CN114703189A - Fraxinus mandshurica U6 gene promoter proFmU6.3, and cloning and application thereof - Google Patents
Fraxinus mandshurica U6 gene promoter proFmU6.3, and cloning and application thereof Download PDFInfo
- Publication number
- CN114703189A CN114703189A CN202210336615.6A CN202210336615A CN114703189A CN 114703189 A CN114703189 A CN 114703189A CN 202210336615 A CN202210336615 A CN 202210336615A CN 114703189 A CN114703189 A CN 114703189A
- Authority
- CN
- China
- Prior art keywords
- promoter
- fraxinus mandshurica
- gene
- fraxinus
- mandshurica
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a fraxinus mandshurica U6 gene promoter proFmU6.3 and cloning and application thereof. The invention successfully clones a fraxinus mandshurica RNA polymerase III type promoter, namely a fraxinus mandshurica endogenous U6 gene promoter proFmU6.3 for the first time, successfully constructs a fraxinus mandshurica U6 gene promoter activity detection vector, and proves that the promoter has high-efficiency transcription activity through transient transformation of fraxinus mandshurica seedlings and GUS (glucuronidase) staining verification, thereby providing a high-efficiency promoter sequence for transformation research of fraxinus mandshurica and related plants.
Description
Technical Field
The invention belongs to the technical field of biology, particularly the technical field of plant transgenosis, and particularly relates to a fraxinus mandshurica RNA polymerase III type promoter, more particularly to a fraxinus mandshurica U6 gene promoter proFmU6.3, and further discloses a cloning method and application thereof.
Background
The fraxinus mandshurica is a larch of fraxinus of Oleaceae, is classified as a gradually dangerous species for national secondary protection, has high overall strength, good shock resistance and excellent wood quality, is commonly used for buildings, furniture and the like, and has important economic value. After the tobacco transgenic plant is obtained for the first time in 1983, the genetic transformation of the woody plant is also regarded as important component of forest genetic engineering, and plays an important role in disease resistance, insect resistance, character improvement and genetic engineering breeding of the woody plant. In the field of life sciences, mutants have a crucial role in the study of gene function. However, the generation cycle of forest trees is long, the genetic heterozygosity is high, the genome ploidy is complex, the traditional random mutagenesis method usually needs to construct a large-population mutant library and carry out large-scale screening to obtain the mutant with the function loss of the target gene, and a large amount of manpower and material resources are needed in the process. In contrast, the genome site-directed editing technique has great advantages, and can directly introduce mutation at a specific position of the genome.
The CRISPR/Cas9 system is the most promising gene editing technology recognized at present, and Cas9 enzyme directionally cuts a target site under the guidance of sgRNA to accurately edit a target gene. Compared with Zinc Finger Nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) technologies, the CRISPR/Cas9 system has the advantages of simple design process, convenient operation and high gene editing efficiency, and can be rapidly and widely applied to research of animals, plants and microorganisms once being developed. Since the CRISPR/Cas9 was first used in the model plants Arabidopsis and tobacco in 2013, the gene editing system has been applied to plants of 24 family 45 genera (Applications et al, plains, Plant, etc.) including rice (Nekrasov et al, Nat Biotechnol,2013,31 (8):691-693.), wheat (Wang et al, Nature biotechnology,2014,32(9):947-951.), maize (Zhen et al, Journal of Genetics and Genomics,2014,41(2):63-68.), sorghum (Jiang et al, Nucleic acids research,2013,41(20): 188), brachypodium distachyle, tomato (Brooks et al, Physiology,2014,166 (1292): 1297) etc., with the prospect of improved yield in plants (Applications, plain et al, plains, plain et al, plain, 1138, 2020, and 2020). The CRISPR/Cas9 system also plays a great promoting role in the function research and genetic improvement of forest genes. However, compared with herbaceous plants and food crops, the CRISPR/Cas9 system has lagged related research and application in woody plants, and most of them are still in the establishment stage of gene editing systems. Citrus is the woody plant that was the first attempt to use CRISPR/Cas9 for gene editing, and moreover this technology has also been successfully applied to actinidia, vitis, malus, punica, coffea, theobroma, manioc, and the like. Meanwhile, the successful application of the CRISPR/Cas9 system in economic woody plants such as poplar and the like shows the great potential of the CRISPR/Cas9 system in the aspects of regulating and controlling the stress tolerance of plants, shortening the breeding cycle of forest trees and the like, realizes the cultivation of new varieties of forest trees such as drought resistance, disease resistance and the like, provides a new approach for the basic research and molecular breeding of forest trees, and provides a new thought for accurately improving the plant properties and breeding new varieties.
