leeum GV3101 strain.

In order to solve the above problem, the present invention provides a nucleic acid sequence encoding an endonuclease protein within the Potato Virus A nucleic acid sequence encoding hammerhead ribozyme; and DNA encoding a guide RNA specific to the target base sequence of a tomato-derived gene.

Additionally, the present invention provides a composition for improving gene editing efficiency in tomato plants containing the recombinant vector as an active ingredient.

In addition, the present invention includes the steps of inoculating an Agrobacterium strain containing the recombinant vector into the tissue of a tomato plant and culturing it; and heat-treating the cultured tissue. A method for improving gene editing efficiency in tomato plants is provided.

The recombinant vector for gene correction of tomato plants using the Potato Virus It is expected to be very useful in reducing the time, cost and effort required for breeding. Additionally, the recombinant vector according to the present invention has the advantage of superior gene editing efficiency over the existing gene editing system using the Potato Virus

Figure 1 shows a schematic diagram of the PVX-SlPDS vector used in the present invention (A), a schematic diagram of the PVX-SlPDS-HH vector (B), a schematic diagram of the PVX-SlPDS-HH-Ter4 vector (C), and the production of the PVX-SlPDS-HH vector. This shows the sequence and structure (D) of the hammerhead ribozyme used in . RdRp: RNAdependent RNA polymerase, TGB: triple gene block, CP: coat protein, nosT: nopaline synthase terminator.
Figure 2 is a schematic diagram showing a method for checking whether a transformant is mutated using a primer and a restriction enzyme (RE) that amplifies a sequence containing a gene correction site.
Figure 3 shows the results of confirming the expression of foreign genes after inducing transformation of tomatoes using the PVX-SlPDS vector. (A) shows the negative control (Mock) plants that were not treated with anything and the PVX-SlPDS vector in tomato (Micro-Tom) plants. ) is a photo confirming the plant's phenotype 10 days after inoculation into the cotyledons, and (B) is a photo showing the PVX-GFP vector, which contains GFP instead of Cas9 and gRNA in the PVX-SlPDS vector, 10 days after inoculation into the cotyledons of tomato. This is a picture of the signal taken through a confocal microscope, and (C) is the RT-PCR result confirming the expression level of Cas9 and PVX coat protein (CP) 10 days after inoculation of the PVX-SlPDS vector into tomato cotyledons.
Figure 4 shows the results of confirming the expression level of Cas9 protein after inoculating tomato cotyledons with Agrobacterium GV3101, EHA105, or LBA4404 strains inserted with the PVX-SlPDS-HH vector, respectively. WT is tomato cotyledons inoculated with buffer not containing Agrobacterium strains, and H3 is Histone 3 protein used as an internal control. Different letters a and b in the drawing are significantly different from each other, p<0.05.
Figure 5 shows the inoculation of the Agrobacterium GV3101 strain into which the PVX-SlPDS vector was inserted into tomato cotyledons, followed by heat treatment at 37°C for 24 hours on the 7th day (H7) or 9th day (H9) of inoculation, and then using restriction enzymes. This is the result of confirming a mutation in the PDS gene. MOCK is the control group without heat treatment after inoculation with the PVX-SlPDS vector, and C is the control group that was inoculated with the Agrobacterium GV3101 strain into which the PVX-SlPDS vector was inserted into tomato cotyledons, and then heat treated at 26°C for 24 hours on the 7th day of inoculation. This is a control group.
Figure 6 shows that after inoculating the Agrobacterium GV3101 strain into which the PVX-SlPDS vector was inserted into tomato cotyledons, heat treatment was performed at 37°C for 24 hours on the 7th day (H7) or 9th day (H9) of inoculation, and then NGS (Next Generation) This is the result of confirming the PDS gene correction efficiency through Sequencing analysis. C is a control group that was inoculated into tomato cotyledons with the Agrobacterium GV3101 strain into which the PVX-SlPDS vector was inserted and then heat-treated at 26°C for 24 hours on the 7th day of inoculation.
Figure 7 shows that the Agrobacterium GV3101 strain inserted with the PVX-SlPDS vector (A) or the PVX-SlPDS-HH vector (B) was inoculated into tomato cotyledons, heat-treated at 26°C for 24 hours, and then treated with restriction enzymes. This is the result of confirming a mutation in the PDS gene in the cotyledons or upper leaves.
Figure 8 shows the Agrobacterium GV3101 strain inserted with the PVX-SlPDS vector or the PVX-SlPDS-HH vector was inoculated into tomato cotyledons and heat-treated at 26°C for 24 hours, and then the PDS gene was analyzed through NGS (Next Generation Sequencing) analysis. This is the result of confirming the correction efficiency.
Figure 9 shows the Agrobacterium GV3101 strain inserted with the PVX-SlPDS vector or the PVX-SlPDS-HH vector inoculated into tomato cotyledons, heat-treated at 37°C for 24 hours, and then confirmed for mutation in the PDS gene using restriction enzymes. It is a result.
Figure 10 shows NGS (Next Generation Sequencing) analysis after inoculating the Agrobacterium GV3101 strain into which the PVX-SlPDS-HH vector or PVX-SlPDS-HH-Ter4 vector was inserted into tomato cotyledons, respectively, and heat-treating them at 26°C for 24 hours. This is the result of confirming the efficiency of PDS gene editing.

