KR20230067161A - Method for producing lettuce plant having late flowering trait by SOC1 gene editing and lettuce plant produced by the same method - Google Patents

Abstract

The present invention relates to a complex (ribonucleoprotein) of a guide RNA specific to a target sequence of a lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene and an endonuclease protein; Or a recombinant vector comprising DNA encoding a guide RNA specific to the target sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein; It relates to a dielectric correction composition for delaying and its use.

Description

Method for producing lettuce plants having late autumn traits by SOC1 gene editing and lettuce plants produced thereby

The present invention relates to a method for producing a genetically corrected lettuce plant having late autumn traits by gene editing of SOC1 (suppressor of overexpression of constans 1) derived from lettuce, and a genetically corrected lettuce plant having late autumn traits prepared by the method.

Lettuce ( Lactuca sativa L.) is an annual plant of the Asteraceae family and is used as a wrap vegetable and salad, and contains a large amount of vitamins, iron, fiber and antioxidants. Lettuce begins to be harvested 30 to 40 days after planting. If early growth due to environmental factors such as high temperatures or long days occurs, flower buds are differentiated before sufficient number of leaves are secured, shortening the harvest period, reducing production, and reducing quality. It falls. As lettuce promotes differentiation and growth of flower buds at a high temperature of 25℃ or higher, cultivation in late spring after May or summer before late July should be avoided in flatlands. It is known that the cultivation period can be extended by cultivating in the early spring or autumn after August as much as possible in the flatland, but in the low temperature period of 15 ℃ or less to be suitable for growth. When there is a risk of early growth due to high temperature during cultivation, single treatment or blocking sunlight can slightly delay growth. Treatment with maleeic hydrazide (MH) or cycocel (CCC), which are growth inhibitors, can delay growth of lettuce, but has the disadvantage of inhibiting growth itself. In the case of globular lettuce, it is known that the Great Lake line is insensitive to high temperatures and has late autumn traits, but the growth characteristics of irregular globular lettuce cultivated in Korea have not been identified in detail for each variety.

On the other hand, the CRISPR/Cas9 system is a genome (genome) editing method called CRISPR (Clustered regularly interspaced short palindromic repeat, CRISPR) gene scissors, which uses a guide RNA that specifically binds to a specific base sequence and a specific base sequence. It is composed of the Cas9 (CRISPR associated protein 9) endonuclease enzyme, which serves as a pair of scissors to cut. Using this CRISPR/Cas9 system, it is possible to knock-out the function of a specific gene in a cell or animal.

On the other hand, Korean Patent Registration No. 2113500 discloses 'a method for producing a genome-corrected cabbage plant having late autumn traits by correcting the SOC1 gene and the resulting plant', and Korean Patent Publication No. 2020-0066967 discloses ' FT gene A method for producing a genome-corrected Chinese cabbage plant having late autumn traits by correction and a plant accordingly is disclosed, but a 'method for producing a lettuce plant having late autumn traits by SOC1 gene correction and a lettuce plant produced thereby' are disclosed. ' Nothing is mentioned about it.

The present invention was derived from the above needs, and the present inventors developed a CRISPR/Cas9 system targeting the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene to prepare genetically corrected lettuce plants having late autumn traits. It was introduced into lettuce protoplasts and the indel efficiency of the SOC1 gene by specific guide RNA was analyzed. Among them, a guide RNA with high indel efficiency was selected and gene correction was performed on the lettuce protoplasts. The present invention was completed by confirming that the lettuce plants were delayed in growth compared to wild-type lettuce plants.

In order to solve the above problems, the present invention is a guide RNA specific to the target sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene and a complex of endonuclease (endonuclease) protein (ribonucleoprotein); Or a recombinant vector comprising DNA encoding a guide RNA specific to the target sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein; Provided is a composition for dielectric correction for delaying.