In order to improve the gene editing efficiency of the CRISPR/Cas9 system, the vector is continuously optimized. The sgRNA that determines target specificity is a small RNA with a specific secondary structure, usually driven by a U3/U6 series promoter. The U3/U6 promoter is one of important elements of a CRISPR/Cas9 gene editing system, the transcription start sites of the promoter are A and G respectively, and the transcription activity is high. Wherein U3 is used for monocotyledons, U6 is used for dicotyledons. The U3 or U6 promoter with a defined start site is selected to precisely direct the transcription of sgrnas, thereby reducing off-target effects from transcription of unrelated DNA. Although U3/U6 has been successfully used in gene editing of multiple species, the same promoter is not always suitable for use in species with distant homology, and multiple U3 or U6 promoters are often present in the same species gene, and their activities and transcription efficiencies are different. Therefore, the endogenous U3/U6 promoter of a more target plant is cloned, and the improvement of a CRISPR/Cas9 gene editing system is facilitated. Cloning two PeU3 promoters in Phyllostachys pubescens by Whitmania et al and truncating the promoters at different lengths, and finding that the transcription activities of different promoters and the same promoter are different at different truncating lengths (Whitmania et al, plant science 2020,55(03): 299-307.). Puyan et al verified the transcriptional activity of the promoter in tomato and found that the cloned U3 promoter still has transcriptional activity within 250bp in length (Puyan, North China agricultural science, 2019(1): 33-39.). Based on The requirement of constructing a CRISPR/Cas9 gene editing vector, The length of The used U3/U6 promoter is required to be as short as possible on The basis of ensuring that The promoter has higher transcription activity so as to ensure that The promoter does not contain enzyme cutting sites as far as possible, and The existing research shows that The U6 promoter used for The CRISPR/Cas9 gene editing technology is only 200-400bp long (Fauser et al, The Plant Journal,2014,79(2):348-359.) and even shorter than 100bp (Vladimir et al, Nature biotechnology,2013,31(8): 691-693.). Long et al increased sgRNA expression levels by 6-7 fold and gene editing efficiency by 4-5 fold using the cotton endogenous U6 promoter (Longs et al, Plant methods.2018,14(1): 80.). Liuchuanea capillata et al used the tomato U6 promoter to drive expression of sgRNA, and compared with the U6 promoter of Arabidopsis thaliana, the tomato gene editing efficiency was increased from 63% to 73% (Liuchuanea capillata et al, molecular plant breeding, 2020,18(20): 6716-doped 6724.).
Successfully establishing a CRISPR/Cas9 gene editing system applied to the fraxinus mandshurica provides efficient and reliable technical support for obtaining a fraxinus mandshurica directional mutant library and provides a valuable material basis for deeply researching the fraxinus mandshurica gene function and the development and utilization of gene resources thereof. However, so far, the U6 promoter is still lack of research on fraxinus mandshurica, and the lack of an applicable endogenous U6 promoter which is as short as possible and has high transcription activity has become a restriction factor for the construction of a fraxinus mandshurica CRISPR/Cas9 gene editing system, and also limits the application of the CRISPR/Cas9 system in the aspects of fraxinus mandshurica genetic breeding, germplasm innovation and the like. Therefore, the endogenous FmU6 promoter of the fraxinus mandshurica with high transcription activity is cloned, and the method has important research significance and application value on fraxinus mandshurica CRISPR/Cas9 vector construction, fraxinus mandshurica functional gene research and genetic breeding.