In order to achieve the object of the present invention, the present invention includes a nucleic acid sequence encoding an endonuclease protein in a Potato Virus A nucleic acid sequence encoding hammerhead ribozyme; and DNA encoding a guide RNA specific to the target base sequence of a tomato-derived gene.

As used herein, the term "genome/gene editing" refers to a technology that can introduce target-oriented mutations into the genome sequence of animal and plant cells, including human cells, and refers to one or more nucleic acid molecules by cutting DNA. Knock-out or knock-in of specific genes by deletion, insertion, substitutions, etc., or non-coding that does not produce proteins. coding) refers to a technology that can introduce mutations into the DNA sequence. For the purpose of the present invention, the genome editing may be to introduce mutations into plants using endonuclease, such as Cas9 (CRISPR associated protein 9) protein and guide RNA. Additionally, “gene editing” can be used interchangeably with “gene editing.”

Additionally, the term “target gene” refers to some DNA in the genome of a plant to be corrected through the present invention, is not limited to the type of gene, and may include both coding regions and non-coding regions. A person skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be manufactured, depending on the purpose.

As used herein, the term “recombinant” refers to a cell that replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments that are not found in the natural form of the cell, either in sense or antisense form. Additionally, recombinant cells can express genes found in cells in their natural state, but the genes have been modified and reintroduced into the cells by artificial means.

The term “vector” is used to refer to a DNA fragment(s) or nucleic acid molecule that is delivered into a cell. Vectors replicate DNA and can reproduce independently in host cells. The term "vector" is often used interchangeably with "vector".

In the recombinant vector for improving the gene editing efficiency of tomato plants of the present invention, the nucleic acid sequence encoding the hammerhead ribozyme may be composed of the base sequence of SEQ ID NO: 4, but is not limited thereto.

In addition, in the recombinant vector for improving the gene editing efficiency of tomato plants of the present invention, the tomato-derived gene may be a PDS (phytoene desaturase) gene, and preferably has the base sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2. It may consist of, but is not limited to.

Additionally, in the recombinant vector for improving gene editing efficiency in tomato plants of the present invention, the target base sequence may be comprised of the base sequence of SEQ ID NO: 3, but is not limited thereto.