In addition, the present invention (a) introduces a guide RNA and an endonuclease protein specific to the target sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene into lettuce plant cells to generate genome correcting; and (b) regenerating lettuce plants from the genome-corrected lettuce plant cells.

In addition, the present invention provides a genome-corrected lettuce plant with delayed growth prepared by the above method and a genome-corrected seed thereof.

Since the genome-corrected lettuce plants prepared through the production method of the present invention have traits with delayed growth compared to lettuce plants without genome correction, increase in yield as well as product value improvement through flowering control can be expected. In addition, since the method according to the present invention induces mutations that are indistinguishable from natural mutations, cost and time are saved, unlike GMO (Genetically Modified Organism) crops, which require enormous costs and time to evaluate safety and environmental hazards. Expect to be able to do it.

Figure 1 shows the Target 1 and Target 2 sites selected in the SOC1 gene of lettuce for gene editing.
Figure 2 is a result (B) of analyzing Indel efficiency after introducing RNP (ribonuclease protein) containing a guide sgRNA1 specific to the Target 1 site and Cas9 protein into lettuce protoplasts. A is the result of analyzing the Indel efficiency of the control group injected only with Cas9 protein.
Figure 3 is a result (B) of analyzing Indel efficiency after introducing RNP (ribonuclease protein) containing a guide sgRNA2 specific to the Target 2 site and Cas9 protein into lettuce protoplasts. A is the result of analyzing the Indel efficiency of the control group injected only with Cas9 protein.
Figure 4 shows the process of regenerating lettuce plants from lettuce protoplasts into which ribonuclease protein (RNP) containing sgRNA1 and Cas9 proteins was introduced, A is a protoplast cell, B is a microcalli formed from a protoplast single cell , C is a callus cultured in a callus induction medium, D is a callus with shoot formation, E is a shoot with roots formed in MS medium, F is a lettuce plant undergoing soil adaptation, and G is a lettuce plant that has completed regeneration. .
Figure 5 is the result of analyzing the expression level of flowering control subgenes of SOC1 gene-corrected lettuce plants, analyzing the expression levels of LFY (A) gene, APL1 gene (B), APL2 gene (C) and FUL gene (D) is a result WT: wild-type lettuce plants without SOC1 gene correction.
Figure 6 is the result of observing the phenotype of SOC1 gene correction lettuce plants. WT: wild-type lettuce plants without SOC1 gene correction. Scale bar=2 cm.

In order to achieve the object of the present invention, the present invention is a guide RNA specific to the target sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene and a complex of endonuclease (endonuclease) protein (ribonucleoprotein); Or a recombinant vector comprising DNA encoding a guide RNA specific to the target sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein; Provided is a composition for dielectric correction for delaying.

As used herein, the term "genome/gene editing" refers to a technology capable of introducing target-directed mutations into genomic sequences of animal and plant cells, including human cells, and includes one or more nucleic acid molecules by cutting DNA. Knock-out or knock-in of a specific gene by deletion, insertion, substitution, etc., or non-coding that does not produce a protein Coding refers to a technology that can introduce mutations into DNA sequences. For the purposes of the present invention, the genome editing may be to introduce mutations into plants using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and guide RNA. In addition, 'gene editing' may be used interchangeably with 'gene editing'.

In addition, the term "target gene" refers to some DNA in the genome of a plant to be corrected through the present invention, and is not limited to the type of gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be produced, depending on the purpose.

In the composition for genome editing according to one embodiment of the present invention, the target gene may be lettuce-derived SOC1 (Supperssor of overexpression of constans 1) gene, preferably composed of the nucleotide sequence of SEQ ID NO: 1. Not limited.

In addition, the term "guide RNA" refers to a short single-stranded RNA, which is specific for a target DNA among base sequences encoding a target gene, and binds to the target DNA base sequence in whole or in part complementarily. It means ribonucleic acid that serves to guide the endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain comprising a first region comprising a sequence complementary in whole or in part to a base sequence in a target gene and a second region comprising a sequence interacting with an endonuclease (particularly, an RNA-guided nuclease). Guide RNA (single guide RNA, sgRNA) form, but if the endonuclease can be active in the target sequence, it can be included in the scope of the present invention without limitation, and the type of endonuclease used together or endo It can be prepared and used according to known techniques in the art in consideration of the microorganism derived from the nuclease.