Disclosure of Invention
Aiming at the current research situation, the invention aims to provide a fraxinus mandshurica U6 gene promoter FmU6.3, a cloning method and application thereof.
One of the technical schemes adopted by the invention for solving the technical problems is as follows: provides a promoter proFmU6.3 of an endogenous U6 gene of fraxinus mandshurica, and the nucleotide sequence of the promoter is shown in SEQ ID NO. 1.
Preferably, the promoter proFmU6.3 of the Fraxinus mandshurica U6 gene belongs to the RNA polymerase III type promoter of the Fraxinus mandshurica U6 snRNA gene.
Preferably, the nucleotide sequence of the promoter proFmU6.3 of the fraxinus mandshurica U6 gene comprises 102bp U6 SnRNA.
The second technical scheme adopted by the invention for solving the technical problems is as follows: provides a method for cloning the promoter proFmU6.3 of the ashtree FmU6 gene, which comprises the following steps:
(1) the method comprises the following steps of (1) designing a specific primer by taking the DNA of the aseptic seedling of the fraxinus mandshurica as a template:
proFmU6.3-F:ACCACCGTCGTCTCCTCCA
proFmU6.3-R:CATCCAGAAGTTCACCTAAAGCA
(2) the LA Taq enzyme is used for PCR cloning in a 50 mu L system, and the reaction program of PCR amplification is as follows: pre-denaturation at 95 ℃ for 2min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, 35 cycles, and final extension at 70 ℃ for 10 min.
(3) Cloning the amplified product to pCloneEZ-TOPO vector, transforming Escherichia coli DH5 alpha, selecting recombinant monoclonal sequencing to obtain the promoter proFmU6.3 of the water willow U6 gene with the length of 1442 bp.
The fourth technical scheme adopted by the invention for solving the technical problems is as follows: provides the application of a fraxinus mandshurica U6 gene promoter proFmU6.3 in the technical field of fraxinus mandshurica molecular breeding.
The invention has the following beneficial effects: the RNA polymerase III type promoter of the fraxinus mandshurica U6 snRNA gene, namely fraxinus mandshurica endogenous U6 gene promoter proFm6.3, is obtained by cloning in fraxinus mandshurica for the first time, and the fraxinus mandshurica U6 gene promoter proFm6.3 and GUS gene are fused and expressed to transform fraxinus mandshurica tissue culture seedling, the fraxinus mandshurica U6 gene promoter proFm6.3 can be efficiently expressed on fraxinus mandshurica through transient expression verification, and an efficient promoter sequence is provided for transformation research of fraxinus mandshurica and closely-related plants.
Drawings
FIG. 1 is a Sequence alignment of a promoter proFmU6.3 of a fraxinus mandshurica U6 gene and promoters of Arabidopsis thaliana and soybean U6, wherein, the frame line positions are key elements USE (upstream Sequence element), TATA-like Box and a transcription initiation site of U6 snRNA transcription respectively, and the horizontal line mark position is U6 snRNA;
FIG. 2 is a clone electrophoresis diagram of a promoter proFmU6.3 of a fraxinus mandshurica U6 gene, which shows that a 1442bp fraxinus mandshurica U6 gene promoter proFmU6.3 fragment is obtained by PCR amplification;
FIG. 3 shows GUS staining of aseptic seedlings of Fraxinus mandshurica, and Control is a Control group transiently infected with Agrobacterium GV 3101.
Detailed Description
For better understanding of the present invention, the following embodiments and the accompanying drawings are used to describe the present invention in further detail, but it should be understood by those skilled in the art that the following embodiments are not intended to limit the scope of the present invention, and any changes and modifications made on the basis of the present invention are within the scope of the present invention.
In the following examples, the experimental methods used were all conventional methods unless otherwise specified.