As used herein, the term "guide RNA" refers to a short single-stranded RNA that is specific to the target DNA among the base sequences encoding the target gene, and is complementary in whole or in part to the target DNA base sequence. It refers to a ribonucleic acid that binds and guides an endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA containing two RNAs, a crRNA (CRISPR RNA) and a tragRNA (trans-activating gRNA) as components; or a single chain comprising a first portion comprising a sequence that is fully or partially complementary to a base sequence in the target gene and a second portion comprising a sequence that interacts with an endonuclease (particularly an RNA-guided nuclease). It refers to a guide RNA (single guide RNA, sgRNA) form, but as long as the endonuclease is in a form that can be active at the target base sequence, it can be included within the scope of the present invention without limitation, and the type of endonuclease used together or endonuclease It can be manufactured and used according to techniques known in the art, taking into account the microorganism from which the nuclease is derived.

Additionally, the guide RNA may be transcribed from a plasmid template, transcribed in vitro (e.g., oligonucleotide double-stranded), or synthesized guide RNA, but is not limited thereto.

Additionally, in the recombinant vector for improving the gene editing efficiency of tomato plants of the present invention, the recombinant vector may include a Ter4 terminator consisting of the base sequence of SEQ ID NO: 36, but is not limited thereto.

In addition, in the recombinant vector for improving the gene editing efficiency of tomato plants of the present invention, the endonuclease protein is Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), and TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), or a functional analog thereof, and preferably Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Streptococcus thermophilus ( S. thermophilus ) or a Streptococcus aureus ( S. aureus )-derived Cas9 protein, Neisseria meningitidis -derived Cas9 protein, Pasteurella multocida -derived Cas9 protein, Francisella novicida -derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or its genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI). The Cas9 gene information may be a known sequence, or a sequence optimized for the codon of the target (organism) to be transduced, but is not limited thereto.

The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target base sequence and cut the DNA strand, a short base sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must exist next to the target base sequence, and the Cas9 protein must contain the PAM sequence (NGG) It is estimated and cut between the 3rd and 4th base pairs.

In the recombinant vector according to the present invention, the gRNA and the endonuclease protein form a ribonucleoprotein complex and can operate as RNA-Guided Engineered Nuclease (RGEN).

The CRISPR/Cas9 system used in the present invention is NHEJ, which induces insertion-deletion (InDel) mutations due to incomplete repair induced during the DNA repair process by introducing a double-strand break at a specific position of a specific gene to be corrected. It is a gene editing method using the (non-homologous end joining) mechanism.

The present invention also provides a composition for improving gene editing efficiency in tomato plants containing the recombinant vector as an active ingredient.

In the composition for improving gene editing efficiency in tomato plants of the present invention, the recombinant vector is the same as described above.

The present invention also includes the steps of inoculating and culturing an Agrobacterium strain containing the recombinant vector into the tissue of a tomato plant; and heat-treating the cultured tissue. A method for improving gene editing efficiency in tomato plants is provided.

In the method for improving gene editing efficiency in tomato plants of the present invention, the recombinant vector is the same as described above.

In the method for improving the gene editing efficiency of tomato plants of the present invention, the heat treatment may be performed at 32 to 42 ° C. for 20 to 28 hours, and preferably may be performed at 37 ° C. for 24 hours, but is limited thereto. It doesn't work.

In the method for improving the gene editing efficiency of tomato plants according to an embodiment of the present invention, the Agrobacterium strain may be preferably the Agrobacterium GV3101 strain, but is not limited thereto.

In the method for improving gene editing efficiency in tomato plants according to the present invention, treating the tissues of tomato plants with the composition refers to a transformation method. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the recombinant vector according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts ( Shillito et al., 1985, Bio/Technol.3: 1099-1102), microinjection method into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), various plant elements ( Agrobacterium tumefaciens (DNA or RNA-coated) particle bombardment (Klein et al., 1987, Nature 327: 70), invasion of plants or transformation of mature pollen or spores. It can be suitably selected from metastasis (non-complete) infection by a virus (EP 0 301 316), etc. A preferred method according to the invention involves Agrobacterium mediated DNA transfer.