In addition, the guide RNA may be a guide RNA transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide duplex), or synthesized guide RNA, but is not limited thereto.

In the genome editing composition according to the present invention, the guide RNA is designed specifically for the target nucleotide sequence of the lettuce-derived SOC1 gene, and the target nucleotide sequence may preferably consist of the nucleotide sequence of SEQ ID NO: 2, Not limited to this.

In addition, in the genome editing composition according to the present invention, the endonuclease protein is Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analogue thereof It may be one or more selected from the group consisting of, preferably Cas9 or Cpf1, etc., more preferably a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophilus ( S. thermophilus ) or Streptococcus aureus ( S. aureus ) derived Cas9 protein, Neisseria meningitidis ( Neisseria meningitidis ) derived Cas9 protein, Pasteurella multocida ( Pasteurella multocida ) derived Cas9 protein, Francisella novicida ( Francisella novicida ) derived Cas9 protein, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from known databases such as GenBank of National Center for Biotechnology Information (NCBI). For the Cas9 gene information, a known sequence may be used as it is or a sequence optimized for the codon of a target (organism) to be transduced may be used, but is not limited thereto.

The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must be present next to the target sequence, and the Cas9 protein has a PAM sequence (NGG) It is cut by estimating between the 3rd and 4th base pairs from .

In the composition for genome editing according to the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).

The CRISPR/Cas9 system used in the present invention introduces a double helix break at a specific position of a specific gene to be corrected, thereby inducing insertion-deletion (InDel) mutations caused by incomplete repair induced in the DNA repair process. (non-homologous end joining) is a gene editing method.

The present invention also

(a) introducing a guide RNA and an endonuclease protein specific for the target sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene into lettuce plant cells to correct the genome; and

(b) re-differentiating lettuce plants from the genome-corrected lettuce plant cells;

In the production method according to one embodiment of the present invention, the target nucleotide sequence and endonuclease protein of the lettuce-derived SOC1 gene are the same as described above.

In the production method according to the present invention, introducing the guide RNA and endonuclease protein of step (a) into lettuce plant cells is a guide RNA specific to the target sequence of the SOC1 gene derived from lettuce and an endonuclease a complex of proteins (ribonucleoprotein); Or a recombinant vector comprising DNA encoding a guide RNA specific to the target sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein; may be used, but is not limited thereto.

In the production method according to the present invention, the method for transducing the complex of guide RNA and endonuclease protein into plant cells is the calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72- 74; Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts (Shillito et al., 1985, Bio/Technol. 3:1099-1102), brown rice as plant element injection (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70) , infection by bacteria in Agrobacterium tumefaciens mediated gene transfer (incomplete), and the like.

In addition, introducing a recombinant vector containing DNA encoding a guide RNA specific to the target sequence and a nucleic acid sequence encoding an endonuclease protein into plant cells refers to a transformation method. Transformation of plant species is now common for plant species including both dicotyledonous as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vectors according to the invention into suitable progenitor cells.

In the manufacturing method according to the present invention, the "plant cell" into which the target sequence-specific guide RNA and endonuclease protein are introduced can be any plant cell. A plant cell is a cultured cell, cultured tissue, cultured organ or whole plant. "Plant tissue" refers to differentiated or undifferentiated plant tissue, including, but not limited to, roots, stems, leaves, pollen, microspores, ovules, seeds, and various types of cells used in culture, i.e., single cells, Includes protoplast, shoot and callus tissues. The plant tissue may be in planta or may be in organ culture, tissue culture or cell culture. Preferred plant cells according to the present invention are protoplasts.