The promoter activity assay vector pNC-121-pro in the following examples is pNC series vectors of NC Biotech, which are used only for repeating the relevant experiments of the present invention and are not used for other purposes.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1:
obtaining a promoter proFmU6.3 of a fraxinus mandshurica U6 gene, and specifically operating as follows:
(1) based on the conservation of the U6 snRNA sequence among different species, the arabidopsis AtU6 snRNA sequence (GTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCATAAATCGAGAAATGGTCCAAATTTT) and the soybean GmU6 snRNA sequence (GTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCACAAATCGAGAAATGGTCCAAATTTT) were used to align with the genomic sequence of ashtree (BLAST). Checking the comparison result, selecting the position with the sequence homology higher than or equal to 99 percent, and carrying out promoter cis-acting element analysis on the 1800bp sequence upstream by using Plant CARE online analysis software. As a result of analysis, the USE (upstream Sequence element) and the TATA-like Box related to the basic transcription were found to be located at 60bp and 30bp upstream of the transcription initiation site of these U6 genes, respectively. One of the promoter sequences was selected and named proFmU6.3.
(2) Taking genome DNA of the aseptic seedling of the fraxinus mandshurica as a template, designing specific primers at the upstream and downstream of a fraxinus mandshurica U6 gene promoter proFmU6.3:
proFmU6.3-F:ACCACCGTCGTCTCCTCCA
proFmU6.3-R:CATCCAGAAGTTCACCTAAAGCA
wherein the downstream primer is positioned at the downstream 300bp of the fraxinus mandshurica snRNA in the genome sequence so as to ensure that the clone sequence comprises the complete 102bp snRNA.
(3) The LA Taq enzyme is used for PCR cloning in a 50 mu L system, and the reaction program of PCR amplification is as follows: pre-denaturation at 95 ℃ for 2min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, 35 cycles, and final extension at 70 ℃ for 10 min.
(4) Cloning the amplified product to pCloneEZ-TOPO vector, transforming Escherichia coli DH5 alpha, picking up recombinant monoclonal for sequencing, and finally obtaining the promoter proFmU6.3 of the Fraxinus mandshurica U6 gene with the length of 1442bp as shown in figure 2.
(5) The promoter sequence is compared with base sequences of AtU6-1, AtU6-26, AtU6-29, soybean GmU6-16g-1, GmU6-16g-2 and GmU6-19g-2 of arabidopsis thaliana by using DNAMAN, and the result shows that the promoter proFmU6.3 sequence of the fraxinus mandshurica U6 gene contains USE elements and TATA-like Box which is a key transcription site of U6 snRNA, as shown in figure 1, and the positions of the two elements in the promoter proFmU6.3 sequence of the fraxinus mandshurica U6 gene are consistent with the positions of the promoter sequences of AtU6-1, AtU6-26, AtU6-29, soybean GmU6-16g-1, GmU6-16g-2 and GmU6-19g-2 of arabidopsis thaliana, which has important significance for the function.
Example 2:
the activity detection of the promoter proFmU6.3 of the fraxinus mandshurica U6 gene is specifically carried out as follows:
(1) construction of an activity detection vector of a fraxinus mandshurica U6 gene promoter proFmU6.3:
specific primers containing homology arms were designed for cloning by homologous recombination with pNC-121-pro (pBI121 framework, GUS reporter gene, replacement of 35S promoter of pBI121 with NC cloning cassette):
pNC-proFmU6.3-F:CAGTGGTCTCTGTCCAGTCCTACCACCGTCGTCTCCTCCA
pNC-proFmU6.3-R:CGGTCTCAGCAGACCACAAGTCATCCAGAAGTTCACCTAAAGCA
(sequences homologous to the pNC-121-pro vector are underlined)
A promoter proFmU6.3 positive recombinant monoclonal plasmid of a fraxinus mandshurica U6 gene is used as a template, PCR amplification is carried out to obtain a proFmU6.3 DNA fragment with homologous arms at two ends, Nimble Mix (A) is used to Mix the fragment with pNC-121-pro plasmid, after sucking and pumping for uniformly mixing for 10-20 times, a PCR instrument is used for processing at 50 ℃ for 45 minutes, and the constant temperature of 4 ℃ is carried out, thus finally obtaining a pNC-121-pro promoter, namely a vector for detecting the activity of the FmU6.3 promoter.