In the method for improving the gene editing efficiency of tomato plants according to the present invention, the “tissue” inoculated with the strain is differentiated or undifferentiated plant tissue, such as, but not limited to, roots, stems, leaves, pollen, and spores. , egg cells, seeds and various types of cells used in culture, including single cells, protoplasts, shoots and callus tissue. Plant tissue may be in planta or in organ culture, tissue culture, or cell culture.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plant material

In the present invention, tomato ( Solanum lycopersicum ) 'Micro-Tom', a genetic resource from the Horticultural Crop Genetic Breeding Laboratory of Seoul National University, was used. The seeds of the 'Micro-Tom' were surface disinfected with 70% (v/v) ethanol for 1 minute, 2% (v/v) NaOCl containing Tween 20 for 15 minutes, and then washed with sterilized distilled water for 4~4 minutes. It was prepared by washing five times. 20 g/L sucrose and 8 g/L plant agar were added to 1/2 MS (Murashige and Skoog) medium, the pH was adjusted to 5.8 ± 1, and the disinfected and prepared seeds were plated and wrapped with aluminum foil. Cultured under dark conditions for 3 days, after which the foil was removed to induce uniform germination under light conditions. All cultures were cultured under fluorescent lights at a temperature of 24°C and a photoperiod of 16 hours of light/8 hours of darkness. Agrobacterium-mediated transformation was induced using cotyledons from seedlings 7 days after sowing, and on the 4th day after inoculation, the tissues were disinfected and placed on medium.

2. Guide RNA (gRNA) production and vector production

The Potato Virus The first exon of the tomato PDS (phytoene desaturase) gene (Sol Genomics Network, https://solgenomics) was identified using the CRISPR/Cas9 online prediction program CCTop (https://crispr.cos.uni-heidelberg.de/index.html). A gRNA targeting .net/) was produced, and a site that recognizes the restriction enzyme HinF I was inserted 2 bp away from the PAM site. Afterwards, the PVX-Cas9 vector containing Cas9 was purchased from the same place as the PVX vector, the gRNA sequence was inserted to construct the PVX-SlPDS vector (Figure 1A), and a hammerhead was inserted in front of the gRNA sequence of the PVX-SlPDS vector. The PVX-SlPDS-HH vector (Figure 1B) was created by inserting a ribozyme (hammerhead ribozyme). Primers used for vector construction are listed in Table 1 below. A PVX-GFP vector containing GFP instead of Cas9 and gRNA was created and used as a control.

Primers for PVX-SlPDS vector construction primer Base sequence 5'-3' (SEQ ID NO) Tm(℃) GC content (%) SIPDS-Mlu1-F1 TTAACTTGAGAGGTCCAGTTTTAGAGCTAGAAATA (5) 66.0 32.4 SlPDS-Mlu1-F2 ATGCACGCGTCTGTTAACTTGAGAGTCCA (6) 75.0 48.3 SIPDSH-Mlu1-F1 TGAGGACGAAACGAGTAAGCTCGTCCTGTTAACTTGAGAG (7) 78.9 47.5 SlPDSH-Mlu1-F2 TTGAACGCGTTAACAGCTGATGAGTCCGTGAGGACGAAAC (8) 83.7 50.0 PVX-Vec_R CGGCGGTCGACTGGGTCTAGAAAAAAAGCA (9) 79.1 53.3

3. Agrobacterium-mediated tomato transformation

For transformation of tomato plants, the PVX-GFP vector, PVX-SlPDS vector, or PVX-SlPDS-HH vector was inserted into the Agrobacterium strain using electroporation, respectively, and cultured on a solid medium containing kanamycin and spectinomycin. A single transformed colony was selected using . After culturing the selected Agrobacterium for 24 hours, OD ₆₀₀ = 0.3 in the inoculum containing 10 mM MgCl ₂ , MES (2-(N-morpholino)ethanesulfonic acid) buffer, and 200 uM acetosyringone. It was diluted as much as possible, and the inoculum was placed on a stirrer and incubated for 3 hours to prepare a suspension.