In the production method of the present invention, any method known in the art may be used as a method for regenerating genome-corrected plants from genome-corrected plant cells. The genome-corrected plant cell must regenerate into a whole plant. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vols. 1-5, 1983-1989 Momillan, N.Y.).

The present invention also provides a genome-corrected lettuce plant with delayed growth prepared by the above method and a genome-corrected seed thereof.

The genome-corrected lettuce plant with delayed planting according to the present invention is a lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene corrected using the CRISPR/Cas9 system, and a lettuce plant in which the SOC1 gene is knocked out and the genome is not corrected. It is a genome-edited lettuce plant with a trait with delayed growth compared to .

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plant material

Seeds of lettuce ( Lactuca sativa L.) cultivar Cheongchima were purchased from Nongwoo Bio and used. The seeds were sterilized in 70% (v/v) ethanol, 0.4% (v/v) hypochlorite solution for 15 minutes, washed three times with distilled water, and then plated on MS (Murashige and Skoog) medium. 16 hours light / 8 hours dark photoperiod, 20 ~ 25 ℃ was cultured.

2. Guide RNA design

In order to perform gene correction targeting the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene, the sequence of the lettuce-derived SOC1 gene was obtained from the Lettuce Genome Resource (https://lgr.genomecenter.ucdavis.edu/). Two target sites (Target 1 or Target 2) were selected from the SOC1 gene (Fig. 1, Table 1), and each target was selected using the CRISPR RGEN Tool (http://www.rgenome.net/cas-designer/). A site-specific guide RNA (sgRNA1 or sgRNA2) was designed.

Lettuce-derived SOC1 gene Target sequence for proofreading target sequence sequence (direction) sequence number One GAGGGAAGACTCAAATGCGG(5'-3') 2 2 GAAGCATGAAACAGCTACTA (5'-3') 3

3. Protoplast Isolation and Gene Editing

On the 7th day of cultivation, the cotyledons of lettuce were incubated in the dark at 25 ° C for 4 to 6 hours in an enzyme solution (1% Viscozyme, 0.5% Celluclast, 0.5% Pectinex, 9% mannitol, 3 mM MES, CPW solution, pH 5.7). ) was incubated with stirring at 40-50 rpm and then diluted with the same amount of W5 solution (2 mM MES, 154 mM NaCl, 125 mM CaCl ₂ , 5 mM KCl). The mixture was filtered, and protoplasts were recovered by centrifugation at 114 g for 5 minutes in a round bottom tube, resuspended in W5 solution, and counted under a microscope using a hemacytometer. 1×10 ⁶ protoplast cells were prepared by diluting with MMG (0.4 M mannitol, 15 mM MgCl ₂ , 4 mM MES) solution.

Recombinant Cas9 protein (3 μg) and sgRNA (1 μg) were mixed and reacted at room temperature for 10 minutes to prepare a ribonuclease protein (RNP) mixture. Thereafter, the RNP mixture and the PEG solution (40% (w/v) PEG 4000, 0.2 M mannitol, 0.1 M CaCl ₂ ) were added to 1×10 ⁶ protoplast cells and reacted at room temperature for 10 minutes. Then, the pellet obtained by washing with W5 solution and centrifuging at 55 g for 5 minutes was added to the protoplast culture medium (MS salts, 0.4 mg/ℓ thiamine, 100 mg/ℓ myo-inositol, 30 g/ℓ sucrose, 0.2 mg/ℓ 2,4-D, 0.3 mg/ℓ BA), and cultured at 25° C. for 48 hours in the dark to induce gene correction.

4. Deep sequencing

Genomic DNA was extracted from the gene-corrected protoplasts using AccuPrep® Genomic DNA Extraction Kit (BIONEER, K-3032). After PCR was performed using the primers in Table 2 below, nucleotide sequences were analyzed using Illumina MiSeq (v2, 300 cycles), and Indel efficiency was analyzed using Cas-Analyzer.