(2) Agrobacterium transformation verification of the fraxinus mandshurica U6 gene promoter proFmU6.3:
the constructed promoter activity detection vector pNC-121-pro: FmU6.3 is transformed into an agrobacterium GV3101 strain, 15d of fraxinus mandshurica seedlings are inoculated as transient transformation explant materials, the agrobacterium is transiently infected, and the fraxinus mandshurica seedlings are taken out after 3 days of co-culture and subjected to GUS staining observation to evaluate the starting capability and the expression activity of the fraxinus mandshurica U6 gene promoter proFmU6.3.
Adding GUS dye solution into the tissue culture seedlings of the fraxinus mandshurica for detection, carrying out vacuum filtration for half an hour, carrying out light-shielding overnight dyeing in a shaking table at 37 ℃, pouring out the dye solution, decoloring with 95% alcohol for 3 days, and observing the GUS dyeing condition. As a control, the staining of ashtree seedlings infected with Agrobacterium tumefaciens without loading GV3101 is shown in FIG. 3.
As can be seen, the invention obtains the RNA polymerase III type promoter of the fraxinus mandshurica U6 snRNA gene, namely the fraxinus mandshurica U6 gene promoter proFmU6.3, and is verified to have the promoter activity. Therefore, the invention provides a high-efficiency promoter sequence for transformation research of fraxinus mandshurica and kindred plants.
While specific embodiments of the present invention have been described above, it will be understood by those skilled in the art that the specific embodiments described are illustrative only and are not limiting to the scope of the invention, and that various modifications and alterations can be made therein by those skilled in the art without departing from the principles of the present invention, which should also be construed as within the scope of the appended claims.
Sequence listing
<110> northeast university of forestry
<120> fraxinus mandshurica U6 gene promoter proFmU6.3, and clone and application thereof
<130> proFmU6.3
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1442
<212> DNA
<213> Fraxinus mandshurica (Fraxinus mandshurica)
<400> 1
accaccgtcg tctcctccac caacaccaac accaacacta cagaaacgca ctacaatggt 60
ttgatgtcac atgttaataa tgagtctcaa tgaaccaaaa tgtcggttac atccatcaaa 120
cacctcacac ccatcccgat tctccaccaa aatttggtca caaatcaacc ctcgagaccc 180
ctaccaccac cattattatc gccgcagcca gacccaccgc cactgcagct agaaaaccca 240
aaacccccca acagcaccaa aaccaccact accaccaaca taagcaccac catctccacc 300
acaaatccac catatccaac acattcaaaa ccaaaacgcg aaacacatct tagatctaaa 360
cacccaaatc acaccgcatc accgctacaa caacgaccac cacccaaaca ccaccactac 420
gagcactgca ccatagcagt gattgcccat gaacaataga tcttctcaat aagagagact 480
tcgttgcgga tcctgtggtg ccgctgcacc aacacaacga catctctctt ggtgaagctt 540
gaaatggttc cgtttcaaac acccacggcc tcgggcgggg caaaaagtga agccccgatt 600
ttgaaaccaa ggaccgttgg gtcgaccacg aagattatca aatggaagtc tcatgggaaa 660
ggtgcaacaa cgacgagaga gagaacggaa atagaaatga attagggttt aatttataat 720
atttaaatat ggattattaa ttaaaacctg acttgattct tgatttatga aaatggaaaa 780
ttaaaatcca ttatagctgt aatttcctca gtaaacggtt ctaaacaagt ttaaggtaga 840
caaaatgaat aaaatgcaaa tcaaatactt tgtaggctca ccaacaaggc ctggcccgta 900
attgaaacta gaagtgaagc ctaagaaccc gagcccaaaa acttaccagt cctattggaa 960
ctgaatctca tatattctag tcccacatcg acaaaaggca gaattccttt gcaatttata 1020
ttgcgattgc tggcaataga gtttgtccct tcggggacat ccgataaaat tggaacgata 1080
cagagaagat tagcatggcc cctgcgcaag gatgacacgc acaaatcgag aaatggtcca 1140
aatttttttt gttcttgaat tcatgtagtt ttccgtagaa aaatcatcct ttggtttttt 1200
tatttttttt gtcgatttgc agtttgtcta tatttttgag gactttggtg agtggttctt 1260
atggacctta atttgatgag gtttttgtca aaaaaccatc tatattgtta gggtttcagg 1320
caagctttat ttattattaa ggtttctatc gcgaaatgac gatttttttc ttttttttcg 1380
gtatgcagtt tcatcgaaat tgttgaggta tttgtcgaat gctttaggtg aacttctgga 1440
tg 1442
Claims (6)
1. A promoter proFmU6.3 of a fraxinus mandshurica U6 gene is characterized in that the DNA nucleotide sequence of the promoter proFmU6.3 is shown as SEQ ID NO. 1.