In addition, the cotyledons of tomato plants 4 days after sowing were sterilized by disinfecting with 70% (v/v) ethanol for 1 minute and 0.4% (v/v) bleach for 10 minutes. The terminal part of the cotyledons was cut and then cut into one piece. The cotyledons were divided into two pieces and cultured in preculture medium (Table 2) for 2 days, then inoculated with the prepared Agrobacterium suspension and reacted for 20 minutes, and the remaining Agrobacterium suspension was lightly dried on sterile filter paper. Then, it was plated on MS medium with the same composition. After 2 days, the seedlings were placed on shoot introduction medium (Table 2) and cultured for 14 to 21 days, and then the seedlings were placed on shoot elongation medium (Table 2) and cultured. After 30 to 50 days, the stem part grew to about 1 to 2 cm. were cut and cultured on root formation medium (Table 2). Afterwards, Western blot was performed using cotyledons of tomato plants 3 days after inoculation to analyze the production of foreign proteins.

Plant tissue culture media information badge Furtherance Culture date Freeculture Badge MS, 30 g/L sucrose, 4 g/L Phytagel, 1 mg/L NAA, 1 mg/L BAP 2 days suit introduction badge MS, 30 g/L sucrose, 4 g/L phytagel, 2 mg/L trans zeatin riboside, 1 mg/L IAA, 250 mg/L carbenicillin 14~21 days suit height badge MS, 30 g/L sucrose, 4 g/L phytagel, 1 mg/L trans zeatin riboside, 1 mg/L IAA, 250 mg/L carbenicillin 30~50 days root formation medium MS, 30 g/L sucrose, 4 g/L Phytagel, 1 mg/L IAA, 250 mg/L carbenicillin 14~21 days

NAA: 1-Naphthaleneacetic acid, BAP: benzylaminopurine, IAA: Indole-3-acetic acid

4. Nucleic acid extraction and PCR analysis

The leaf tissue of the tomato plant was homogenized using 3 mm steel beads and a tissue crusher (TissueLyserⅡ, Qiagen), and then subjected to CTAB (cetyltrimethylammonium bromide) method (Porebski et al., 1997, Plant Mol. Biol. Rep. 15;8- Genomic DNA was extracted through 15) and prepared at a concentration of 20 ng/μl. Expression of the inserted foreign genes Cas9 and PVX-CP was confirmed using the extracted genomic DNA and the primers shown in Table 3 below.

Primers for confirming foreign gene expression primer Base sequence 5'-3' (SEQ ID NO) Tm (℃) GC content (%) PVX-Cas-F TGGTTTCGATTCTCCTACCG (10) 64.3 50.0 PVX-Cas-R ATCAGCCCTTGAATCACCAC (11) 64.3 50.0 PVX-CP-F ACCAGCTAGCACAACACAGC (12) 63.6 55.0 PVX-CP-R GTAGTTATGGTGGTGGTAGAGTG (13) 59.5 47.8 SlActin-F AGTGGTGGTACTACCATGTTCCCA (14) 67.5 50.0 SlActin-R GAGGGAAGCCAAGATAGAGCCTCCA (15) 72.1 56.0 NbActin-F CCAGGTATTGCTGATAGAATGAG (16) 61.8 43.5 NbActin-R CTGAGGGAAGCCAAGATAGAG (17) 62.3 52.4

5. Selection of mutant individuals using restriction enzymes

Mutation of the transformant was confirmed by using a primer (Table 4) and restriction enzymes to amplify a 525bp product containing the correction site of the PDS (phytoene desaturase) gene (Figure 2). It was treated with the restriction enzyme HinF Ⅰ (NEB, USA), which recognizes 6bp inserted at a position 2bp away from the PAM site, and reacted at 37°C for 12 hours, then applied a voltage of 135V to a 2% agarose gel and lowered it for 30 minutes. . Afterwards, through band analysis, if two bands were observed, it was confirmed that the individual had not undergone a mutation, and if three bands were observed, it was confirmed that the individual had undergone a mutation.