Primer information used for PCR analysis Primer name Base sequence (5'→3') sequence number 1 ^ST PCR F TGTAACTTGAACATGCGACCATAC 4 1 ^ST PCR R CATTATAAGGAAAAAGAACCCACAAAC 5 Adapt PCR F TGCGACCATACCACTTTCAA 6 Adapt PCR R AAGCAACTCAGCATCACAA 7

Example 1. Indel efficiency analysis of guide RNA according to target site

Guide RNA (sgRNA1 or sgRNA2) specific to Target 1 or Target 2 and RNP containing Cas9 protein were introduced into lettuce protoplasts, and then Indel efficiency was analyzed.

As a result, the Indel efficiency of the control group injected only with Cas9 protein was 0%, whereas the indel efficiency of the experimental group injected with RNP containing sgRNA1 and Cas9 protein was about 7.5% (Fig. 2), and the indel efficiency of the control group containing sgRNA2 and Cas9 protein was It was confirmed that the Indel efficiency of the experimental group injected with RNP was about 1.5% (FIG. 3).

Based on the above results, sgRNA1 with high Indel efficiency among the two sgRNAs was finally selected.

Example 2. SOC1 Characterization of genetically modified lettuce plants

SOC1 Lettuce plants were regenerated from the gene-edited lettuce protoplasts (FIG. 4).

(1) Gene expression level analysis

Flowering regulatory subgenes related to the SOC1 gene include LFY (LEAFY), APL1 (APETALA-like 1), APL2 (APETALA-like 2), and FUL (FRUITIFUL) genes.

RNA was extracted from the leaves of lettuce plants in which the SOC1 gene was corrected through gRNA1, cDNA was synthesized, and qPCR analysis was performed on flowering control subgenes using the primers shown in Table 3 below.

Primer information used for qPCR analysis gene Base sequence (5'→3') sequence number LFY F:TCTGTCATGCTGAACGCAGC 8 R:CTAAAACTGGAGATGACCACCACC 9 APL1 F:GAGAAGCTGGACCCTGGAGT 10 R:TGCTTCTTGTATGGCCTTTCCC 11 APL2 F:GGGAAGACCTTGAGCCTTTGA 12 R:TGGTGGTGGCTGATGAGTCT 13 FUL F:ATGCCGATGTCGCACTCATC 14 R:TGTTCCAGAGACCAGCTTTCCT 15 PP2AA3 F:CATGCAATGGTTACAAGACAAGGTAT 16 R:CAAACTCCTCCGAAGTCTCTTC 17

As a result, it was confirmed that the expression of flowering control subgenes in SOC1 gene-corrected lettuce plants was decreased compared to the control group (WT) (FIG. 5).

(2) Phenotypic analysis

In order to analyze the phenotype of lettuce plants whose SOC1 gene was corrected through gRNA1, lettuce plants regenerated from protoplasts and wild-type (control) lettuce plants were grown outdoors for 120 days.