2. A method for cloning a gene promoter, wherein the method for cloning the fraxinus mandshurica U6 gene promoter proFmU6.3 of claim 1 comprises the following steps:
(1) taking the DNA of the fraxinus mandshurica as a template, designing a specific primer proFmU6.3-F: ACCACCGTCGTCTCCTCCA, proFmU6.3-R: CATCCAGAAGTTCACCTAAAGCA;
(2) performing PCR amplification in a 50 mu L system by using LA Taq enzyme;
(3) cloning the amplified product to pCloneEZ-TOPO vector, transforming Escherichia coli DH5 alpha, selecting recombinant monoclonal sequencing to obtain the promoter proFmU6.3 of the northeast China ash U6 gene with the length of 1442 bp.
3. The method for cloning the promoter proFmU6.3 of the fraxinus mandshurica U6 gene of claim 2, wherein the reaction procedure of PCR amplification in the step (2) is as follows: pre-denaturation at 95 ℃ for 2min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, 35 cycles, and final extension at 70 ℃ for 10 min.
4. The method for cloning the fraxinus mandshurica U6 gene promoter FmU6.3 as claimed in claim 2, wherein the downstream primer is located 300bp downstream of fraxinus mandshurica snRNA in the genome sequence so as to ensure that the cloned sequence contains the complete 102bp U6 snRNA.
5. A method for detecting promoter activity of a fraxinus mandshurica promoter is characterized in that the method is a method for detecting promoter activity of a U6 gene promoter proFmU6.3 in claim 1, and a promoter activity detection vector pNC-121-pro and FmU6.3 are respectively and instantly introduced into fraxinus mandshurica seedlings.
6. The application of the fraxinus mandshurica promoter is characterized in that the fraxinus mandshurica promoter proFmU6.3 of the fraxinus mandshurica U6 gene of claim 1 is applied in the technical field of fraxinus mandshurica molecular breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210336615.6A CN114703189B (en) | 2022-03-31 | 2022-03-31 | Fraxinus mandshurica U6 gene promoter proFMU6.3, cloning and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210336615.6A CN114703189B (en) | 2022-03-31 | 2022-03-31 | Fraxinus mandshurica U6 gene promoter proFMU6.3, cloning and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114703189A true CN114703189A (en) | 2022-07-05 |
| CN114703189B CN114703189B (en) | 2023-05-23 |
Family
ID=82171291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210336615.6A Active CN114703189B (en) | 2022-03-31 | 2022-03-31 | Fraxinus mandshurica U6 gene promoter proFMU6.3, cloning and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114703189B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106232803A (en) * | 2014-02-27 | 2016-12-14 | 孟山都技术公司 | For pinpointing compositions and the method for genomic modification |
| US20170016017A1 (en) * | 2014-07-31 | 2017-01-19 | Michael E Fromm | Method for increasing plant yields |
| CN107567499A (en) * | 2015-03-27 | 2018-01-09 | 纳幕尔杜邦公司 | Soybean U6 small nuclear RNAs gene promoter and its purposes in the constitutive expression of plant MicroRNA gene |
| CN110144353A (en) * | 2019-05-31 | 2019-08-20 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.6 and its clone and application |
| CN110144354A (en) * | 2019-05-31 | 2019-08-20 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.3 and its clone and application |
| CN113999850A (en) * | 2021-11-23 | 2022-02-01 | 云南农业大学 | Potato U6 RNA polymerase III type promoter and cloning and application thereof |
-
2022