Primers for mutation confirmation using restriction enzymes primer Base sequence 5'-3' (SEQ ID NO) Tm(℃) GC content (%) SlPDS-T-F AGCATTCGGTATCTTTTTCTGGGTAACT (18) 68.1 39.3 SlPDS-T-R CCAGCAAAACATAACGAATTCCTTTGCA (19) 72.9 39.3

6. Analysis of gene editing efficiency through NGS

To analyze the gene editing efficiency in tomato plants using the PVX-SlPDS vector or PVX-SlPDS-HH vector, next generation sequencing (NGS) analysis was performed using the Illumina Miseq platform. Primers (Table 5) were designed to amplify a 569bp product including the target region, and then sequencing analysis was performed.

Primers used to analyze gene editing efficiency primer Base sequence (5'-3') SlPDS_Miseq_1PCR_1F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACTTTGCTTAATTGTGCAGAAC (20) SlPDS_Miseq_1PCR_1F-1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACNTTTGCTTAATTGTGCAGAAC (21) SlPDS_Miseq_1PCR_1F-2 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACNNTTTGCTTAATTGTGCAGAAC (22) SlPDS_Miseq_1PCR_1F-3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNAACACNNNTTTGCTTAATTGTGCAGAAC (23) SlPDS_Miseq_1PCR_2F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATTTTGCTTAATTGTGCAGAAC (24) SlPDS_Miseq_1PCR_2F-1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATNTTTGCTTAATTGTGCAGAAC (25) SlPDS_Miseq_1PCR_2F-2 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATNNTTTGCTTAATTGTGCAGAAC (26) SlPDS_Miseq_1PCR_2F-3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTATNNNTTTGCTTAATTGTGCAGAAC (27) SlPDS_Miseq_1PCR_3F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNATCACGTTTGCTTAATTGTGCAGAAC (28) SlPDS_Miseq_1PCR_3F-1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNATCACGNTTTGCTTAATTGTGCAGAAC (29) SlPDS_Miseq_1PCR_3F-2 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNATCACGNNTTTGCTTAATTGTGCAGAAC (30) SlPDS_Miseq_1PCR_3F-3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNATCACGNNNTTTGCTTAATTGTGCAGAAC (31) SlPDS_Miseq_1PCR_1R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCTTGAGATAATAATTCAAGTC (32) SlPDS_Miseq_1PCR_1R-1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNGCCTTGAGATAATAATTCAAGTC (33) SlPDS_Miseq_1PCR_1R-2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNGCCTTGAGATAATAATTCAAGTC (34) SlPDS_Miseq_1PCR_1R-3 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNGCCTTGAGATAATAATTCAAGTC (35)

Example 1. Induction of transformation in tomato using PVX vector

The PVX-SlPDS vector with gRNA targeting the tomato PDS gene inserted (Figure 1A) and the PVX-GFP vector with GFP inserted instead of Cas9 and gRNA in the PVX-SlPDS vector were introduced into tomato plants through Agrobacterium strain inoculation. Transformation was induced. Afterwards, GFP signals were confirmed through confocal microscopy in the inoculated leaves 10 days after inoculation with the Agrobacterium strain into which the PVX-GFP vector was inserted, and inoculation with the Agrobacterium strain into which the PVX-SlPDS vector was inserted RT-PCR for Cas9 and CP genes was performed on inoculated leaves 10 days after cold storage.

As a result, it was confirmed that the tomato plants into which the PVX-SlPDS vector was introduced had no phenotypic differences from the negative control (Mock) plants that were not treated with anything (Figure 3A), and in the tomato plants into which the PVX-GFP vector was introduced, GFP was expressed normally. Expression was confirmed (Figure 3B), and Cas9 and CP genes were confirmed to be expressed normally in the tomato plants into which the PVX-SlPDS vector was introduced, confirming that the PVX-SlPDS vector was introduced and operated normally in the tomato plants (Figure 3C).

Example 2. Analysis of differences according to strain of Agrobacterium strains

The PVX-SlPDS-HH vector according to the present invention was inserted into Agrobacterium GV3101, LBA4404, or EHA105 strains and inoculated into tomato cotyledons, respectively. On the 3rd day, the inoculated leaves were sampled and Cas9 protein was detected through Western blot. As a control group, cotyledons (WT) inoculated with a buffer not containing the strain were used.

As a result, it was confirmed that Cas9 protein was normally detected in the Agrobacterium GV3101 strain, while a small amount of Cas9 protein was detected in the Agrobacterium EHA105 strain, and that Cas9 protein was almost not detected in the Agrobacterium LBA4044 strain (Figure 4) .

The above results showed that Agrobacterium GV3101 strain was most suitable for gene editing of tomatoes using the PVX-SlPDS-HH vector.

Example 3. By heat treatment PDS Gene editing efficiency analysis

After inoculating tomato cotyledons with the Agrobacterium GV3101 strain into which the PVX-SlPDS vector according to the present invention was inserted, the inoculated leaves on the 7th or 9th day were heat-treated in an incubator at 37°C (Hanbaek Science, KOREA) for 24 hours. Afterwards, it was treated with restriction enzyme HinF Ⅰ (NEB, USA), reacted at 37°C for 12 hours, placed on a 2% agarose gel, observed the band, and identified tomato PDS through NGS (Next Generation Sequencing) analysis. Gene editing efficiency was analyzed. As a control, inoculated leaves grown in an incubator at 26°C after inoculation with the Agrobacterium GV3101 strain into which the PVX-SlPDS vector was inserted were used.

As a result, only bands of 102bp and 423bp were identified in the negative control (Mock) plant that was not treated with anything, while bands of 102bp, 423bp, and 525bp were identified in the heat-treated plant (FIG. 5).

In addition, as a result of NGS analysis, the PDS gene correction efficiency of plants heat-treated at 37°C on day 7 (H7) or plants heat-treated at 37°C on day 9 (H9) was higher than that of control (C) plants heat-treated at 26°C. It was confirmed that it was done. In particular, the gene correction efficiency of control (C) plants heat-treated at 26°C is 31.11%, the gene correction efficiency of plants (H7) heat-treated at 37°C on day 7 inoculated leaves is 38.54%, and the gene correction efficiency of plants heat-treated at 37°C on day 9 are 38.54%. By confirming that the gene editing efficiency of one plant (H9) was 38.02%, it was found that the gene editing efficiency increased by about 7% by heat treatment at 37°C (FIG. 6).

Example 5. Analysis of gene editing efficiency by adding hammerhead ribozyme

To overcome the problem that gene correction does not occur in upper leaves when heat treatment is performed, we attempted to increase gene correction efficiency by using the PVX-SlPDS-HH vector, in which a hammerhead ribozyme was added to the PVX-SlPDS vector. .

5-1. Analysis of gene editing efficiency in upper leaves

After inoculating tomato cotyledons with the Agrobacterium GV3101 strain containing the PVX-SlPDS-HH vector, heat treatment was performed on the inoculated leaves on the 10th day in an incubator (Hanbaek Science, KOREA) at 26°C for 24 hours. Afterwards, it was treated with restriction enzyme HinF Ⅰ (NEB, USA), reacted at 37°C for 12 hours, placed on a 2% agarose gel, observed the band, and analyzed the tomato PDS gene editing efficiency through NGS analysis. did. As a control group, cotyledons (WT) inoculated with a buffer not containing the strain were used.

As a result, an uncut band (525 bp) was not confirmed in the upper leaves (the first upper leaf closest to the cotyledons) of plants inoculated with Agrobacterium into which the PVX-SlPDS vector was inserted, whereas the uncut band (525 bp) was not confirmed in the plants inoculated with Agrobacterium into which the PVX-SlPDS-HH vector was inserted. A band of 525 bp was confirmed in the upper leaves of plants inoculated with Agrobacterium (Figure 7).

In addition, as a result of NGS analysis, it was confirmed that the PDS gene correction efficiency of plants inoculated with Agrobacterium inserted with PVX-SlPDS-HH increased by more than about 20% compared to plants inoculated with the PVX-SlPDS vector (FIG. 8).

5-2. Analysis of gene editing efficiency according to heat treatment

After inoculating tomato cotyledons with the Agrobacterium GV3101 strain containing the PVX-SlPDS-HH vector, heat treatment was performed on the inoculated leaves on the 10th day in an incubator at 37°C (Hanbaek Science, KOREA) for 24 hours. Afterwards, it was treated with restriction enzyme HinF I (NEB, USA), reacted at 37°C for 12 hours, placed on a 2% agarose gel, and the band was observed. As a control, inoculated leaves grown in an incubator at 37°C after inoculation with the Agrobacterium GV3101 strain inserted with the PVX-SlPDS vector were used.

As a result, the PDS gene correction efficiency of plants inoculated with Agrobacterium inserted with PVX-SlPDS-HH and then heat-treated at 37°C increased compared to plants inoculated with Agrobacterium inserted with the PVX-SlPDS vector and then heat-treated at 37°C. It was confirmed that (FIG. 9).

Based on the above results, when the Agrobacterium GV3101 strain inserted with the PVX-SlPDS-HH vector according to the present invention is inoculated into tomatoes and then heat treated at 37°C, gene correction efficiency increases and gene correction is induced even in the upper leaves of tomato plants. By doing so, it was found that the targeted gene could be edited effectively.

Example 6. Analysis of gene editing efficiency according to terminator replacement of PVX-SlPDS-HH

In order to overcome the problem that gene correction does not occur in the upper leaves when heat treatment is performed, we attempted to increase gene correction efficiency by using a vector in which the existing terminator, nosT, was replaced with Ter4 in the PVX-SlPDS-HH vector. Ter4 (SEQ ID NO: 36) includes a portion of the 3' 35S sequence derived from cauliflower mosaic virus and an intronless tobacco extension 3' UTRc (EU) and t abacco Rb7 MAR (3) derived from tobacco ( Nicotiana tabacum ). ' It consists of part of the Rb7 MAR) sequence.

After inoculating tomato cotyledons with the Agrobacterium GV3101 strain containing the PVX-SlPDS-HH vector or PVX-SlPDS-Ter4, the inoculated leaves were heat-treated for 24 hours in an incubator at 26°C (Hanbaek Science, KOREA) on the 10th day. . Afterwards, the reaction was treated with restriction enzyme HinFI (NEB, USA), reacted at 37°C for 12 hours, run on a 2% agarose gel, and the intensity of the band was analyzed using the Image J program.

As a result, it was confirmed that the PDS gene correction efficiency in plants inoculated with Agrobacterium inserted with the PVX-SlPDS-Ter4 vector increased by about 10% compared to plants inoculated with Agrobacterium inserted with the PVX-SlPDS-HH vector. (Figure 10).

From the above results, when the Agrobacterium GV3101 strain inserted with the PVX-SlPDS-HH-Ter4 vector according to the present invention is inoculated into tomatoes, the gene editing efficiency is efficiently increased compared to PVX-SlPDS-HH, and the targeted It was found that genes can be edited effectively.

Claims (7)

delete delete delete delete Within the Potato Virus X vector, a nucleic acid sequence encoding the Cas9 protein; A nucleic acid sequence encoding a hammerhead ribozyme consisting of the base sequence of SEQ ID NO: 4; DNA encoding a guide RNA specific to the target base sequence of a tomato-derived gene; and a Ter4 terminator consisting of the base sequence of SEQ ID NO: 36; Agrobacterium GV3101 strain containing a recombinant vector for improving the gene editing efficiency of tomato plants, characterized in that operably linked to the tissues of tomato plants. Inoculating and culturing; and heat-treating the cultured tissue at 32 to 42°C. A method for improving gene editing efficiency in tomato plants. delete delete