As a result, it was confirmed that the SOC1 gene-corrected lettuce plants formed shorter shafts and delayed growth compared to the control group (FIG. 6).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Method for producing lettuce plant having late flowering trait by SOC1 gene editing and lettuce plant produced by the same method <130> PN21320 <160> 17 <170> KoPatentIn 3.0 <210> 1 <211> 3223 <212> DNA <213> Lactuca sativa <400> 1 atggtgagag ggaagactca aatgcggagg attgaaaatg ctacaagtag acaagtgacc 60 ttctccaaaa gaagaaatgg tttgttgaag aaagcgtttg aactttctgt gctttgtgat 120 gctgaggttg ctttgatcat cttctctcca agaggcaaac tttatgaatt tgcaagctca 180 aggttccatt tttctcactt aatcatcaaa atttgtaaat tctaatttcg ggattcttat 240 tcgtataatc ttgattttaa ttctgggttt caaatttatt tcccttttat ctactcaatg 300 catatattca tacgcgtatg cacaaacgga tctgaaaata gataacatca aagagaacca 360 tgatcatttt gatcttttct tgattctggt ttgtgggttc ttttccttat aatgatttct 420 attctgggtt taaaatattc tttctttat atactgttat ttagtttcca aactcaaggt 480 tccatttttc tcacttaaat ttcatgtttt cttgattcta aagtgtttta aaacactatt 540 aatccaacca attccagtgt atactttctt ttccatagta atgggcttca atcttctttc 600 tgatgttatc tacacaaggc acatacacag agatctatta agatacttgt gtcggacata 660 aaatgttatt tgctcgaata tggttaaccg gatctttata tgaataaaaa gggatacaat 720 attatggaat tgaaatttta attagtttca aatgcttatt gaacgctttc atgattagtt 780 tcgtacaaaa tacttactct atacatataa agatagaacc ttttttgaat ctcgagtttc 840 taccgaaatt tagagaattt taaatatata taaatgaaga gcatataact ataggaagtg 900 aggtcaatct gtgtttcctc ttagtccagt caaataataa taaagaaatg atattagtat 960 attaatataa atttttgata aaaataataa aaaatgatat gatctgattg actcttgtct 1020 ggcatgtttt gatcagttaa cttgaaatgg tgtatttcat attcatcata cgaatacgaa 1080 gaatgtcaca gcttttactt ttctgatttt actataaaaa gcatctgttt acaattagtt 1140 ttatataaat ttagtacaat attcattgtg tttaatatat ttaaataaca gtaacaaaaa 1200 tagtatctct tcttttacat atattgccct atataaactt aacattatta tattcaagtt 1260 atatatagaa aagccgactc gggtgcttga aattaagata tcatgagtgg ttttctcatg 1320 ttttgataag tataataata gtttttcgaa aggtcaaaac aaacacaatt gctataatca 1380 gtcttaagta ttagatgacc aattgttaca atttacaaaa atgtcctcaa acaagtgttc 1440 ggattcagaa tgtttacata taacttctat tttattaagt tttaaagatc actgtacata 1500 gaattgaaca tttgttttcc ttattgaatc aatgtcaact caaagccctg atgaacacgg 1560 ccttgcgaaa tatgtatgtg tctttctttt tctgtttgaa aaaactcgta tacagcatat 1620 atgtatatcc atgaattcat atgatagatg natacatgag ttttgtttta tatattttcc 1680 atggcttttt ttgggcaatg attgcatctt ttttttgggt tttgaaatca ttcagcatgc 1740 aggagacaat tgaacgatat agaagtcacg taaaagatgt tcaaacagaa aattcttcga 1800 gtatagaaga tgttcaggtt cacagacata tataattcgg ttgtttgttt ttgaatttgt 1860 ttttgatata tataattcgg ttgtttgttt ttgaatttgt ttttgatata tatgtacaaa 1920 caatattcaa aagatgaacg ttgtttgttt ttaatttgaa tttgtttttg atatatataa 1980 ttcggttgtt tgtttttgaa tttgtttttg atatatataa ttcggttgca gcatttgaag 2040 catgaaacag ctactatggc aaagaaggta gaactcctag aagttgcaaa aaggtacaat 2100 tttatggttt aatcattgaa aatatacttt atatgcttct gaagatcaaa tgctgatgga 2160 aaaaccacaa aaataggatg aaaaatggct actgatcatt ttaaaatcat taatgcagca 2220 ggcaaaaggg tgaaattttt gtctatctga tgcatgcttc tgaggtttcg aatctcacta 2280 aattaaaatt aaaagaaatt aaacaagaga aaaagaatgt ttcctgatct tacaattgtt 2340 gatgttgcca aaaattgcta tttattaatc aatacgagta tatttggatt gtattttaaa 2400 taaacaaaca agcacacaca cacacacaca gattcatata tacaattaaa gaaaaaaaga 2460 tggctactga tcttagttgc aatgcaggaa acttttggga gaagggttag gatcaagcac 2520 cattgaagag atagttcaga ttgagcaaca gctggagagg agcgtacgca ttgttcgagc 2580 aagaaaggtt taaaaaatag ttacttatta tcaaagaatt attcttcctt cttcaattcc 2640 atatcaattt tagggtttat ggttgaatct ttaacattct tttgttgaat acttgacgtt 2700 ttagatgcaa gtctacaatg aacagattga gcaactacaa gcaaaggtac acagcttaat 2760 gattccaaac ctacccattt atgctatata taactcaaaa cgctcatatt tagctagagt 2820 ggatgtacaa gttttatgga atgatttaca tgttgtccaa tgcgagaact tcattaatat 2880 gggaggaagg gtttttttcg agaaactaat aaactatagt atttcttttt tatgtggatc 2940 ttcaggagaa actgctagca gctgaaaatg catcacttac tgagaaggtt agtatagttt 3000 ttcttccgta tctcctggaa gcatgttgtt caacctgcat aatgatctaa gagttaaatc 3060 tgtgtttttt ggcattcagt gcttaatcca aacagaccaa ggaacagaag aaatgagacc 3120 ggatttacgt gttgttgata acgaggagaa ctcagatgtg gaaacggaat tgttcatcgg 3180 accaccagag gtcaggagaa cgaagcaaag atggtcaaag tag 3223 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> target sequence <400> 2 gagggaagac tcaaatgcgg 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> target sequence <400> 3 gaagcatgaa acagctacta 20 <210> 4 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 tgtaacttga acatgcgacc atac 24 <210> 5 <211> 26 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 cattataagg aaaagaaccc acaaac 26 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 tgcgaccata ccactttcaa 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 7 aagcaacctc agcatcacaa 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 8 tctgtcatgc tgaacgcagc 20 <210> 9 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 9 ctaaaactgg agatgaccac cacc 24 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 10 gagaagctgg accctggagt 20 <210> 11 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 11 tgctcttgta tggcctttcc c 21 <210> 12 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 12 gggaagacct tgagcctttg a 21 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 13 tggtggtggc tgatgagtct 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 14 atgccgatgt cgcactcatc 20 <210> 15 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 15 tgttccagag accagcttcc t 21 <210> 16 <211> 26 <212> DNA <213> artificial sequence <220> <223> primer <400> 16 catgcaatgg ttacaagaca aggtat 26 <210> 17 <211> 23 <212> DNA <213> artificial sequence <220> <223> primer <400> 17 caaactcctc cgcaagtctc ttc 23

Claims (8)

a complex (ribonucleoprotein) of a guide RNA specific to a target sequence of a lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene and an endonuclease protein; Or a recombinant vector comprising DNA encoding a guide RNA specific to the target sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein; A composition for dielectric correction for delaying. The composition according to claim 1, wherein the target nucleotide sequence of the suppressor of overexpression of constans 1 ( SOC1 ) gene is composed of the nucleotide sequence of SEQ ID NO: 2. (a) introducing a guide RNA and an endonuclease protein specific for the target sequence of the lettuce-derived SOC1 gene into lettuce plant cells to correct the genome; and
(b) regenerating lettuce plants from the genome-corrected lettuce plant cells; a method for producing a genome-corrected lettuce plant with delayed growth. The method of claim 3, wherein introducing the guide RNA and endonuclease protein of step (a) into the lettuce plant cells is a complex of guide RNA and endonuclease protein specific for the target sequence of the SOC1 gene (ribonucleoprotein ); or a recombinant vector comprising DNA encoding a guide RNA specific to the target sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein. The preparation method according to claim 3, wherein the target nucleotide sequence of the SOC1 gene consists of the nucleotide sequence of SEQ ID NO: 2. The method according to claim 3, wherein the plant cell is a protoplast. A genome corrected lettuce plant with delayed growth prepared by the method of any one of claims 3 to 6. A seed whose genome is corrected in a lettuce plant according to claim 7.

Images