- 2022-03-31 CN CN202210336615.6A patent/CN114703189B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106232803A (en) * | 2014-02-27 | 2016-12-14 | 孟山都技术公司 | For pinpointing compositions and the method for genomic modification |
| US20170016017A1 (en) * | 2014-07-31 | 2017-01-19 | Michael E Fromm | Method for increasing plant yields |
| CN107567499A (en) * | 2015-03-27 | 2018-01-09 | 纳幕尔杜邦公司 | Soybean U6 small nuclear RNAs gene promoter and its purposes in the constitutive expression of plant MicroRNA gene |
| CN110144353A (en) * | 2019-05-31 | 2019-08-20 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.6 and its clone and application |
| CN110144354A (en) * | 2019-05-31 | 2019-08-20 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.3 and its clone and application |
| CN113999850A (en) * | 2021-11-23 | 2022-02-01 | 云南农业大学 | Potato U6 RNA polymerase III type promoter and cloning and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 张秋博等: "水曲柳SnRK2B基因和启动子的克隆及分析", 《核农学报》 * |
| 王璇等: "水曲柳节律基因LHY启动子的克隆和功能分析", 《植物生理学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114703189B (en) | 2023-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110747187B (en) | Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method | |
| Ren et al. | Bidirectional promoter-based CRISPR-Cas9 systems for plant genome editing | |
| CN108546716A (en) | A kind of genome edit methods | |
| Lin et al. | Genome editing in plants with MAD7 nuclease | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| WO2018098935A1 (en) | Vector for plant genome site-directed base substitution | |
| CN113999850A (en) | Potato U6 RNA polymerase III type promoter and cloning and application thereof | |
| Sukegawa et al. | Genome editing in rice mediated by miniature size Cas nuclease SpCas12f | |
| CN114540406A (en) | Genome editing expression box, vector and application thereof | |
| CN114703189B (en) | Fraxinus mandshurica U6 gene promoter proFMU6.3, cloning and application thereof | |
| CN114774414B (en) | Fraxinus mandshurica U6 gene promoter proFMU6.5, cloning and application thereof | |
| CN114703187B (en) | Fraxinus mandshurica U6 gene promoter proFMU6.7, cloning and application thereof | |
| CN112662687B (en) | Method, kit and gene for delaying flowering phase of corn | |
| CN114703188B (en) | Fraxinus mandshurica U6 gene promoter proFMU6.6 and cloning and application thereof | |
| CN111269932B (en) | Method for changing cucumber tendril character | |
| CN111909956B (en) | Method for blocking or weakening OsNAC092 gene expression of rice to improve drought resistance of rice | |
| CN112522299A (en) | Method for obtaining rice with increased tillering by using OsTNC1 gene mutation | |
| CN111019967A (en) | Application of GmU3-19g-1 and GmU6-16g-1 promoters in soybean polygene editing system | |
| WO2021223545A1 (en) | Directed evolution method based on primary and secondary replicon of gemini virus | |
| CN117866966B (en) | Betel nut U6 promoter and application thereof | |
| US20220162625A1 (en) | Methods to improve site-directed integration frequency | |
| Reinard et al. | Editing the Genome of Wolffia australiana | |
| Li et al. | Highly efficient multiplex genome editing in dicots using improved CRISPR/Cas systems | |
| CN107022566B (en) | A kind of expression vector and its application in plant gene function research | |
| Li et al. | A Novel Method to Construct Binary CRISPR Vectors for Plant Transformation by Single Round of PCR Amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |